Propagation of a Human Herpesvirus from AIDS-Associated Kaposi's Sarcoma
Kimberly E. Foreman, Ph.D., Jacques Friborg, Ph.D., Wing-pui Kong, Ph.D., Clive Woffendin, Ph.D., Peter J. Polverini, D.D.S., Brian J. Nickoloff, M.D., Ph.D., and Gary J. Nabel, M.D., Ph.D.
Background Although unique DNA sequences related to gammaherpesviruseshave been found in Kaposi's sarcoma lesions, it is uncertainwhether this DNA encodes a virus that is able to reproduce.
Methods We isolated and propagated a filterable agent whoseDNA sequences were found to be identical to those of the Kaposi'ssarcomaassociated herpesvirus (KSHV). We obtained early-passagespindle cells from skin lesions of patients with the acquiredimmunodeficiency syndrome (AIDS) who had Kaposi's sarcoma andcultured them with cells of the human embryonal-kidney epithelial-cellline 293. We characterized the virus according to its effectson cellular morphology and viral replication and its appearanceon electron microscopy.
Results KSHV was cytotoxic to 293 cells and was detected bythe polymerase chain reaction (PCR) in infected cells but notuninfected ones. Cytotoxicity and positive PCR signals wereconsistently maintained with viral titers of 1 million per milliliteror higher for about 20 serial infections of 293 cells. The viralcopy number was relatively low (1 to 10 copies per cell). Viralreplication was confirmed by Southern blot analysis of DNA isolatedfrom the enriched nuclear fraction of infected cells and bya semiquantitative PCR using dilutions of the lysates of infectedcells to detect the 233-bp viral DNA fragment originally describedin association with Kaposi's lesions. Electron microscopy revealedherpesvirus-like particles in about 1 percent of cells frominfected cultures, as compared with none in cells from uninfectedcultures.
Conclusions A herpesvirus with DNA sequences identical to thoseof KSHV can be propagated from skin lesions of patients withAIDS-associated Kaposi's sarcoma. (N Engl J Med 1997;336:163-71.)
Kaposi's sarcoma was originally described in the late 1800sas a rare neoplasm predominantly affecting elderly men of Jewishor Mediterranean descent. Currently, Kaposi's sarcoma is themost common cancer in patients with the acquired immunodeficiencysyndrome (AIDS), affecting approximately 20 percent of personswith human immunodeficiency virus type 1 (HIV-1) infection.1,2,3Epidemiologic data have suggested that an infectious agent couldspread the disease through sexual contact,4 but the etiologicagent has not been identified. Several viruses, including cytomegalovirus(CMV), hepatitis B virus, and human papillomavirus, have beenfound in patients with Kaposi's sarcoma. Recently, Chang etal. found that over 90 percent of the tissue samples they studiedfrom patients with AIDS-associated Kaposi's sarcoma were positivefor herpesvirus-like DNA sequences.5 These sequences were homologousto, but distinct from, minor capsid and tegument proteins ofEpsteinBarr virus (EBV) and herpesvirus saimiri.5 Theydefined a putative new member of the gammaherpesvirus family,referred to as Kaposi's sarcomaassociated herpesvirus(KSHV) or human herpesvirus 8 (HHV-8). Since then, investigatorsin several laboratories have found these DNA sequences in patientswith four types of Kaposi's sarcoma the classic one,the one endemic in Africa, the iatrogenic one, and the one associatedwith AIDS6,7,8 as well as in patients with body-cavitybasedlymphomas.9,10,11
It is uncertain whether these DNA sequences encode a replication-competentvirus or represent a replication-defective, adventitious viruspresent in patients with Kaposi's sarcoma. Although B-cell linesthat carry the virus have been identified,10,11 neither viralreplication in vitro nor serial propagation of the virus incell lines has been demonstrated. In this study we demonstratethe propagation of a human herpesvirus from AIDS-associatedKaposi's sarcoma.
Methods
Cell Culture, Isolation of DNA, and Analysis by the Polymerase Chain Reaction
Kaposi's sarcoma cell lines were isolated independently fromspecimens of Kaposi's sarcoma skin lesions obtained at biopsyfrom five HIV-infected patients,12 all of whom had multiplelesions, diminished CD4 cell counts, and other signs of AIDS.For some patients, two biopsy specimens were evaluated. Thecells were plated in tissue-culture dishes coated with microvascularendothelial-cell attachment factor (Cell Systems, Kirkland,Wash.) and were maintained as previously described,12,13 butwithout the addition of medium conditioned by cells infectedwith the human T-cell lymphotropic virus type II (HTLV-II).
The polymerase chain reaction (PCR) was performed with KSHV-specificprimers.5 Either genomic DNA or Hirt supernatants thatis, episomal DNA from infected cells were isolated fromtissue-culture cells as previously described.14,15,16 PCR wasperformed as previously described to detect human herpesvirus6 (HHV-6), EBV, and herpes simplex virus types 1 and 2 (HSV-1and HSV-2).17,18,19 CMV was detected with the following primersfrom the intron of an immediate early gene, under standard conditions:5'CCAAGCTTCCACGCTGTTTTGACCTCCATAGA3' (sense) and 5'CCAAGCTTCTGTCAGCTATTATGTCTGGTGGC3'(antisense); a 908-bp product was generated. Positive controlsfor these known herpesviruses were obtained from paraffin-embeddedtissue samples and from the EBV-transformed B-cell line M16B.The sensitivity of the PCR was 0.1 to 1 fg of DNA.
In a semiquantitative PCR, the 233-bp fragment of viral DNAoriginally described in association with Kaposi's sarcoma lesions5(Genbank accession number U18551, base pairs 987 to 1219) wasquantitated by electrophoresis with ethidium-stained agarosegel and spectroscopy in serial dilutions. PCR was performed,followed by Southern blot hybridization with a form of the same233-bp DNA fragment that was radiolabeled with phosphorus-32.Each PCR used DNA from 100,000 cells, purified by phenolchloroformextraction. The range of the DNA concentration measurable inthe assay was 0.001 to 1 fg (4 to 4000 copies).
Propagation of Virus from Cocultures and Serial Passage
Cells from primary Kaposi's sarcoma lesions (200,000 cells,passaged no more than three times after the cells from the biopsysamples were plated) were incubated with 2 million cells ofthe human embryonal-kidney epithelial-cell line 293 (293 cells)in 35-mm six-well Costar plates, either stimulated before culturewith tumor necrosis factor (200 IU per milliliter) or unstimulated.The 293 cells (provided by Dr. Garry Nolan) were grown in Dulbecco'smodified Eagle's medium supplemented with fetal-calf serum (10percent), antibiotics, and l-glutamine. To release viral particles,cell-free lysates from the 293 cells were prepared by threecycles of freezing and thawing in dry ice and ethanol and awater bath at 37°C three to five days after the initialcoculture with the Kaposi's sarcoma cells. After lysis of thecells, the extracts were centrifuged at 10,000 x g for 10 minutes,then filtered through a 0.45-µm membrane.
