|
| |||||||||||||||||||||||||||||||||
Background Germ-line mutations in the BRCA1 and BRCA2 genes predispose women to breast cancer. BRCA1 mutations are found in approximately 12 percent of women with breast cancer of early onset, and the specific mutation causing a deletion of adenine and guanine (185delAG), which is present in 1 percent of the Ashkenazi Jewish population, contributes to 21 percent of breast cancers among young Jewish women. The contribution of BRCA2 mutations to breast cancer of early onset is unknown.
Methods Lymphocyte specimens from 73 women with breast cancer diagnosed by the age of 32 were studied for heterozygous mutations of BRCA2 by a complementary-DNAbased protein-truncation assay, followed by automated nucleotide sequencing. In addition, specimens from 39 Jewish women with breast cancer diagnosed by the age of 40 were tested for specific mutations by an allele-specific polymerase chain reaction.
Results Definite BRCA2 mutations were found in 2 of the 73 women with early-onset breast cancer (2.7 percent; 95 percent confidence interval, 0.4 to 9.6 percent), suggesting that BRCA2 is associated with fewer cases than BRCA1 (P = 0.03). The specific BRCA2 mutation causing a deletion of thymine (6174delT), which is found in 1.3 percent of the Ashkenazi Jewish population, was observed in 1 of the 39 young Jewish women with breast cancer (2.6 percent; 95 percent confidence interval, 0.09 to 13.5 percent), indicating that it has a small role as a risk factor for early-onset breast cancer. Among young women with breast cancer, there are BRCA2 mutations that cause truncation of the extreme C terminus of the protein and that may be functionally silent, along with definite truncating mutations.
Conclusions Germ-line mutations in BRCA2 contribute to fewer cases of breast cancer among young women than do mutations in BRCA1. Carriers of BRCA2 mutations may have a smaller increase in the risk of early-onset breast cancer.
Mutations in the BRCA1 gene have been linked to half of all cases of familial breast cancer.2,10,11,12,13,14 Among women with cancer of early onset, who were not selected because of a family history, the frequency of germ-line BRCA1 mutations is approximately 12 percent.15,16 The frequency of such mutations in the general population is unknown, making it difficult to calculate the increase in the risk of breast cancer in a carrier who does not have a strong family history of breast cancer. However, the frequency of a specific BRCA1 mutation has been measured in the Ashkenazi Jewish population, both in otherwise unselected subjects and in a cohort of Jewish women with early-onset breast cancer. This mutation, which causes a deletion of adenine and guanine (185delAG), has been found in 1 percent of the Ashkenazi Jewish population17 and 21 percent of young Jewish women with breast cancer.16,18,19,20 It is calculated that the risk of early-onset breast cancer among carriers of the 185delAG mutation is 27 times higher than among noncarriers, suggesting that the age-specific penetrance of this BRCA1 mutation in the Jewish population generally is similar to that predicted from analyses of kindreds with breast cancer.16,17
Genetic-linkage analysis initially suggested that mutations in BRCA2 account for most cases of familial breast cancer in which there is no mutation of BRCA1.3,4,7 However, BRCA2 mutations have been found in only a fraction of kindreds in which BRCA1 mutations are absent,21,22 suggesting that the number of familial cases attributed to BRCA2 mutations has been overestimated. In the kindreds studied to date, BRCA2 mutations appear to confer a high probability of early-onset breast cancer.3,4,21,22 However, a specific BRCA2 mutation that causes a deletion of thymine (6174delT) has been reported in 1.3 percent of the Ashkenazi population23,24 but only 8 percent of Ashkenazi Jewish women with early-onset breast cancer, suggesting that its age-specific penetrance is lower than predicted.25 The relative contributions of BRCA1 and BRCA2 mutations to breast cancer in the general population are thus uncertain. To address this question, we screened the entire coding region of BRCA2 for truncating mutations in a cohort of women with breast cancer diagnosed at or before the age of 32; these women are presumed to be highly likely to have a genetic predisposition.
