FREE NEJM E-TOC    HOME   |   SUBSCRIBE   |   CURRENT ISSUE   |   PAST ISSUES   |   COLLECTIONS   |   Search Term  Advanced Search

Sign in | Get NEJM's E-Mail Table of Contents — Free | Subscribe

Previous Volume 336:163-171 January 16, 1997 Number 3 Next

Abstract PDF Letters Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited PubMed Citation

ABSTRACT

Background Although unique DNA sequences related to gammaherpesviruses have been found in Kaposi's sarcoma lesions, it is uncertain whether this DNA encodes a virus that is able to reproduce.

Methods We isolated and propagated a filterable agent whose DNA sequences were found to be identical to those of the Kaposi's sarcoma–associated herpesvirus (KSHV). We obtained early-passage spindle cells from skin lesions of patients with the acquired immunodeficiency syndrome (AIDS) who had Kaposi's sarcoma and cultured them with cells of the human embryonal-kidney epithelial-cell line 293. We characterized the virus according to its effects on cellular morphology and viral replication and its appearance on electron microscopy.

Results KSHV was cytotoxic to 293 cells and was detected by the polymerase chain reaction (PCR) in infected cells but not uninfected ones. Cytotoxicity and positive PCR signals were consistently maintained with viral titers of 1 million per milliliter or higher for about 20 serial infections of 293 cells. The viral copy number was relatively low (1 to 10 copies per cell). Viral replication was confirmed by Southern blot analysis of DNA isolated from the enriched nuclear fraction of infected cells and by a semiquantitative PCR using dilutions of the lysates of infected cells to detect the 233-bp viral DNA fragment originally described in association with Kaposi's lesions. Electron microscopy revealed herpesvirus-like particles in about 1 percent of cells from infected cultures, as compared with none in cells from uninfected cultures.

Conclusions A herpesvirus with DNA sequences identical to those of KSHV can be propagated from skin lesions of patients with AIDS-associated Kaposi's sarcoma. (N Engl J Med 1997;336:163 -71.)

It is uncertain whether these DNA sequences encode a replication-competent virus or represent a replication-defective, adventitious virus present in patients with Kaposi's sarcoma. Although B-cell lines that carry the virus have been identified,^10,11 neither viral replication in vitro nor serial propagation of the virus in cell lines has been demonstrated. In this study we demonstrate the propagation of a human herpesvirus from AIDS-associated Kaposi's sarcoma.

Methods

Cell Culture, Isolation of DNA, and Analysis by the Polymerase Chain Reaction

Kaposi's sarcoma cell lines were isolated independently from specimens of Kaposi's sarcoma skin lesions obtained at biopsy from five HIV-infected patients,¹² all of whom had multiple lesions, diminished CD4 cell counts, and other signs of AIDS. For some patients, two biopsy specimens were evaluated. The cells were plated in tissue-culture dishes coated with microvascular endothelial-cell attachment factor (Cell Systems, Kirkland, Wash.) and were maintained as previously described,^12,13 but without the addition of medium conditioned by cells infected with the human T-cell lymphotropic virus type II (HTLV-II).

The polymerase chain reaction (PCR) was performed with KSHV-specific primers.⁵ Either genomic DNA or Hirt supernatants — that is, episomal DNA from infected cells — were isolated from tissue-culture cells as previously described.^14,15,16 PCR was performed as previously described to detect human herpesvirus 6 (HHV-6), EBV, and herpes simplex virus types 1 and 2 (HSV-1 and HSV-2).^17,18,19 CMV was detected with the following primers from the intron of an immediate early gene, under standard conditions: 5'CCAAGCTTCCACGCTGTTTTGACCTCCATAGA3' (sense) and 5'CCAAGCTTCTGTCAGCTATTATGTCTGGTGGC3' (antisense); a 908-bp product was generated. Positive controls for these known herpesviruses were obtained from paraffin-embedded tissue samples and from the EBV-transformed B-cell line M16B. The sensitivity of the PCR was 0.1 to 1 fg of DNA.

In a semiquantitative PCR, the 233-bp fragment of viral DNA originally described in association with Kaposi's sarcoma lesions⁵ (Genbank accession number U18551, base pairs 987 to 1219) was quantitated by electrophoresis with ethidium-stained agarose gel and spectroscopy in serial dilutions. PCR was performed, followed by Southern blot hybridization with a form of the same 233-bp DNA fragment that was radiolabeled with phosphorus-32. Each PCR used DNA from 100,000 cells, purified by phenol–chloroform extraction. The range of the DNA concentration measurable in the assay was 0.001 to 1 fg (4 to 4000 copies).