For the serial propagation of virus, cell-free lysates wereprepared from infected 293 cells by this method on day 3 afterinfection, while a duplicate cell culture was maintained toconfirm subsequent cytotoxicity. No viable cells were detectedin the lysates by staining with trypan blue, and positivityfor KSHV DNA was confirmed in the lysates by PCR. Virus waspropagated serially in an equivalent number of 293 cells forapproximately 20 passages. Viral titers were estimated by incubatingthe infected lysates in progressive dilutions (10-2 to 10-10)with 293 cells. Human umbilical-vein endothelial cells werepropagated as previously described.20
Treatment of Extracellular Virions with Nuclease
To confirm that viral DNA was protected by components of theviral structure, isolated virions were digested with RNase-freeDNase (1 U per milliliter; Promega) and pronase (1 mg per milliliter),which together should degrade free or protein-associated DNA.Some virions were incubated in addition with a nonionic detergent,1 percent Nonidet P-40 (NP40), which disrupts the lipid bilayerof the viral envelope11,21 and allows DNase and pronase to degradevirion-associated DNA. The supernatants of infected culturesof 293 cells were centrifuged for 10 minutes at 3000 rpm andfiltered through a 0.45-µm membrane. To prevent the potentialcarryover of viral DNA, the supernatants were ultracentrifuged(25,000 x g) at 4°C (SW 28 rotor, Beckman) to pellet theviral particles. Before analysis, the particles were washedonce with phosphate-buffered saline (PBS).
Electron Microscopy
Cells from the in vitro cultures described above were rinsedwith PBS, and monolayers were fixed in 2.5 percent glutaraldehydein PBS (pH 7.4) for five minutes at 4°C. The cells werethen resuspended, centrifuged into pellets at 300 x g, and incubatedfor two hours at 4°C. The samples were rinsed, dehydrated,and embedded in epon. The specimens were sectioned, stainedwith uranyl acetate and lead citrate, and examined with a Zeiss109 transmission electron microscope. In some instances, thecells were incubated for 12 hours with brefeldin A (0.3 µgper milliliter), an inhibitor of Golgi transport, added 24 hoursafter infection. This treatment improved the visualization ofvirions.
Results
Characterization of KSHV DNA in Isolated Kaposi's Sarcoma Cells
To establish Kaposi's sarcoma cell lines in vitro, we developedconditions for cell culture that did not require the presenceof medium conditioned with HTLV-IIinfected cells, unlikethe culture conditions in previous studies.12,13 Kaposi's sarcomacell lines grew rapidly after the initiation of the cultures.Each was positive for clotting factor XIIIa and vascular-celladhesion molecule 1 on immunohistochemical staining and negativefor factor XIIIs, E-selectin, CD31, factor VIII, and CD34 (datanot shown), as is consistent with the phenotype of isolatedKaposi's sarcoma cells studied under different conditions ofculture.12,22
PCR was used to determine whether the proliferating Kaposi'ssarcoma cells contained recently described herpesvirus-likeDNA sequences.5 Early-passage, isolated Kaposi's sarcoma celllines from six of the seven specimens obtained were positivefor these DNA sequences (Table 1). The positive signal was presentin the cell lines until passage 2 or 3 and could not be detectedthereafter. The 233-bp PCR product was also found in DNA isolatedfrom two paraffin-embedded samples of tissue from a differentpatient who had pulmonary Kaposi's sarcoma, as has been describedin other patients.5,6 No evidence of KSHV DNA sequences wasdetected in human umbilical-vein endothelial cells, 293 cells,or DNA isolated from paraffin-embedded tissue from a patientwith psoriasis (Table 1). To determine whether other herpesviruseswere present in these samples, PCR was performed to detect viralsequences of HHV-6, HSV-1, HSV-2, CMV, and EBV. DNA from thesamples of Kaposi's sarcoma cells was negative for each of thesesequences (Table 1). In addition, there was no evidence of mycoplasma,HIV, or adenovirus in freshly derived Kaposi's sarcoma cellsor viral isolates (data not shown).
Table 1. Presence of KSHV and Other DNA Sequences in Isolated Cell Lines.
Propagation of Lytic Virus
Early-passage Kaposi's sarcoma cells were cocultured for twoto seven days with various types of cells, including human epithelial-celllines (HeLa, 293, and A431 cells), human umbilical-vein endothelialcells, porcine endothelial cells, and human or porcine vascularsmooth-muscle primary cells. Genomic DNA was isolated from thecocultures and analyzed for KSHV DNA sequences by PCR. Consistentlystrong PCR signals were found on day 2 in DNA isolated fromcocultures of Kaposi's sarcoma cells with 293 cells, whereasthe DNA from the co-cultures with other types of cells was negative.In the 293 cells, the PCR signal was detected as Kaposi's sarcomacells were lost from the culture (on days 4 and 5) and was accompaniedby progressively increasing signs of cytotoxicity in the cellculture (Figure 1A and Figure 1B). Light-microscopical analysisof uninfected 293 cells showed viable epithelial cells withround nuclei that contained evenly distributed chromatin andprominent nucleoli (Figure 1B). In contrast, after exposureto the infected-cell lysate, the 293 cells showed substantialcytopathic changes, beginning as early as day 2. Groups of infected293 cells contained multinucleated giant cells (Figure 1B).In addition, certain cells had nuclear molding or dense, chromatin-likematerial at the margin of the nucleus, and the chromatin wasdissolving, with residual chromatin forming a margin along thenuclear membrane (Figure 1B). By day 5, virtually all the cellsunderwent condensation of chromatin and other morphologic changesconsistent with cell death (Figure 1A and Figure 1B). Thesefindings suggested that the positive PCR signals were probablydue to transmission of virus rather than to persistent DNA sequencesfrom the primary Kaposi's sarcoma cell line. PCR signals werevariably observed in the human umbilical-vein endothelial cells,but there was no consistent cytopathic effect. We thereforefocused our efforts on the 293 cells as host cells for viralreplication.
Figure 1. Cytotoxic Effect on 293 Cells of Virus Propagated in Vitro.
Panel A shows uninfected 293 cells and cells exposed to virus (infected) after incubation in vitro for the numbers of days shown, as analyzed by phase-contrast microscopy. The degree of cytotoxicity observed in the infected cells was graded as + on day 3, ++ on day 4, and +++ on day 5 (x10).
Panel B shows the typical light-microscopical appearance of 293 cells before exposure to lysate and five days thereafter. The uninfected cells appear uniformly viable, with typical epithelial differentiation, but the infected cells have undergone degeneration, with the formation of multinucleated giant cells (black arrows) and the alteration of chromatin typical of infection by a virus of the herpes group (white arrows) (left, x400; middle, x200; right, x400).
Propagation of Virus by Serial Infection of 293 Cells
To propagate the virus further, we prepared cell-free lysatesfrom cocultures of Kaposi's sarcoma cells with 293 cells atvarious times after incubation, and the 293 cells were infectedboth in the presence and in the absence of tumor necrosis factor. No PCR signals were detected in the uninfected cells, butsignals were readily detected in the infected 293 cells withinone day after infection (Figure 2A). Signals were detected morereadily in the nuclear fraction and were weaker in the cytoplasm(Figure 2B). Hirt supernatants that is, episomal DNAisolated from infected cells contained KSHV DNA sequencesby PCR. The signals were maximal three days after the viralchallenge, diminishing by day 5 (Figure 2A).
Figure 2. Detection of KSHV DNA Sequences in 293 Cells after Coculture with Kaposi's Sarcoma Cells.