Methods
Study Patients
A cohort of 418 women with early-onset breast cancer (age at diagnosis, <40 years) has been described.16 This cohort was drawn from women with breast cancer diagnosed between 1981 and 1992 at Boston-area hospitals who provided blood samples for genetic analysis and to whom the results of the analyses were not disclosed. Pathological confirmation of the diagnosis and a clinical and family history were available in every case, along with lymphoblasts immortalized by infection with the EpsteinBarr virus (EBV). The entire BRCA2 coding region was screened for truncating mutations in 73 women with breast cancer diagnosed at or before the age of 32, who represented the subgroup at highest risk for a genetic predisposition. The specific BRCA1 and BRCA2 mutations that are prevalent in the Ashkenazi population were sought in 39 Jewish women with breast cancer diagnosed at or before the age of 40. To determine the population prevalence of the C-terminustruncating mutations in BRCA2 that appear to be silent polymorphisms, we screened specimens from 130 anonymous blood donors. All the specimens used in the study were coded, and the patients' confidentiality was preserved, in accordance with the guidelines for studies of human subjects.
Analysis of Mutations
Since virtually all the BRCA2 mutations reported to date in kindreds with breast cancer result in premature termination of the polypeptide chain, we developed a complementary DNA (cDNA) based protein-truncation assay to screen EBV-immortalized lymphoblasts from women with breast cancer. Total cellular messenger RNA (mRNA) was isolated by standard procedures and reverse-transcribed into cDNA with random hexanucleotide primers.
The entire coding region of BRCA2 spans 10 kilobases (kb); the region was divided into three overlapping fragments (Figure 1) and amplified by the polymerase chain reaction (PCR) in a single multiplex reaction. The primers used were as follows: for fragment I, TGACCGGCGCGGTTTTTGTCAGC (sense) and TGATTATCTAATGCCAAGGTATT (antisense); for fragment II, CTGTCAATCCAGACTCTGAAG (sense) and CAGAAATTCTTGACCAGGTGCGG (antisense); and for fragment III, AACTGACAGATTCTAAACTGC (sense) and AACTGGAAAGGTTAAGCGTCA (antisense). The PCR conditions consisted of 5 cycles (94°C for 20 seconds, 64°C for 1 minute, and 68°C for 8 minutes) followed by 30 cycles (94°C for 20 seconds, 60°C for 1 minute, and 68°C for 7.5 minutes).
|
One microgram of the PCR product was incubated with T7 polymerase, rabbit reticulocyte lysate, and [35S]methionine (Amersham) in a coupled transcriptiontranslation reaction (Promega), followed by electrophoresis with 12 percent polyacrylamidesodium dodecyl sulfate gel. The PCR products that gave rise to truncated peptides were analyzed by automated nucleotide sequencing of both strands, with dye-labeled dideoxy terminators (Applied Biosystems). Uncloned PCR products were analyzed to ensure that both alleles were represented and to avoid Taq polymeraseinduced errors that might be present in individual PCR products. When necessary, potential mutations were confirmed by sequencing multiple cloned PCR products.
To detect the 6174delT mutation, an allele-specific PCR reaction was designed that used four primers in a single reaction. The primers were as follows: primer 1, TGGCAGGTTGTTACGAGGCATTGG (sense); primer 2, TAAATGTTCTGGAGTACGTATAGC (antisense); primer 3, GTGGGATTTTTAGCACAGCAAGTG (sense); and primer 4, CTGATACCTGGACAGATTTTCCCT (antisense). The PCR conditions consisted of 40 cycles (94°C for 30 seconds, 58°C for 30 seconds, and 72°C for 30 seconds). This reaction produces a PCR fragment containing 194 base pairs (bp) that is specific for the wild-type allele, a fragment of 299 bp that is specific for the mutant allele, and a control fragment of 448 or 449 bp that is common to both alleles.