Propagation of Virus from Cocultures and Serial Passage

Cells from primary Kaposi's sarcoma lesions (200,000 cells, passaged no more than three times after the cells from the biopsy samples were plated) were incubated with 2 million cells of the human embryonal-kidney epithelial-cell line 293 (293 cells) in 35-mm six-well Costar plates, either stimulated before culture with tumor necrosis factor (200 IU per milliliter) or unstimulated. The 293 cells (provided by Dr. Garry Nolan) were grown in Dulbecco's modified Eagle's medium supplemented with fetal-calf serum (10 percent), antibiotics, and l-glutamine. To release viral particles, cell-free lysates from the 293 cells were prepared by three cycles of freezing and thawing in dry ice and ethanol and a water bath at 37°C three to five days after the initial coculture with the Kaposi's sarcoma cells. After lysis of the cells, the extracts were centrifuged at 10,000 x g for 10 minutes, then filtered through a 0.45-µm membrane.

For the serial propagation of virus, cell-free lysates were prepared from infected 293 cells by this method on day 3 after infection, while a duplicate cell culture was maintained to confirm subsequent cytotoxicity. No viable cells were detected in the lysates by staining with trypan blue, and positivity for KSHV DNA was confirmed in the lysates by PCR. Virus was propagated serially in an equivalent number of 293 cells for approximately 20 passages. Viral titers were estimated by incubating the infected lysates in progressive dilutions (10-² to 10-¹⁰) with 293 cells. Human umbilical-vein endothelial cells were propagated as previously described.²⁰

Treatment of Extracellular Virions with Nuclease

To confirm that viral DNA was protected by components of the viral structure, isolated virions were digested with RNase-free DNase (1 U per milliliter; Promega) and pronase (1 mg per milliliter), which together should degrade free or protein-associated DNA. Some virions were incubated in addition with a nonionic detergent, 1 percent Nonidet P-40 (NP40), which disrupts the lipid bilayer of the viral envelope^11,21 and allows DNase and pronase to degrade virion-associated DNA. The supernatants of infected cultures of 293 cells were centrifuged for 10 minutes at 3000 rpm and filtered through a 0.45-µm membrane. To prevent the potential carryover of viral DNA, the supernatants were ultracentrifuged (25,000 x g) at 4°C (SW 28 rotor, Beckman) to pellet the viral particles. Before analysis, the particles were washed once with phosphate-buffered saline (PBS).

Electron Microscopy

Cells from the in vitro cultures described above were rinsed with PBS, and monolayers were fixed in 2.5 percent glutaraldehyde in PBS (pH 7.4) for five minutes at 4°C. The cells were then resuspended, centrifuged into pellets at 300 x g, and incubated for two hours at 4°C. The samples were rinsed, dehydrated, and embedded in epon. The specimens were sectioned, stained with uranyl acetate and lead citrate, and examined with a Zeiss 109 transmission electron microscope. In some instances, the cells were incubated for 12 hours with brefeldin A (0.3 µg per milliliter), an inhibitor of Golgi transport, added 24 hours after infection. This treatment improved the visualization of virions.

Results

Characterization of KSHV DNA in Isolated Kaposi's Sarcoma Cells

To establish Kaposi's sarcoma cell lines in vitro, we developed conditions for cell culture that did not require the presence of medium conditioned with HTLV-II–infected cells, unlike the culture conditions in previous studies.^12,13 Kaposi's sarcoma cell lines grew rapidly after the initiation of the cultures. Each was positive for clotting factor XIIIa and vascular-cell adhesion molecule 1 on immunohistochemical staining and negative for factor XIIIs, E-selectin, CD31, factor VIII, and CD34 (data not shown), as is consistent with the phenotype of isolated Kaposi's sarcoma cells studied under different conditions of culture.^12,22

PCR was used to determine whether the proliferating Kaposi's sarcoma cells contained recently described herpesvirus-like DNA sequences.⁵ Early-passage, isolated Kaposi's sarcoma cell lines from six of the seven specimens obtained were positive for these DNA sequences (Table 1). The positive signal was present in the cell lines until passage 2 or 3 and could not be detected thereafter. The 233-bp PCR product was also found in DNA isolated from two paraffin-embedded samples of tissue from a different patient who had pulmonary Kaposi's sarcoma, as has been described in other patients.^5,6 No evidence of KSHV DNA sequences was detected in human umbilical-vein endothelial cells, 293 cells, or DNA isolated from paraffin-embedded tissue from a patient with psoriasis (Table 1). To determine whether other herpesviruses were present in these samples, PCR was performed to detect viral sequences of HHV-6, HSV-1, HSV-2, CMV, and EBV. DNA from the samples of Kaposi's sarcoma cells was negative for each of these sequences (Table 1). In addition, there was no evidence of mycoplasma, HIV, or adenovirus in freshly derived Kaposi's sarcoma cells or viral isolates (data not shown).