Viral DNA was detected by PCR in Hirt supernatants of 293 cells (Panel A) on the indicated days after infection, but not in uninfected cells, and with DNA isolated from the enriched subcellular fractions on day 3 (Panel B). In both panels, the arrows indicate the specific 233-bp DNA fragment; the plus signs, a positive control sample from a Kaposi's sarcoma lesion; and the minus signs, DNA from uninfected 293 cells. M denotes molecular-size marker. The amount of DNA used in each PCR analysis (1 or 0.1 µg) is shown.
Panel C shows the results of Southern blot analysis of genomic DNA (10 µg) isolated from uninfected and infected 293 cells. Viral DNA sequences were detected without PCR amplification from uninfected cells (lane 1) and from cells three days after infection with passage 5 virus (lanes 2 and 3), probed either without digestion (lane 2) or after digestion with BamHI (lanes 1 and 3). The arrow indicates the 330-bp product expected after digestion with BamHI.
Panel D shows an analysis of the cytotoxicity and PCR reactivity of 293 cells after incubation with cell-free lysates (passage 5) at the dilutions shown. In the study of reactivity, ethidium bromide staining and Southern blot hybridization were used. No signal was detected by Southern blot analysis of the PCR product in uninfected cells (see Panel A, lane 2, and Panel B, lane 13). The degree of cellular cytotoxicity was determined by light microscopy and graded as in Figure 1. PCR was performed with 1 µg of DNA isolated on day 3 from the enriched nuclear fraction of infected cells. PCR fragments and genomic DNA were transferred to nylon membranes (Genescreen Plus, Dupont) and hybridized to oligolabeled probe derived from the 233-bp PCR fragment under standard conditions.
Although virus could be detected in the cell-culture supernatantsand passaged serially, the cell lysates consistently had viraltiters two to three orders of magnitude higher than the supernatants(data not shown), and the lysates were therefore used in furtherstudies. With the PCR we could also amplify regions of the thymidinekinase gene, the putative principal capsid protein, and glycoproteinH. These regions were visualized by staining with ethidium bromideafter 30 cycles in at least three separate experiments (datanot shown). No PCR signals from other known herpesviruses weredetected in serially passaged viral isolates, although theywere detected readily in positive control tissues and cell linesinfected with the relevant viruses. In particular, there wasno PCR evidence of EBV in either the primary early-passage Kaposi'ssarcoma cell lines or subsequent serially passaged virus (withas many as 20 passages) (data not shown).
Southern blot analysis of DNA prepared from enriched nucleiisolated from 293 cells confirmed that in passage 5 virus, viralDNA was amplified by a factor of 1000 or more after infection(Figure 2C), as was consistent with the results of semiquantitativePCR (Figure 2A and Figure 2B). Moreover, when 293 cells wereincubated with infected-cell lysates at increasing dilutions,the development of cytotoxicity correlated with the magnitudeof the signal for KSHV that could be detected by Southern blotanalysis of the PCR product (Figure 2D). Cytotoxicity and positivePCR signals for KSHV were consistently maintained with viraltiters of 1 million per milliliter or more, as determined bythe dilution at which no cytotoxicity was seen, for approximately20 serial infections of 293 cells. The transfer of the cytotoxiceffect among the cell cultures and the PCR signals after serialpassage were maintained consistently after the infected-celllysates were filtered through a 0.45-µm membrane, butthese characteristics disappeared after inactivation by heat(data not shown). Under identical culture conditions, serialpassages of KSHV derived from body-cavitybased lymphomaswere unsuccessful, and no cytotoxicity was seen (unpublisheddata).
Replication of Viral DNA in Infected Cells and Sensitivity of Virus to Treatment with Nuclease
To passage the virus serially, we prepared cell lysates frominfected 293 cells on day 3, before the generation of cytotoxicity.Although tumor necrosis factor enhanced viral replication duringthe coculture of primary Kaposi's sarcoma cells and 293 cells,it did not increase cytotoxicity or viral titers during serialpassage of 293 cells and thus was not used further. Replicationof viral DNA was confirmed by semiquantitative PCR. With thistechnique, as little as about 0.001 fg of viral DNA (or aboutone copy per 100,000 infected cells) could be detected. Afterone hour of incubation with infected-cell lysates from passage15 (a 10-2 dilution, containing 1000 to 10,000 viral-genomeequivalents), followed by extensive washing with Dulbecco'smodified Eagle's medium, viral DNA was barely detectable inthe infected cells four hours after the removal of the viralsupernatant. By 24 hours, a definite signal was detected. Thepeak replication was observed two days after infection, withamplification of viral DNA increased by at least three ordersof magnitude.
Exposure to a smaller quantity of lysate in a 10-4 dilution(containing 10 to 100 viral-genome equivalents) revealed sustainedbut decreased peak replication of viral DNA (Figure 3A and Figure 3B),which may have been due to a slower spread in the infectedcell culture and to reduced cytotoxicity. No viral DNA was detectedin uninfected cells (Figure 2A and Figure 3A). Thus, for thecultures of 293 cells exposed to infected lysates (passage 15),there was a period in which the viral titer was minimal, followedby one in which it increased exponentially, providing evidencethat this virus is competent to replicate. Analysis of passage1 and passage 5 virus showed a similar increase in the synthesisof viral DNA in infected 293 cells (Figure 3C). These resultsare representative of those obtained with at least six infectionsin which virus from different passages (from passage 2 to passage22) was studied by PCR. At least three primary isolates of thevirus with similar properties have now been obtained and propagated(data not shown). Quantitation of the Southern blot signal suggestedthat there was a relatively low copy number of viral genomesin each cell (on average, 1 to 10 copies per cellular genome;data not shown), as is consistent with results of quantitativePCR and electron-microscopical data.
Figure 3. Replication of Viral DNA in 293 Cells and Analysis of Extracellular Viral Particles.
Panel A shows the course of viral propagation over time in infected 293 cells, as estimated by semiquantitative PCR. A Southern blot analysis of the PCR product amplified from DNA extracted from cells (passage 15) after infection with two dilutions of virus (10-2 and 10-4) is shown at the top. DNA from cultures of infected cells was isolated at various times, extracted, precipitated with ethanol, and amplified by PCR. For comparison, a known amount of DNA (the same 233-bp PCR product) was quantitated in the presence and absence of cellular DNA lysate isolated from 100,000 uninfected cells. Viral-genome equivalents were calculated with standards containing cellular DNA. The quantity of the viral PCR product was standardized initially by ethidium agarose-gel electrophoresis and spectrophotometry. DNA from cells infected with virus at two dilutions (10-2 and 10-4) was extracted 4, 24, 48, 72, and 96 hours after infection (lanes 1 through 5). Positive controls containing various amounts of DNA (the 233-bp KSHV PCR product from a Kaposi's sarcoma lesion) are shown in lanes 6 through 9, and a negative control sample with buffer alone is shown in lane 10. Samples purified by phenolchloroform extraction were subjected to PCR as described in the Methods section. Specific hybridization is shown of PCR products from the infected cell extracts and the positive control DNA to the 32P-labeled 233-bp PCR product from a Kaposi's sarcoma lesion after transfer of the gel to nylon membranes.