To detect the mutation that causes a substitution of guanine for cytosine (C10152G), an allele-specific reverse-transcription PCR was designed that used the following primers: primer 1, TCTGTTTCCACACCTGTCTCAGC (sense); primer 2, TTTATTGTCGCCTTTGCAAATGC (antisense); primer 3, ACCAAGGAGTTGTGGCACCAAATAC (sense); and primer 4, CAGTTCTTTTTTCTTTATGGGTGTTTCC (antisense). The conditions were identical to those of the 6174delT PCR, except that the annealing temperature was 61°C. This reaction produces a 381-bp fragment specific for the wild-type allele, a 235-bp fragment specific for the mutant allele, and a control fragment of 566 bp common to both alleles.
The mutation that causes a substitution of thymine for adenine at position 10,204 (A10204T) was also detected by an allele-specific reverse-transcription PCR that used primers 1 and 2 as described in the preceding paragraph along with TTCTCCTCAGATGACTCCATTTA (sense) and ttccaaaagagaaattcattgaattttta (antisense). The PCR conditions were identical to those of the 6174delT reaction. This reaction produces a 321-bp fragment specific for the wild-type allele, a 290-bp fragment specific for the mutant allele, and a control fragment of 566 bp common to both alleles.
The BRCA1 mutation at position 5382 that causes an insertion of cytosine (5382insC) was detected by an allele-specific genomic PCR that used the following primers: primer 1, TAAAATGGACGTGTCTGCT (sense); primer 2, CTGCAAAGGGGAGTGGAATACAG (antisense); primer 3, CAAAGCGAGCAAGAGAATCCCA (sense); and primer 4, GAGCTTTACCTTTCTGTCC-TGGGGA (antisense). The PCR conditions were identical to those of the 6174delT reaction. This reaction produces a 100-bp fragment specific for the wild-type allele, a 175-bp fragment specific for the mutant allele, and a control fragment of 233 or 234 bp common to both alleles.
To identify definite mutations in the BRCA1 gene in 43 women who had breast cancer diagnosed between the ages of 30 and 32, we used a novel yeast-based truncation assay.26 In brief, the BRCA1 transcript was divided into three overlapping fragments (comprising codons 1 to 263, 224 to 1365, and 1324 to 1863) that were amplified by reverse-transcription PCR and inserted in the correct reading frame of the yeast gene URA3 by homologous recombination. The URA3 gene confers the ability to grow in the absence of uracil; yeast cells that contain a BRCA1URA3 fusion protein derived from wild-type BRCA1 grow in the absence of uracil, whereas those containing a fusion protein derived from a BRCA1 fragment with a truncating mutation depend for their growth on the presence of uracil. This assay identifies carriers of heterozygous BRCA1 mutations, since in such carriers an average (± SD) of 49 ± 6 percent of the yeast cells containing the BRCA1URA3 fusion protein require uracil for growth.
Statistical Analysis
The prevalence of BRCA1 mutations in the study patients was compared with that of BRCA2 mutations by Fisher's exact test. Exact 95 percent confidence intervals for these prevalence rates were calculated with StatXact 3 (Cytel Software). The risks associated with the two mutations were compared by testing the homogeneity of the odds ratios from tables comparing the rates of each mutation among cases and controls (cohorts of Ashkenazi Jewish women). This test assumes that the mutations are independent (an assumption that is believed to be biologically sound). A test that did not make this assumption but instead assumed that the cohorts are large enough to provide population rates gave similar results.
Results
We have previously described the clinical characteristics of a cohort of 418 women with breast cancer diagnosed at or before the age of 40.16 Among these women, bilateral breast cancer (in 5 percent) and a strong family history of breast cancer (in 7 percent) were clinical features indicating an increased risk for a genetic predisposition. Since virtually all the known BRCA2 mutations (32 of 33) in kindreds with breast cancer result in premature chain terminations,3,4,21,22 we used a protein-truncation assay that detects premature stop codons in the coding sequence of the gene, as described in the Methods section. Mutations identified by this approach were confirmed by nucleotide sequencing.