View this table: [in this window] [in a new window]   Table 1. Presence of KSHV and Other DNA Sequences in Isolated Cell Lines.

 
Propagation of Lytic Virus

Early-passage Kaposi's sarcoma cells were cocultured for two to seven days with various types of cells, including human epithelial-cell lines (HeLa, 293, and A431 cells), human umbilical-vein endothelial cells, porcine endothelial cells, and human or porcine vascular smooth-muscle primary cells. Genomic DNA was isolated from the cocultures and analyzed for KSHV DNA sequences by PCR. Consistently strong PCR signals were found on day 2 in DNA isolated from cocultures of Kaposi's sarcoma cells with 293 cells, whereas the DNA from the co-cultures with other types of cells was negative. In the 293 cells, the PCR signal was detected as Kaposi's sarcoma cells were lost from the culture (on days 4 and 5) and was accompanied by progressively increasing signs of cytotoxicity in the cell culture (Figure 1A and Figure 1B). Light-microscopical analysis of uninfected 293 cells showed viable epithelial cells with round nuclei that contained evenly distributed chromatin and prominent nucleoli (Figure 1B). In contrast, after exposure to the infected-cell lysate, the 293 cells showed substantial cytopathic changes, beginning as early as day 2. Groups of infected 293 cells contained multinucleated giant cells (Figure 1B). In addition, certain cells had nuclear molding or dense, chromatin-like material at the margin of the nucleus, and the chromatin was dissolving, with residual chromatin forming a margin along the nuclear membrane (Figure 1B). By day 5, virtually all the cells underwent condensation of chromatin and other morphologic changes consistent with cell death (Figure 1A and Figure 1B). These findings suggested that the positive PCR signals were probably due to transmission of virus rather than to persistent DNA sequences from the primary Kaposi's sarcoma cell line. PCR signals were variably observed in the human umbilical-vein endothelial cells, but there was no consistent cytopathic effect. We therefore focused our efforts on the 293 cells as host cells for viral replication.

View larger version (78K): [in this window] [in a new window]   Figure 1. Cytotoxic Effect on 293 Cells of Virus Propagated in Vitro. Panel A shows uninfected 293 cells and cells exposed to virus (infected) after incubation in vitro for the numbers of days shown, as analyzed by phase-contrast microscopy. The degree of cytotoxicity observed in the infected cells was graded as + on day 3, ++ on day 4, and +++ on day 5 (x10). Panel B shows the typical light-microscopical appearance of 293 cells before exposure to lysate and five days thereafter. The uninfected cells appear uniformly viable, with typical epithelial differentiation, but the infected cells have undergone degeneration, with the formation of multinucleated giant cells (black arrows) and the alteration of chromatin typical of infection by a virus of the herpes group (white arrows) (left, x400; middle, x200; right, x400).

 
Propagation of Virus by Serial Infection of 293 Cells

To propagate the virus further, we prepared cell-free lysates from cocultures of Kaposi's sarcoma cells with 293 cells at various times after incubation, and the 293 cells were infected both in the presence and in the absence of tumor necrosis factor . No PCR signals were detected in the uninfected cells, but signals were readily detected in the infected 293 cells within one day after infection (Figure 2A). Signals were detected more readily in the nuclear fraction and were weaker in the cytoplasm (Figure 2B). Hirt supernatants — that is, episomal DNA isolated from infected cells — contained KSHV DNA sequences by PCR. The signals were maximal three days after the viral challenge, diminishing by day 5 (Figure 2A).