Panel B shows copy numbers of viral genomes estimated by semiquantitative PCR at various times after infection, as quantitated from Panel A by phosphor imaging. The copy numbers were calculated on the basis of image analysis by a PhosphorImager (Molecular Dynamics) and compared with the standards in Panel A.
Panel C shows the kinetics of viral DNA synthesis in earlier-passage cells, derived from passages 1 and 5. In these infections, a 10-2 dilution of cellular lysate prepared from approximately 2 million infected 293 cells was incubated with the same number of uninfected 293 cells.
To determine whether the virus particles released from infectedcells contained KSHV DNA, pelleted virus was subjected to treatmentwith DNase and pronase,11 with or without prior exposure toNP40, and was then analyzed by PCR and Southern blotting. TheKSHV DNA from passage 15 in the preparation treated with pronaseand DNase was resistant to nuclease digestion. In contrast,no PCR signal was detected in the preparation exposed to NP40before treatment with DNase and pronase (Figure 4A). This findingprovides evidence that the DNA is protected from the combinedaction of a protease and DNase by a virus-associated membrane.Furthermore, transmission of KSHV DNA in 293 cells was demonstratedat passage 22 after treatment with DNase alone (Figure 4B),indicating that filtered and DNase-treated viral particles retainedtheir infectivity. In this experiment, but not routinely, thepreparation of virions was also treated with RNase-free DNase(1 U per milliliter, Promega). Similar results were observedwith passage 15 virus.
Figure 4. Nuclease Sensitivity Assays for Enveloped Virions Derived from Infected 293 Cells.
Panel A shows the results of an assay in which particles from the culture fluids (passage 15) of infected cells were concentrated and incubated both without NP40 (lane 1) and with NP40 (lane 2), as described.11,21 Each preparation was then exposed to pronase and digested with DNase before the extraction of nucleic acid. The isolated DNA underwent PCR amplification, and specific hybridization of PCR products to the 32P-labeled 233-bp KSHV DNA probe was performed as described in the Methods section.
Panel B shows the results of an assay in which particles from culture fluids (passage 22) of infected 293 cells were concentrated and incubated at 37°C for 30 minutes both with and without DNase. Equal numbers of 293 cells were exposed to each viral preparation, and DNA was extracted 4 hours (lanes 1 and 3) and 48 hours (lanes 2 and 4) after infection. Purified samples were amplified by PCR, and specific hybridization of PCR products was performed as described in the Methods section.
Electron Microscopy of Infected 293 Cells
To further document the presence of the virus after serial propagation,we performed additional analyses using electron microscopy.In early-passage Kaposi's sarcoma cells, particles were foundin the cytoplasm whose size and structure were consistent withthose of herpes virions (Figure 5A). Electron-microscopicalanalysis of 293 cells infected with viral lysate (passage 5)revealed multiple particles that resembled viral nucleocapsids(Figure 5B). These viral nucleocapsids containing electron-densecores (approximately 100 nm in diameter) were observed in nucleiof infected cells, but not those of uninfected cells, as soonas two days after exposure to lysate (Figure 5C). Furthermore,enveloped virions (approximately 140 nm in diameter) were detectedin the perinuclear cisternae and the cytoplasm of infected 293cells (Figure 5D and Figure 5E). We estimated that about 1 percentof cells in the infected cultures contained herpesvirus-likeparticles, but none of the cells in the control cultures containedsuch particles (300 cells were analyzed in each group).
Figure 5. Electron-Microscopical Analyses of Cultures of Infected 293 Cells.
Panel A shows a herpesvirus-like particle in the cytoplasm of a passage 2 Kaposi's sarcoma cell (x70,000). Panel B shows a 293 cell two days after exposure to infected cellular lysate. Margination of the chromatin is readily apparent, and nucleocapsids (arrows) are detectable within the nuclei (x12,900). Panel C shows a higher magnification of a typical viral nucleocapsid with an electron-dense central core (approximately 100 nm, x67,840). Panel D shows a representative enveloped virion in the cytoplasm of an infected 293 cell (x82,400). Panel E shows an enveloped viral particle in the perinuclear cisternae of an infected 293 cell (x82,400). The cells shown in Panels D and E were incubated with brefeldin A, as described in the Methods section.
Discussion
Since DNA sequences associated with Kaposi's sarcoma were firstdescribed, several reports have either supported6,7,8,23,24,25or challenged26,27 the notion that this novel DNA virus is importantin Kaposi's sarcoma. We used early-passage cell lines from biopsyspecimens of Kaposi's sarcoma skin lesions as a source of thevirus and defined conditions that allowed it to be propagatedin vitro. KSHV DNA sequences were detected by PCR in early passagesof these cell lines (in six of seven primary cultures), andthese sequences resembled previously described herpesvirus-likeDNA sequences.28,29 It is noteworthy that the PCR signal disappearedfrom the primary Kaposi's sarcoma cell lines by passage 3 or4, suggesting that viral replication in these cultures was limited.In coculture experiments, the virus was transmitted to the embryonal-kidneyepithelial-cell line 293 in a manner that correlated with thepresence of the viral PCR signal. In addition, substantial cytotoxicitywas observed, which could be due to the direct toxic effectsof viral proteins on infected cells or, indirectly, to the releaseof cytokines, as noted in the case of EBV infections,30 to thepresence of soluble factors, or to the action of virus particleson uninfected cells in the culture. Because a small fractionof cells appear to be infected (0.1 to 1 percent) at the timecytotoxicity is observed, it is likely that this effect is largelyindirect.
Independent evidence of the presence of the virus was obtainedby analysis of viral DNA, studies of cellular morphology, andelectron microscopy. Although replication of viral DNA was repeatedlydemonstrated by PCR, the viral copy number was relatively low(1 to 10 copies per cell). For this reason, Southern blottingfor the routine detection of virus was not feasible, althoughthe virus was detectable by this technique in larger-scale preparations(Figure 2C). The disappearance of viral DNA (Figure 3B and Figure 3C)was probably due to the cytotoxic effects observed in theculture, with the release of nucleases, proteases, and lipasesthat may degrade cell-associated viral DNA. Although KSHV appearsto replicate with a low copy number, the features we observedare consistent with previous reports based on DNA analysis andin situ hybridization of Kaposi's sarcoma tissue.5,31
Renne et al.11 have described a body-cavitybased lymphomathat contains KSHV. Contrary to Cesarman et al. in an earlierreport,10 they showed that a lymphoma that carries KSHV DNAis devoid of EBV sequences. Although the formation of viruswas induced in a proportion of cells (5 to 10 percent) by treatmentwith phorbol 12-myristate 13-acetate,11 serial passage of replication-competentvirus was not demonstrated. Another report suggested that transienttransmission of KSHV derived from an EBV-containing B-cell lymphomaline was observed, but that virus also could not be propagatedserially.32 We studied and propagated KSHV from primary Kaposi'ssarcoma lesions. Further research is needed to clarify the relationbetween the viruses in body-cavitybased lymphomas andthose in primary Kaposi's sarcoma lesions.