We initially studied the BRCA2 gene in the youngest subgroup of our cohort, 30 women who had breast cancer diagnosed before the age of 30 and had previously been screened for BRCA1 mutations.16 No BRCA2 mutations were detected. We therefore studied an additional 43 women whose breast cancer was diagnosed between the ages of 30 and 32. We detected two definite BRCA2 mutations in this group. Patient 110 had a deletion of four nucleotides, and Patient 420 had a deletion of two nucleotides. Both deletions were in exon 11 (Table 1), and both caused shifts in the codon reading frame that resulted in premature stop codons. Both women had a history of bilateral breast cancer, but neither had a family history of breast cancer.
|
We compared the frequency of BRCA1 mutations with that of BRCA2 mutations in the cohort of 73 women with breast cancer diagnosed at or before the age of 32. We have previously reported16 four definite BRCA1 mutations in 30 women with breast cancer diagnosed before the age of 30. Using a yeast-based assay for truncating mutations,26 we identified BRCA1 mutations in 5 of 43 women with breast cancer diagnosed between the ages of 30 and 32 (Table 2). Unlike mutations in the extreme C terminus of BRCA2, those in the extreme C terminus of BRCA1 are associated with a high likelihood of breast cancer (Breast Cancer Information Core electronic data base; Internet address, http://www.nchgr.nih.gov/dir/lab_transfer/bic/), indicating that all BRCA1 mutations that cause protein truncation can be considered definite mutations.
|
|
We detected definite germ-line mutations in BRCA2 in 2 of 73 women with breast cancer diagnosed at or before the age of 32 (2.7 percent; 95 percent confidence interval, 0.4 to 9.6 percent). By contrast, in our analysis of the same cohort, we identified definite BRCA1 mutations in 9 of 73 women (12 percent; 95 percent confidence interval, 5.8 to 22 percent), including 4 of 30 women with breast cancer diagnosed before the age of 3016 and 5 of 43 women with breast cancer diagnosed between the ages of 30 and 32. Germ-line mutations in BRCA2 appear to contribute to a smaller fraction of cases of early-onset breast cancer in the general population than do germ-line mutations in BRCA1 (P = 0.03). Although this observation is unexpected, it is consistent with recent studies of kindreds with breast cancer. BRCA1 mutations are present in approximately half of such kindreds,2,10,11,12,13,14 but two recent studies found BRCA2 mutations in only 10 of 75 kindreds in which BRCA1 mutations were absent.21,22 Among patients with early-onset breast cancer in the general population, as well as in selected kindreds with breast cancer, BRCA2 mutations therefore occur approximately one fifth as often as BRCA1 mutations.
The infrequency of BRCA2 mutations among women with early-onset breast cancer may result simply from a low prevalence of these mutations in the population. From epidemiologic models, a frequency ranging from 1 in 400 to 1 in 800 has been calculated for all mutations predisposing women to breast cancer,5 but this estimate has yet to be confirmed by molecular studies, and the relative distribution of BRCA1 and BRCA2 mutations is unknown. However, studies of recurrent mutations in the Ashkenazi Jewish population suggest that mutations in these two genes differ not in their prevalence in the population, but rather in their associated risk for the development of breast cancer. Our analysis of three different mutations in 39 Jewish women with breast cancer diagnosed at or before the age of 40 showed considerable differences in age-specific penetrance. The common BRCA1 mutation 185delAG (which appears in 1 percent of the population17) is associated with an increase in the risk of early-onset breast cancer by a factor of 27 (95 percent confidence interval, 8 to 89). With the less common BRCA1 mutation 5382insC (which appears in 0.1 percent of the population23), the risk may increase by a factor of 20 (95 percent confidence interval, 0.4 to 212). In contrast, the risk of early-onset breast cancer associated with the common BRCA2 mutation 6174delT (which appears in 1.3 percent of the population23,24) is probably only doubled (95 percent confidence interval, 0.05 to 12) (P = 0.0166 for the comparison between the relative risks associated with the two common mutations, 185delAG in BRCA1 and 6174delT in BRCA2). The proportion of BRCA2 mutations as compared with BRCA1 mutations in our cohort of Jewish women with early-onset breast cancer is consistent with that in a large study of familial cases28 and somewhat lower than that in another study of cases with early onset.25 Taken together, these observations suggest that the risk of early-onset breast cancer associated with the BRCA2 mutation 6174delT is 1/10 to 1/5 of the risk associated with recurrent BRCA1 mutations in the Ashkenazi population.