View larger version (18K): [in this window] [in a new window]   Figure 2. Detection of KSHV DNA Sequences in 293 Cells after Coculture with Kaposi's Sarcoma Cells. Viral DNA was detected by PCR in Hirt supernatants of 293 cells (Panel A) on the indicated days after infection, but not in uninfected cells, and with DNA isolated from the enriched subcellular fractions on day 3 (Panel B). In both panels, the arrows indicate the specific 233-bp DNA fragment; the plus signs, a positive control sample from a Kaposi's sarcoma lesion; and the minus signs, DNA from uninfected 293 cells. M denotes molecular-size marker. The amount of DNA used in each PCR analysis (1 or 0.1 µg) is shown. Panel C shows the results of Southern blot analysis of genomic DNA (10 µg) isolated from uninfected and infected 293 cells. Viral DNA sequences were detected without PCR amplification from uninfected cells (lane 1) and from cells three days after infection with passage 5 virus (lanes 2 and 3), probed either without digestion (lane 2) or after digestion with BamHI (lanes 1 and 3). The arrow indicates the 330-bp product expected after digestion with BamHI. Panel D shows an analysis of the cytotoxicity and PCR reactivity of 293 cells after incubation with cell-free lysates (passage 5) at the dilutions shown. In the study of reactivity, ethidium bromide staining and Southern blot hybridization were used. No signal was detected by Southern blot analysis of the PCR product in uninfected cells (see Panel A, lane 2, and Panel B, lane 13). The degree of cellular cytotoxicity was determined by light microscopy and graded as in Figure 1. PCR was performed with 1 µg of DNA isolated on day 3 from the enriched nuclear fraction of infected cells. PCR fragments and genomic DNA were transferred to nylon membranes (Genescreen Plus, Dupont) and hybridized to oligolabeled probe derived from the 233-bp PCR fragment under standard conditions.

 
Although virus could be detected in the cell-culture supernatants and passaged serially, the cell lysates consistently had viral titers two to three orders of magnitude higher than the supernatants (data not shown), and the lysates were therefore used in further studies. With the PCR we could also amplify regions of the thymidine kinase gene, the putative principal capsid protein, and glycoprotein H. These regions were visualized by staining with ethidium bromide after 30 cycles in at least three separate experiments (data not shown). No PCR signals from other known herpesviruses were detected in serially passaged viral isolates, although they were detected readily in positive control tissues and cell lines infected with the relevant viruses. In particular, there was no PCR evidence of EBV in either the primary early-passage Kaposi's sarcoma cell lines or subsequent serially passaged virus (with as many as 20 passages) (data not shown).

Southern blot analysis of DNA prepared from enriched nuclei isolated from 293 cells confirmed that in passage 5 virus, viral DNA was amplified by a factor of 1000 or more after infection (Figure 2C), as was consistent with the results of semiquantitative PCR (Figure 2A and Figure 2B). Moreover, when 293 cells were incubated with infected-cell lysates at increasing dilutions, the development of cytotoxicity correlated with the magnitude of the signal for KSHV that could be detected by Southern blot analysis of the PCR product (Figure 2D). Cytotoxicity and positive PCR signals for KSHV were consistently maintained with viral titers of 1 million per milliliter or more, as determined by the dilution at which no cytotoxicity was seen, for approximately 20 serial infections of 293 cells. The transfer of the cytotoxic effect among the cell cultures and the PCR signals after serial passage were maintained consistently after the infected-cell lysates were filtered through a 0.45-µm membrane, but these characteristics disappeared after inactivation by heat (data not shown). Under identical culture conditions, serial passages of KSHV derived from body-cavity–based lymphomas were unsuccessful, and no cytotoxicity was seen (unpublished data).

Replication of Viral DNA in Infected Cells and Sensitivity of Virus to Treatment with Nuclease

To passage the virus serially, we prepared cell lysates from infected 293 cells on day 3, before the generation of cytotoxicity. Although tumor necrosis factor enhanced viral replication during the coculture of primary Kaposi's sarcoma cells and 293 cells, it did not increase cytotoxicity or viral titers during serial passage of 293 cells and thus was not used further. Replication of viral DNA was confirmed by semiquantitative PCR. With this technique, as little as about 0.001 fg of viral DNA (or about one copy per 100,000 infected cells) could be detected. After one hour of incubation with infected-cell lysates from passage 15 (a 10-² dilution, containing 1000 to 10,000 viral-genome equivalents), followed by extensive washing with Dulbecco's modified Eagle's medium, viral DNA was barely detectable in the infected cells four hours after the removal of the viral supernatant. By 24 hours, a definite signal was detected. The peak replication was observed two days after infection, with amplification of viral DNA increased by at least three orders of magnitude.