Despite our ability to propagate this virus in vitro and itsclose association with the presence of Kaposi's sarcoma in vivo,33,34whether KSHV has a causal role in the disease remains uncertain.The ability to propagate KSHV should facilitate the developmentof diagnostic reagents, allow more detailed study of the associationof the virus with Kaposi's sarcoma lesions, and improve ourunderstanding of how people respond after exposure to the virus.Finally, it remains uncertain whether the pathogenesis of Kaposi'ssarcoma derives from its ability to transform primary cellsin vivo or whether the sarcoma represents an immune-mediatedinflammatory and angiogenic response to virally infected cells.The fact that cloned viral isolates can be maintained and propagatedshould facilitate further study of the molecular regulationof the virus and help define its role in the causation and pathogenesisof Kaposi's sarcoma.
Supported in part by grants (AR40488, CA64416, and CA70057 [toDr. Nickoloff] and AI36207 and CA46592 [to Dr. Nabel]) fromthe National Institutes of Health.
We are indebted to Drs. Clay Flowers and Oveta Fuller for helpfuldiscussions; to Donna Gschwend and Nancy Barrett for the preparationof the manuscript; to Philip Simonian for DNA-sequence analysis;to Drs. Carol A. Kauffman and Powel H. Kazanjian for the referralof patients; and to Robin Kunkel, Barbara Rogers, Theodore Beals,and Paula Kovarik for the preparation and analysis of the electron-microscopicalspecimens.
Source Information
From the Department of Pathology, Skin Disease Research Laboratories, Cardinal Bernardin Cancer Center, Loyola University Medical Center, Maywood, Ill. (K.E.F., B.J.N.); and the Departments of Internal Medicine and Biological Chemistry (J.F., W.K., C.W., G.J.N.) and Oral Pathology (P.J.P.), Howard Hughes Medical Institute, University of Michigan Medical Center, Ann Arbor.
Address reprint requests to Dr. Nabel at University of Michigan Medical Center, MSRBI, Rm. 4520, 1150 W. Medical Center Dr., Ann Arbor, MI 48109-0650.
References
Beral V, Peterman TA, Berkelman RL, Jaffe HW. Kaposi's sarcoma among persons with AIDS: a sexually transmitted infection? Lancet 1990;335:123-128. [CrossRef][Medline]
Safai B, Johnson KG, Myskowski PL, et al. The natural history of Kaposi's sarcoma in the acquired immunodeficiency syndrome. Ann Intern Med 1985;103:744-750.
Beral V, Jaffe H, Weiss R. Cancer surveys: cancer, HIV, and AIDS. Eur J Cancer 1991;27:1057-1058.
Beral V. Epidemiology of Kaposi's sarcoma. Cancer Surv 1991;10:5-22. [Erratum, Cancer Surv 1992;12:225a.] [Medline]
Chang Y, Cesarman E, Pessin MS, et al. Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposi's sarcoma. Science 1994;266:1865-1869. [Free Full Text]
Huang YQ, Li JJ, Kaplan MH, et al. Human herpesvirus-like nucleic acid in various forms of Kaposi's sarcoma. Lancet 1995;345:759-761. [CrossRef][Medline]
Moore PS, Chang Y. Detection of herpesvirus-like DNA sequences in Kaposi's sarcoma in patients with and those without HIV infection. N Engl J Med 1995;332:1181-1185. [Free Full Text]
Ambroziak JA, Blackburn DJ, Herndier BG, et al. Herpes-like sequences in HIV-infected and uninfected Kaposi's sarcoma patients. Science 1995;268:582-583. [Free Full Text]
Cesarman E, Chang Y, Moore PS, Said JW, Knowles DM. Kaposi's sarcoma-associated herpesvirus-like DNA sequences in AIDS-related body-cavity-based lymphomas. N Engl J Med 1995;332:1186-1191. [Free Full Text]
Cesarman E, Moore PS, Rao PH, Inghirami G, Knowles DM, Chang Y. In vitro establishment and characterization of two acquired immunodeficiency syndrome-related lymphoma cell lines (BC-1 and BC-2) containing Kaposi's sarcoma-associated herpesvirus-like (KSHV) DNA sequences. Blood 1995;86:2708-2714. [Free Full Text]
Renne R, Zhong W, Herndier B, et al. Lytic growth of Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) in culture. Nat Med 1996;2:342-346. [CrossRef][Medline]
Huang YQ, Friedman-Kien AE, Li JJ, Nickoloff BJ. Cultured Kaposi's sarcoma cell lines express factor XIIIa, CD14, and VCAM-1, but not factor VIII or ELAM-1. Arch Dermatol 1993;129:1291-1296. [Erratum, Arch Dermatol 1993;129:1622.] [Free Full Text]
Yang J, Xu Y, Zhu C, Hagan MK, Lawley T, Offermann MK. Regulation of adhesion molecule expression in Kaposi's sarcoma cells. J Immunol 1994;152:361-373. [Abstract]
Eizuru Y, Inagawa S, Minamishima Y. Application of "Hirt supernatant" DNA to the molecular epidemiology of cytomegalovirus infections. J Clin Microbiol 1984;20:1012-1014. [Free Full Text]
Pater MM, Hyman RW, Rapp F. Isolation of herpes simplex virus DNA from the "Hirt supernatant." Virology 1976;75:481-483. [Medline]
Coen DM. Quantitation of rare DNAs by PCR. In: Ausubel FM, Brent R, Kingston RE, et al., eds. Current protocols in molecular biology. Vol. 2. New York: Greene Publishing, 1992:15.3.1-15.3.8.
Sa'Adu A, Thomson BJ, Bountiff L, Webster AD. Lymphotropic viruses in "common variable" immunodeficiency -- PCR analysis of lymphocyte DNA for HIV-1 and HHV-6. Clin Exp Immunol 1993;91:50-53. [Medline]
Cao M, Xiao X, Egbert B, Darragh TM, Yen TS. Rapid detection of cutaneous herpes simplex virus infection with the polymerase chain reaction. J Invest Dermatol 1989;92:391-392. [CrossRef][Medline]
Apolloni A, Sculley TB. Detection of A-type and B-type Epstein-Barr virus in throat washings and lymphocytes. Virology 1994;202:978-981. [CrossRef][Medline]
Duckett CS, Perkins ND, Kowalik TF, et al. Dimerization of NF-KB2 with RelA(p65) regulates DNA binding, transcriptional activation, and inhibition by an IB- (MAD-3). Mol Cell Biol 1993;13:1315-1322. [Free Full Text]
Lenhoff RJ, Summers J. Coordinate regulation of replication and virus assembly by the large envelope protein of an avian hepadnavirus. J Virol 1994;68:4565-4571. [Free Full Text]
Naidu YM, Rosen EM, Zitnick R, et al. Role of scatter factor in the pathogenesis of AIDS-related Kaposi's sarcoma. Proc Natl Acad Sci U S A 1994;91:5281-5285. [Free Full Text]
Lebbe C, de Cremoux P, Rybojad M, Costa da Cunha C, Morel P, Calvo F. Kaposi's sarcoma and new herpesvirus. Lancet 1995;345:1180-1180.