The fact that virtually all BRCA2 mutations cause premature chain termination suggests that their effect on protein function may depend on where they truncate the protein. Like the BRCA2 mutations in Patients 110 and 420 (Table 1), the 6174delT mutation occurs within the large exon 11 and results in the loss of half the encoded protein (Figure 1). For this reason, it and many other BRCA2 mutations that truncate protein segments of comparable size probably have the same age-specific penetrance. In contrast, mutations that truncate the protein at the extreme C terminus, such as C10152G and A10204T in the terminal exon 27, may affect protein function minimally and thus have no effect on the development of breast cancer. These two adjacent mutations were each present in 1 of the 73 women with early-onset breast cancer whom we studied (1.4 percent). Although we did not detect either mutation in 130 healthy persons from the Boston area, A10204T has recently been reported in 2.2 percent of both patients with breast cancer and controls in a study in the United Kingdom, indicating that it is not a risk factor for breast cancer, but rather a silent polymorphism.26
In the absence of information on the functional domains of the protein encoded by BRCA2, further studies will be needed to determine whether silent mutations are restricted to exon 27 or whether other mutations in distal BRCA2 exons are associated with intermediate increases in the risk of breast cancer. The possibilities that the increase in the risk of early-onset breast cancer is smaller with BRCA2 mutations than with BRCA1 mutations and that a number of C terminustruncating mutations in BRCA2 may be functionally silent call for caution in formulating clinical recommendations for carriers of BRCA2 mutations.
Supported by grants from Massachusetts General Hospital and the Monell Foundation (to Drs. Haber and Isselbacher), by a grant (CA60650) from the National Institutes of Health (to Dr. Bowcock), and from the Fonds zur Förderung der Wissenschaftlichen Forschung (Austria) (to Dr. Krainer).
We are indebted to the patients and volunteers who participated in this study and to their referring physicians; to Dr. S. Friend for establishing the germ-line tissue bank; and to S. Hegde, J. Bean, and S. Osborne-Lawrence for technical assistance.
Source Information
From the Center for Cancer Risk Analysis and the Massachusetts General Hospital Cancer Center, Charlestown, Mass. (M.K., S.S.-A., M.G.F., D.J.M., H.U., K.J.I., D.A.H.); the Divisions of Biostatistics (D.M.F.) and HematologyOncology (D.A.H.), Massachusetts General Hospital and Harvard Medical School, Boston; the Department of Clinical Oncology, Tohoku University, Sendai, Japan (A.S., C.I., R.K.); and the Division of Pediatric HematologyOncology, University of Texas Southwestern Medical Center, Dallas (A.B.).
Address reprint requests to Dr. Haber at the Laboratory of Molecular Genetics, Massachusetts General Hospital Cancer Center, CNY 7, Bldg. 149, 13th St., Charlestown, MA 02129.
References
| |||||||||||||||||||||||||||||||||
This article has been cited by other articles:
HOME | SUBSCRIBE | SEARCH | CURRENT ISSUE | PAST ISSUES | COLLECTIONS | PRIVACY | HELP | beta.nejm.org Comments and questions? Please contact us. The New England Journal of Medicine is owned, published, and copyrighted © 2009 Massachusetts Medical Society. All rights reserved. |