Exposure to a smaller quantity of lysate in a 10-⁴ dilution (containing 10 to 100 viral-genome equivalents) revealed sustained but decreased peak replication of viral DNA (Figure 3A and Figure 3B), which may have been due to a slower spread in the infected cell culture and to reduced cytotoxicity. No viral DNA was detected in uninfected cells (Figure 2A and Figure 3A). Thus, for the cultures of 293 cells exposed to infected lysates (passage 15), there was a period in which the viral titer was minimal, followed by one in which it increased exponentially, providing evidence that this virus is competent to replicate. Analysis of passage 1 and passage 5 virus showed a similar increase in the synthesis of viral DNA in infected 293 cells (Figure 3C). These results are representative of those obtained with at least six infections in which virus from different passages (from passage 2 to passage 22) was studied by PCR. At least three primary isolates of the virus with similar properties have now been obtained and propagated (data not shown). Quantitation of the Southern blot signal suggested that there was a relatively low copy number of viral genomes in each cell (on average, 1 to 10 copies per cellular genome; data not shown), as is consistent with results of quantitative PCR and electron-microscopical data.

View larger version (13K): [in this window] [in a new window]   Figure 3. Replication of Viral DNA in 293 Cells and Analysis of Extracellular Viral Particles. Panel A shows the course of viral propagation over time in infected 293 cells, as estimated by semiquantitative PCR. A Southern blot analysis of the PCR product amplified from DNA extracted from cells (passage 15) after infection with two dilutions of virus (10-2 and 10-4) is shown at the top. DNA from cultures of infected cells was isolated at various times, extracted, precipitated with ethanol, and amplified by PCR. For comparison, a known amount of DNA (the same 233-bp PCR product) was quantitated in the presence and absence of cellular DNA lysate isolated from 100,000 uninfected cells. Viral-genome equivalents were calculated with standards containing cellular DNA. The quantity of the viral PCR product was standardized initially by ethidium agarose-gel electrophoresis and spectrophotometry. DNA from cells infected with virus at two dilutions (10-2 and 10-4) was extracted 4, 24, 48, 72, and 96 hours after infection (lanes 1 through 5). Positive controls containing various amounts of DNA (the 233-bp KSHV PCR product from a Kaposi's sarcoma lesion) are shown in lanes 6 through 9, and a negative control sample with buffer alone is shown in lane 10. Samples purified by phenol–chloroform extraction were subjected to PCR as described in the Methods section. Specific hybridization is shown of PCR products from the infected cell extracts and the positive control DNA to the 32P-labeled 233-bp PCR product from a Kaposi's sarcoma lesion after transfer of the gel to nylon membranes. Panel B shows copy numbers of viral genomes estimated by semiquantitative PCR at various times after infection, as quantitated from Panel A by phosphor imaging. The copy numbers were calculated on the basis of image analysis by a PhosphorImager (Molecular Dynamics) and compared with the standards in Panel A. Panel C shows the kinetics of viral DNA synthesis in earlier-passage cells, derived from passages 1 and 5. In these infections, a 10-2 dilution of cellular lysate prepared from approximately 2 million infected 293 cells was incubated with the same number of uninfected 293 cells.

 
To determine whether the virus particles released from infected cells contained KSHV DNA, pelleted virus was subjected to treatment with DNase and pronase,¹¹ with or without prior exposure to NP40, and was then analyzed by PCR and Southern blotting. The KSHV DNA from passage 15 in the preparation treated with pronase and DNase was resistant to nuclease digestion. In contrast, no PCR signal was detected in the preparation exposed to NP40 before treatment with DNase and pronase (Figure 4A). This finding provides evidence that the DNA is protected from the combined action of a protease and DNase by a virus-associated membrane. Furthermore, transmission of KSHV DNA in 293 cells was demonstrated at passage 22 after treatment with DNase alone (Figure 4B), indicating that filtered and DNase-treated viral particles retained their infectivity. In this experiment, but not routinely, the preparation of virions was also treated with RNase-free DNase (1 U per milliliter, Promega). Similar results were observed with passage 15 virus.

View larger version (11K): [in this window] [in a new window]   Figure 4. Nuclease Sensitivity Assays for Enveloped Virions Derived from Infected 293 Cells. Panel A shows the results of an assay in which particles from the culture fluids (passage 15) of infected cells were concentrated and incubated both without NP40 (lane 1) and with NP40 (lane 2), as described.11,21 Each preparation was then exposed to pronase and digested with DNase before the extraction of nucleic acid. The isolated DNA underwent PCR amplification, and specific hybridization of PCR products to the 32P-labeled 233-bp KSHV DNA probe was performed as described in the Methods section. Panel B shows the results of an assay in which particles from culture fluids (passage 22) of infected 293 cells were concentrated and incubated at 37°C for 30 minutes both with and without DNase. Equal numbers of 293 cells were exposed to each viral preparation, and DNA was extracted 4 hours (lanes 1 and 3) and 48 hours (lanes 2 and 4) after infection. Purified samples were amplified by PCR, and specific hybridization of PCR products was performed as described in the Methods section.