Dupin N, Grandadam M, Calvez V, et al. Herpesvirus-like DNA sequences in patients with Mediterranean Kaposi's sarcoma. Lancet 1995;345:761-762. [CrossRef][Medline]
Whitby D, Howard MR, Tenant-Flowers M, et al. Detection of Kaposi sarcoma associated herpesvirus in peripheral blood of HIV-infected individuals and progression to Kaposi's sarcoma. Lancet 1995;346:799-802. [CrossRef][Medline]
Rady PL, Yen A, Rollefson JL, et al. Herpesvirus-like DNA sequences in non-Kaposi's sarcoma skin lesions of transplant patients. Lancet 1995;345:1339-1340. [CrossRef][Medline]
Lin JC, Lin SC, Mar EC, et al. Is Kaposi's-sarcoma-associated herpesvirus detectable in semen of HIV-infected homosexual men? Lancet 1995;346:1601-1602. [CrossRef][Medline]
Ioachim HL, Adsay V, Giancotti FR, Dorsett B, Melamed J. Kaposi's sarcoma of internal organs: a multiparameter study of 86 cases. Cancer 1995;75:1376-1385. [CrossRef][Medline]
Jones K, Rivera C, Sgadari C, et al. Infection of human endothelial cells with Epstein-Barr virus. J Exp Med 1995;182:1213-1221. [Free Full Text]
Boshoff C, Talbot S, Kennedy M, O'Leary J, Schulz T, Chang Y. HHV8 and skin cancers in immunosuppressed patients. Lancet 1996;347:338-339. [Erratum, Lancet 1996;348:138.] [Medline]
Moore PS, Gao SJ, Dominguez G, et al. Primary characterization of a herpesvirus agent associated with Kaposi's sarcoma. J Virol 1996;70:549-558. [Abstract]
Kedes DH, Operskalski E, Busch M, Kohn R, Flood J, Ganem D. The seroepidemiology of human herpesvirus 8 (Kaposi's sarcoma-associated herpesvirus): distribution of infection in KS risk groups and evidence for sexual transmission. Nat Med 1996;2:918-924. [CrossRef][Medline]
Gao SJ, Kingsley L, Li M, et al. KSHV antibodies among Americans, Italians and Ugandans with and without Kaposi's sarcoma. Nat Med 1996;2:925-928. [CrossRef][Medline]
Gonzalez, C. M., Wang, L., Damania, B.
(2009). Kaposi's Sarcoma-Associated Herpesvirus Encodes a Viral Deubiquitinase. J. Virol.
83: 10224-10233
[Abstract][Full Text]
Subramanian, R., D'Auvergne, O., Kong, H., Kousoulas, K. G.
(2008). The Cytoplasmic Terminus of Kaposi's Sarcoma-Associated Herpesvirus Glycoprotein B Is Not Essential for Virion Egress and Infectivity. J. Virol.
82: 7144-7154
[Abstract][Full Text]
Curry, C. L., Reed, L. L., Broude, E., Golde, T. E., Miele, L., Foreman, K. E.
(2007). Notch inhibition in Kaposi's sarcoma tumor cells leads to mitotic catastrophe through nuclear factor-{kappa}B signaling. Molecular Cancer Therapeutics
6: 1983-1992
[Abstract][Full Text]
Brinkmann, M. M., Pietrek, M., Dittrich-Breiholz, O., Kracht, M., Schulz, T. F.
(2007). Modulation of Host Gene Expression by the K15 Protein of Kaposi's Sarcoma-Associated Herpesvirus. J. Virol.
81: 42-58
[Abstract][Full Text]
Pan, H., Xie, J., Ye, F., Gao, S.-J.
(2006). Modulation of Kaposi's Sarcoma-Associated Herpesvirus Infection and Replication by MEK/ERK, JNK, and p38 Multiple Mitogen-Activated Protein Kinase Pathways during Primary Infection.. J. Virol.
80: 5371-5382
[Abstract][Full Text]
Teo, C.G.
(2006). Conceptual Emergence of Human Herpesvirus 8 (Kaposi's Sarcoma-associated Herpesvirus) as an Oral Herpesvirus. ADR
19: 85-90
[Abstract][Full Text]
Lu, F., Day, L., Lieberman, P. M.
(2005). Kaposi's Sarcoma-Associated Herpesvirus Virion-Induced Transcription Activation of the ORF50 Immediate-Early Promoter. J. Virol.
79: 13180-13185
[Abstract][Full Text]
Caselli, E., Galvan, M., Cassai, E., Caruso, A., Sighinolfi, L., Di Luca, D.
(2005). Human herpesvirus 8 enhances human immunodeficiency virus replication in acutely infected cells and induces reactivation in latently infected cells. Blood
106: 2790-2797
[Abstract][Full Text]
Dittmer, D. P., Gonzalez, C. M., Vahrson, W., DeWire, S. M., Hines-Boykin, R., Damania, B.
(2005). Whole-Genome Transcription Profiling of Rhesus Monkey Rhadinovirus. J. Virol.
79: 8637-8650
[Abstract][Full Text]
Gasperini, P., Barbierato, M., Martinelli, C., Rigotti, P., Marchini, F., Masserizzi, G., Leoncini, F., Chieco-Bianchi, L., Schulz, T. F., Calabro, M. L.
(2005). Use of a BJAB-Derived Cell Line for Isolation of Human Herpesvirus 8. J. Clin. Microbiol.
43: 2866-2875
[Abstract][Full Text]
Lu, C., Zeng, Y., Huang, Z., Huang, L., Qian, C., Tang, G., Qin, D.
(2005). Human Herpesvirus 6 Activates Lytic Cycle Replication of Kaposi's Sarcoma-Associated Herpesvirus. Am. J. Pathol.
166: 173-183
[Abstract][Full Text]
Malik, P., Blackbourn, D. J., Cheng, M. F., Hayward, G. S., Clements, J. B.
(2004). Functional co-operation between the Kaposi's sarcoma-associated herpesvirus ORF57 and ORF50 regulatory proteins. J. Gen. Virol.
85: 2155-2166
[Abstract][Full Text]
Luna, R. E., Zhou, F., Baghian, A., Chouljenko, V., Forghani, B., Gao, S.-J., Kousoulas, K. G.
(2004). Kaposi's Sarcoma-Associated Herpesvirus Glycoprotein K8.1 Is Dispensable for Virus Entry. J. Virol.
78: 6389-6398
[Abstract][Full Text]
Damania, B., Jeong, J. H., Bowser, B. S., DeWire, S. M., Staudt, M. R., Dittmer, D. P.
(2004). Comparison of the Rta/Orf50 Transactivator Proteins of Gamma-2-Herpesviruses. J. Virol.
78: 5491-5499
[Abstract][Full Text]
Duus, K. M., Lentchitsky, V., Wagenaar, T., Grose, C., Webster-Cyriaque, J.
(2004). Wild-Type Kaposi's Sarcoma-Associated Herpesvirus Isolated from the Oropharynx of Immune-Competent Individuals Has Tropism for Cultured Oral Epithelial Cells. J. Virol.
78: 4074-4084
[Abstract][Full Text]
Lu, F., Zhou, J., Wiedmer, A., Madden, K., Yuan, Y., Lieberman, P. M.
(2003). Chromatin Remodeling of the Kaposi's Sarcoma-Associated Herpesvirus ORF50 Promoter Correlates with Reactivation from Latency. J. Virol.
77: 11425-11435
[Abstract][Full Text]
Gao, S.-J., Deng, J.-H., Zhou, F.-C.
(2003). Productive Lytic Replication of a Recombinant Kaposi's Sarcoma-Associated Herpesvirus in Efficient Primary Infection of Primary Human Endothelial Cells. J. Virol.