 
Electron Microscopy of Infected 293 Cells

To further document the presence of the virus after serial propagation, we performed additional analyses using electron microscopy. In early-passage Kaposi's sarcoma cells, particles were found in the cytoplasm whose size and structure were consistent with those of herpes virions (Figure 5A). Electron-microscopical analysis of 293 cells infected with viral lysate (passage 5) revealed multiple particles that resembled viral nucleocapsids (Figure 5B). These viral nucleocapsids containing electron-dense cores (approximately 100 nm in diameter) were observed in nuclei of infected cells, but not those of uninfected cells, as soon as two days after exposure to lysate (Figure 5C). Furthermore, enveloped virions (approximately 140 nm in diameter) were detected in the perinuclear cisternae and the cytoplasm of infected 293 cells (Figure 5D and Figure 5E). We estimated that about 1 percent of cells in the infected cultures contained herpesvirus-like particles, but none of the cells in the control cultures contained such particles (300 cells were analyzed in each group).

View larger version (97K): [in this window] [in a new window]   Figure 5. Electron-Microscopical Analyses of Cultures of Infected 293 Cells. Panel A shows a herpesvirus-like particle in the cytoplasm of a passage 2 Kaposi's sarcoma cell (x70,000). Panel B shows a 293 cell two days after exposure to infected cellular lysate. Margination of the chromatin is readily apparent, and nucleocapsids (arrows) are detectable within the nuclei (x12,900). Panel C shows a higher magnification of a typical viral nucleocapsid with an electron-dense central core (approximately 100 nm, x67,840). Panel D shows a representative enveloped virion in the cytoplasm of an infected 293 cell (x82,400). Panel E shows an enveloped viral particle in the perinuclear cisternae of an infected 293 cell (x82,400). The cells shown in Panels D and E were incubated with brefeldin A, as described in the Methods section.

 
Discussion

Since DNA sequences associated with Kaposi's sarcoma were first described, several reports have either supported^{6,7,8,23,24,25} or challenged^26,27 the notion that this novel DNA virus is important in Kaposi's sarcoma. We used early-passage cell lines from biopsy specimens of Kaposi's sarcoma skin lesions as a source of the virus and defined conditions that allowed it to be propagated in vitro. KSHV DNA sequences were detected by PCR in early passages of these cell lines (in six of seven primary cultures), and these sequences resembled previously described herpesvirus-like DNA sequences.^28,29 It is noteworthy that the PCR signal disappeared from the primary Kaposi's sarcoma cell lines by passage 3 or 4, suggesting that viral replication in these cultures was limited. In coculture experiments, the virus was transmitted to the embryonal-kidney epithelial-cell line 293 in a manner that correlated with the presence of the viral PCR signal. In addition, substantial cytotoxicity was observed, which could be due to the direct toxic effects of viral proteins on infected cells or, indirectly, to the release of cytokines, as noted in the case of EBV infections,³⁰ to the presence of soluble factors, or to the action of virus particles on uninfected cells in the culture. Because a small fraction of cells appear to be infected (0.1 to 1 percent) at the time cytotoxicity is observed, it is likely that this effect is largely indirect.

Independent evidence of the presence of the virus was obtained by analysis of viral DNA, studies of cellular morphology, and electron microscopy. Although replication of viral DNA was repeatedly demonstrated by PCR, the viral copy number was relatively low (1 to 10 copies per cell). For this reason, Southern blotting for the routine detection of virus was not feasible, although the virus was detectable by this technique in larger-scale preparations (Figure 2C). The disappearance of viral DNA (Figure 3B and Figure 3C) was probably due to the cytotoxic effects observed in the culture, with the release of nucleases, proteases, and lipases that may degrade cell-associated viral DNA. Although KSHV appears to replicate with a low copy number, the features we observed are consistent with previous reports based on DNA analysis and in situ hybridization of Kaposi's sarcoma tissue.^5,31