77: 9738-9749
[Abstract][Full Text]
Dourmishev, L. A., Dourmishev, A. L., Palmeri, D., Schwartz, R. A., Lukac, D. M.
(2003). Molecular Genetics of Kaposi's Sarcoma-Associated Herpesvirus (Human Herpesvirus 8) Epidemiology and Pathogenesis. Microbiol. Mol. Biol. Rev.
67: 175-212
[Abstract][Full Text]
Bechtel, J. T., Liang, Y., Hvidding, J., Ganem, D.
(2003). Host Range of Kaposi's Sarcoma-Associated Herpesvirus in Cultured Cells. J. Virol.
77: 6474-6481
[Abstract][Full Text]
Tang, J., Gordon, G. M., Muller, M. G., Dahiya, M., Foreman, K. E.
(2003). Kaposi's Sarcoma-Associated Herpesvirus Latency-Associated Nuclear Antigen Induces Expression of the Helix-Loop-Helix Protein Id-1 in Human Endothelial Cells. J. Virol.
77: 5975-5984
[Abstract][Full Text]
Bowser, B. S., DeWire, S. M., Damania, B.
(2002). Transcriptional Regulation of the K1 Gene Product of Kaposi's Sarcoma-Associated Herpesvirus. J. Virol.
76: 12574-12583
[Abstract][Full Text]
Ueda, K., Ishikawa, K., Nishimura, K., Sakakibara, S., Do, E., Yamanishi, K.
(2002). Kaposi's Sarcoma-Associated Herpesvirus (Human Herpesvirus 8) Replication and Transcription Factor Activates the K9 (vIRF) Gene through Two Distinct cis Elements by a Non-DNA-Binding Mechanism. J. Virol.
76: 12044-12054
[Abstract][Full Text]
Dezube, B. J., Zambela, M., Sage, D. R., Wang, J.-F., Fingeroth, J. D.
(2002). Characterization of Kaposi sarcoma-associated herpesvirus/human herpesvirus-8 infection of human vascular endothelial cells: early events. Blood
100: 888-896
[Abstract][Full Text]
Ablashi, D. V., Chatlynne, L. G., Whitman, J. E. Jr., Cesarman, E.
(2002). Spectrum of Kaposi's Sarcoma-Associated Herpesvirus, or Human Herpesvirus 8, Diseases. Clin. Microbiol. Rev.
15: 439-464
[Abstract][Full Text]
Zhou, F.-C., Zhang, Y.-J., Deng, J.-H., Wang, X.-P., Pan, H.-Y., Hettler, E., Gao, S.-J.
(2002). Efficient Infection by a Recombinant Kaposi's Sarcoma-Associated Herpesvirus Cloned in a Bacterial Artificial Chromosome: Application for Genetic Analysis. J. Virol.
76: 6185-6196
[Abstract][Full Text]
Pertel, P. E.
(2002). Human Herpesvirus 8 Glycoprotein B (gB), gH, and gL Can Mediate Cell Fusion. J. Virol.
76: 4390-4400
[Abstract][Full Text]
Lagunoff, M., Bechtel, J., Venetsanakos, E., Roy, A.-M., Abbey, N., Herndier, B., McMahon, M., Ganem, D.
(2002). De Novo Infection and Serial Transmission of Kaposi's Sarcoma-Associated Herpesvirus in Cultured Endothelial Cells. J. Virol.
76: 2440-2448
[Abstract][Full Text]
An, J., Lichtenstein, A. K., Brent, G., Rettig, M. B.
(2002). The Kaposi sarcoma-associated herpesvirus (KSHV) induces cellular interleukin 6 expression: role of the KSHV latency-associated nuclear antigen and the AP1 response element. Blood
99: 649-654
[Abstract][Full Text]
Hyun, T. S., Subramanian, C., Cotter, M. A. II, Thomas, R. A., Robertson, E. S.
(2001). Latency-Associated Nuclear Antigen Encoded by Kaposi's Sarcoma-Associated Herpesvirus Interacts with Tat and Activates the Long Terminal Repeat of Human Immunodeficiency Virus Type 1 in Human Cells. J. Virol.
75: 8761-8771
[Abstract][Full Text]
Garber, A. C., Shu, M. A., Hu, J., Renne, R.
(2001). DNA Binding and Modulation of Gene Expression by the Latency-Associated Nuclear Antigen of Kaposi's Sarcoma-Associated Herpesvirus. J. Virol.
75: 7882-7892
[Abstract][Full Text]
Sakurada, S., Katano, H., Sata, T., Ohkuni, H., Watanabe, T., Mori, S.
(2001). Effective Human Herpesvirus 8 Infection of Human Umbilical Vein Endothelial Cells by Cell-Mediated Transmission. J. Virol.
75: 7717-7722
[Abstract][Full Text]
Ciufo, D. M., Cannon, J. S., Poole, L. J., Wu, F. Y., Murray, P., Ambinder, R. F., Hayward, G. S.
(2001). Spindle Cell Conversion by Kaposi's Sarcoma-Associated Herpesvirus: Formation of Colonies and Plaques with Mixed Lytic and Latent Gene Expression in Infected Primary Dermal Microvascular Endothelial Cell Cultures. J. Virol.
75: 5614-5626
[Abstract][Full Text]
Cerimele, F., Curreli, F., Ely, S., Friedman-Kien, A. E., Cesarman, E., Flore, O.
(2001). Kaposi's Sarcoma-Associated Herpesvirus Can Productively Infect Primary Human Keratinocytes and Alter Their Growth Properties. J. Virol.
75: 2435-2443
[Abstract][Full Text]
Jeong, J., Papin, J., Dittmer, D.
(2001). Differential Regulation of the Overlapping Kaposi's Sarcoma-Associated Herpesvirus vGCR (orf74) and LANA (orf73) Promoters. J. Virol.
75: 1798-1807
[Abstract][Full Text]
Renne, R., Barry, C., Dittmer, D., Compitello, N., Brown, P. O., Ganem, D.
(2001). Modulation of Cellular and Viral Gene Expression by the Latency-Associated Nuclear Antigen of Kaposi's Sarcoma-Associated Herpesvirus. J. Virol.
75: 458-468
[Abstract][Full Text]
Cannon, J. S., Ciufo, D., Hawkins, A. L., Griffin, C. A., Borowitz, M. J., Hayward, G. S., Ambinder, R. F.
(2000). A New Primary Effusion Lymphoma-Derived Cell Line Yields a Highly Infectious Kaposi's Sarcoma Herpesvirus-Containing Supernatant. J. Virol.
74: 10187-10193
[Abstract][Full Text]
Keller, S. A., Schattner, E. J., Cesarman, E.
(2000). Inhibition of NF-kappa B induces apoptosis of KSHV-infected primary effusion lymphoma cells. Blood
96: 2537-2542
[Abstract][Full Text]
Chen, J., Ueda, K., Sakakibara, S., Okuno, T., Yamanishi, K.
(2000). Transcriptional Regulation of the Kaposi's Sarcoma-Associated Herpesvirus Viral Interferon Regulatory Factor Gene. J. Virol.
74: 8623-8634
[Abstract][Full Text]
Chang, J., Ganem, D.
(2000). On the control of late gene expression in Kaposi's sarcoma-associated herpesvirus (human herpesvirus-8). J. Gen. Virol.