Renne et al.¹¹ have described a body-cavity–based lymphoma that contains KSHV. Contrary to Cesarman et al. in an earlier report,¹⁰ they showed that a lymphoma that carries KSHV DNA is devoid of EBV sequences. Although the formation of virus was induced in a proportion of cells (5 to 10 percent) by treatment with phorbol 12-myristate 13-acetate,¹¹ serial passage of replication-competent virus was not demonstrated. Another report suggested that transient transmission of KSHV derived from an EBV-containing B-cell lymphoma line was observed, but that virus also could not be propagated serially.³² We studied and propagated KSHV from primary Kaposi's sarcoma lesions. Further research is needed to clarify the relation between the viruses in body-cavity–based lymphomas and those in primary Kaposi's sarcoma lesions.

Despite our ability to propagate this virus in vitro and its close association with the presence of Kaposi's sarcoma in vivo,^33,34 whether KSHV has a causal role in the disease remains uncertain. The ability to propagate KSHV should facilitate the development of diagnostic reagents, allow more detailed study of the association of the virus with Kaposi's sarcoma lesions, and improve our understanding of how people respond after exposure to the virus. Finally, it remains uncertain whether the pathogenesis of Kaposi's sarcoma derives from its ability to transform primary cells in vivo or whether the sarcoma represents an immune-mediated inflammatory and angiogenic response to virally infected cells. The fact that cloned viral isolates can be maintained and propagated should facilitate further study of the molecular regulation of the virus and help define its role in the causation and pathogenesis of Kaposi's sarcoma.

Supported in part by grants (AR40488, CA64416, and CA70057 [to Dr. Nickoloff] and AI36207 and CA46592 [to Dr. Nabel]) from the National Institutes of Health.

We are indebted to Drs. Clay Flowers and Oveta Fuller for helpful discussions; to Donna Gschwend and Nancy Barrett for the preparation of the manuscript; to Philip Simonian for DNA-sequence analysis; to Drs. Carol A. Kauffman and Powel H. Kazanjian for the referral of patients; and to Robin Kunkel, Barbara Rogers, Theodore Beals, and Paula Kovarik for the preparation and analysis of the electron-microscopical specimens.

Source Information

From the Department of Pathology, Skin Disease Research Laboratories, Cardinal Bernardin Cancer Center, Loyola University Medical Center, Maywood, Ill. (K.E.F., B.J.N.); and the Departments of Internal Medicine and Biological Chemistry (J.F., W.K., C.W., G.J.N.) and Oral Pathology (P.J.P.), Howard Hughes Medical Institute, University of Michigan Medical Center, Ann Arbor.

Address reprint requests to Dr. Nabel at University of Michigan Medical Center, MSRBI, Rm. 4520, 1150 W. Medical Center Dr., Ann Arbor, MI 48109-0650.