81: 2039-2047
[Abstract][Full Text]
Mori, Y., Dhepakson, P., Shimamoto, T., Ueda, K., Gomi, Y., Tani, H., Matsuura, Y., Yamanishi, K.
(2000). Expression of Human Herpesvirus 6B rep within Infected Cells and Binding of Its Gene Product to the TATA-Binding Protein In Vitro and In Vivo. J. Virol.
74: 6096-6104
[Abstract][Full Text]
Mercader, M., Taddeo, B., Panella, J. R., Chandran, B., Nickoloff, B. J., Foreman, K. E.
(2000). Induction of HHV-8 Lytic Cycle Replication by Inflammatory Cytokines Produced by HIV-1-Infected T Cells. Am. J. Pathol.
156: 1961-1971
[Abstract][Full Text]
Alexander, L., Denekamp, L., Knapp, A., Auerbach, M. R., Damania, B., Desrosiers, R. C.
(2000). The Primary Sequence of Rhesus Monkey Rhadinovirus Isolate 26-95: Sequence Similarities to Kaposi's Sarcoma-Associated Herpesvirus and Rhesus Monkey Rhadinovirus Isolate 17577. J. Virol.
74: 3388-3398
[Abstract][Full Text]
Haque, M., Chen, J., Ueda, K., Mori, Y., Nakano, K., Hirata, Y., Kanamori, S., Uchiyama, Y., Inagi, R., Okuno, T., Yamanishi, K.
(2000). Identification and Analysis of the K5 Gene of Kaposi's Sarcoma-Associated Herpesvirus. J. Virol.
74: 2867-2875
[Abstract][Full Text]
Haramati, L. B., Wong, J.
(2000). Intrathoracic Kaposi’s Sarcoma in Women With AIDS. Chest
117: 410-414
[Abstract][Full Text]
Dittmer, D., Stoddart, C., Renne, R., Linquist-Stepps, V., Moreno, M.E., Bare, C., McCune, J.M., Ganem, D.
(1999). Experimental Transmission of Kaposi's Sarcoma-Associated Herpesvirus (Kshv/Hhv-8) to Scid-Hu Thy/Liv Mice. JEM
190: 1857-1868
[Abstract][Full Text]
Moses, A. V., Fish, K. N., Ruhl, R., Smith, P. P., Strussenberg, J. G., Zhu, L., Chandran, B., Nelson, J. A.
(1999). Long-Term Infection and Transformation of Dermal Microvascular Endothelial Cells by Human Herpesvirus 8. J. Virol.
73: 6892-6902
[Abstract][Full Text]
Mueller, B. U.
(1999). Cancers in Children Infected With the Human Immunodeficiency Virus. The Oncologist
4: 309-317
[Abstract][Full Text]
Drago, F., Rebora, A.
(1999). The New Herpesviruses: Emerging Pathogens of Dermatological Interest. Arch Dermatol
135: 71-75
[Abstract][Full Text]
Friborg, J. Jr., Kong, W.-P., Flowers, C. C., Flowers, S. L., Sun, Y., Foreman, K. E., Nickoloff, B. J., Nabel, G. J.
(1998). Distinct Biology of Kaposi's Sarcoma-Associated Herpesvirus from Primary Lesions and Body Cavity Lymphomas. J. Virol.
72: 10073-10082
[Abstract][Full Text]
Kliche, S., Kremmer, E., Hammerschmidt, W., Koszinowski, U., Haas, J.
(1998). Persistent Infection of Epstein-Barr Virus-Positive B Lymphocytes by Human Herpesvirus 8. J. Virol.
72: 8143-8149
[Abstract][Full Text]
Dittmer, D., Lagunoff, M., Renne, R., Staskus, K., Haase, A., Ganem, D.
(1998). A Cluster of Latently Expressed Genes in Kaposi's Sarcoma-Associated Herpesvirus. J. Virol.
72: 8309-8315
[Abstract][Full Text]
Foreman, K. E., Alkan, S., Krueger, A. E., Panella, J. R., Swinnen, L. J., Nickoloff, B. J.
(1998). Geographically Distinct HHV-8 DNA Sequences in Saudi Arabian Iatrogenic Kaposi's Sarcoma Lesions. Am. J. Pathol.
153: 1001-1004
[Abstract][Full Text]
Renne, R., Blackbourn, D., Whitby, D., Levy, J., Ganem, D.
(1998). Limited Transmission of Kaposi's Sarcoma-Associated Herpesvirus in Cultured Cells. J. Virol.
72: 5182-5188
[Abstract][Full Text]
Moore, P. S., Chang, Y.
(1998). Kaposi's Sarcoma-Associated Herpesvirus-Encoded Oncogenes and Oncogenesis. J Natl Cancer Inst Monogr
1998: 65-71
[Abstract][Full Text]
Sarid, R., Flore, O., Bohenzky, R. A., Chang, Y., Moore, P. S.
(1998). Transcription Mapping of the Kaposi's Sarcoma-Associated Herpesvirus (Human Herpesvirus 8) Genome in a Body Cavity-Based Lymphoma Cell Line (BC-1). J. Virol.
72: 1005-1012
[Abstract][Full Text]
Fiorelli, V., Gendelman, R., Caterina Sirianni, M., Chang, H.-K., Colombini, S., Markham, P. D., Monini, P., Sonnabend, J., Pintus, A., Gallo, R. C., Ensoli, B.
(1998). gamma -Interferon Produced by CD8+ T Cells Infiltrating Kaposi's Sarcoma Induces Spindle Cells With Angiogenic Phenotype and Synergy With Human Immunodeficiency Virus-1 Tat Protein: An Immune Response to Human Herpesvirus-8 Infection?. Blood
91: 956-967
[Abstract][Full Text]
Sirianni, M. C., Vincenzi, L., Fiorelli, V., Topino, S., Scala, E., Uccini, S., Angeloni, A., Faggioni, A., Cerimele, D., Cottoni, F., Aiuti, F., Ensoli, B.
(1998). gamma -Interferon Production in Peripheral Blood Mononuclear Cells and Tumor Infiltrating Lymphocytes From Kaposi's Sarcoma Patients: Correlation With the Presence of Human Herpesvirus-8 in Peripheral Blood Mononuclear Cells and Lesional Macrophages. Blood
91: 968-976
[Abstract][Full Text]
Blauvelt, A., Herndier, B. G., Orenstein, J. M., Friborg, J., Nabel, G. J., Nickoloff, B. J.
(1997). Propagation of a Human Herpesvirus from AIDS-Associated Kaposi's Sarcoma. NEJM
336: 1837-1839
[Full Text]
(1997). Infectious Diseases. JAMA
277: 1865-1866
(1997). KSHV Grown from KS Lesions. AIDS Clin Care
1997: 3-3
[Full Text]
Mocarski, E. S.
(1997). Propagating Kaposi's Sarcoma-Associated Herpesvirus. NEJM
336: 213-215
[Full Text]
Knight, J. S., Cotter, M. A. II, Robertson, E. S.
(2001). The Latency-associated Nuclear Antigen of Kaposi's Sarcoma-associated Herpesvirus Transactivates the Telomerase Reverse Transcriptase Promoter. J. Biol. Chem.
276: 22971-22978
[Abstract][Full Text]