References

1. Beral V, Peterman TA, Berkelman RL, Jaffe HW. Kaposi's sarcoma among persons with AIDS: a sexually transmitted infection? Lancet 1990;335:123-128. [CrossRef][Medline]
2. Safai B, Johnson KG, Myskowski PL, et al. The natural history of Kaposi's sarcoma in the acquired immunodeficiency syndrome. Ann Intern Med 1985;103:744-750.
3. Beral V, Jaffe H, Weiss R. Cancer surveys: cancer, HIV, and AIDS. Eur J Cancer 1991;27:1057-1058.
4. Beral V. Epidemiology of Kaposi's sarcoma. Cancer Surv 1991;10:5-22. [Erratum, Cancer Surv 1992;12:225a.] [Medline]
5. Chang Y, Cesarman E, Pessin MS, et al. Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposi's sarcoma. Science 1994;266:1865-1869. [Free Full Text]
6. Huang YQ, Li JJ, Kaplan MH, et al. Human herpesvirus-like nucleic acid in various forms of Kaposi's sarcoma. Lancet 1995;345:759-761. [CrossRef][Medline]
7. Moore PS, Chang Y. Detection of herpesvirus-like DNA sequences in Kaposi's sarcoma in patients with and those without HIV infection. N Engl J Med 1995;332:1181-1185. [Free Full Text]
8. Ambroziak JA, Blackburn DJ, Herndier BG, et al. Herpes-like sequences in HIV-infected and uninfected Kaposi's sarcoma patients. Science 1995;268:582-583. [Free Full Text]
9. Cesarman E, Chang Y, Moore PS, Said JW, Knowles DM. Kaposi's sarcoma-associated herpesvirus-like DNA sequences in AIDS-related body-cavity-based lymphomas. N Engl J Med 1995;332:1186-1191. [Free Full Text]
10. Cesarman E, Moore PS, Rao PH, Inghirami G, Knowles DM, Chang Y. In vitro establishment and characterization of two acquired immunodeficiency syndrome-related lymphoma cell lines (BC-1 and BC-2) containing Kaposi's sarcoma-associated herpesvirus-like (KSHV) DNA sequences. Blood 1995;86:2708-2714. [Free Full Text]
11. Renne R, Zhong W, Herndier B, et al. Lytic growth of Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) in culture. Nat Med 1996;2:342-346. [CrossRef][Medline]
12. Huang YQ, Friedman-Kien AE, Li JJ, Nickoloff BJ. Cultured Kaposi's sarcoma cell lines express factor XIIIa, CD14, and VCAM-1, but not factor VIII or ELAM-1. Arch Dermatol 1993;129:1291-1296. [Erratum, Arch Dermatol 1993;129:1622.] [Free Full Text]
13. Yang J, Xu Y, Zhu C, Hagan MK, Lawley T, Offermann MK. Regulation of adhesion molecule expression in Kaposi's sarcoma cells. J Immunol 1994;152:361-373. [Abstract]
14. Eizuru Y, Inagawa S, Minamishima Y. Application of "Hirt supernatant" DNA to the molecular epidemiology of cytomegalovirus infections. J Clin Microbiol 1984;20:1012-1014. [Free Full Text]
15. Pater MM, Hyman RW, Rapp F. Isolation of herpes simplex virus DNA from the "Hirt supernatant." Virology 1976;75:481-483. [Medline]
16. Coen DM. Quantitation of rare DNAs by PCR. In: Ausubel FM, Brent R, Kingston RE, et al., eds. Current protocols in molecular biology. Vol. 2. New York: Greene Publishing, 1992:15.3.1-15.3.8.
17. Sa'Adu A, Thomson BJ, Bountiff L, Webster AD. Lymphotropic viruses in "common variable" immunodeficiency -- PCR analysis of lymphocyte DNA for HIV-1 and HHV-6. Clin Exp Immunol 1993;91:50-53. [Medline]
18. Cao M, Xiao X, Egbert B, Darragh TM, Yen TS. Rapid detection of cutaneous herpes simplex virus infection with the polymerase chain reaction. J Invest Dermatol 1989;92:391-392. [CrossRef][Medline]
19. Apolloni A, Sculley TB. Detection of A-type and B-type Epstein-Barr virus in throat washings and lymphocytes. Virology 1994;202:978-981. [CrossRef][Medline]
20. Duckett CS, Perkins ND, Kowalik TF, et al. Dimerization of NF-KB2 with RelA(p65) regulates DNA binding, transcriptional activation, and inhibition by an IB- (MAD-3). Mol Cell Biol 1993;13:1315-1322. [Free Full Text]
21. Lenhoff RJ, Summers J. Coordinate regulation of replication and virus assembly by the large envelope protein of an avian hepadnavirus. J Virol 1994;68:4565-4571. [Free Full Text]
22. Naidu YM, Rosen EM, Zitnick R, et al. Role of scatter factor in the pathogenesis of AIDS-related Kaposi's sarcoma. Proc Natl Acad Sci U S A 1994;91:5281-5285. [Free Full Text]
23. Lebbe C, de Cremoux P, Rybojad M, Costa da Cunha C, Morel P, Calvo F. Kaposi's sarcoma and new herpesvirus. Lancet 1995;345:1180-1180. 
24. Dupin N, Grandadam M, Calvez V, et al. Herpesvirus-like DNA sequences in patients with Mediterranean Kaposi's sarcoma. Lancet 1995;345:761-762. [CrossRef][Medline]
25. Whitby D, Howard MR, Tenant-Flowers M, et al. Detection of Kaposi sarcoma associated herpesvirus in peripheral blood of HIV-infected individuals and progression to Kaposi's sarcoma. Lancet 1995;346:799-802. [CrossRef][Medline]
26. Rady PL, Yen A, Rollefson JL, et al. Herpesvirus-like DNA sequences in non-Kaposi's sarcoma skin lesions of transplant patients. Lancet 1995;345:1339-1340. [CrossRef][Medline]
27. Lin JC, Lin SC, Mar EC, et al. Is Kaposi's-sarcoma-associated herpesvirus detectable in semen of HIV-infected homosexual men? Lancet 1995;346:1601-1602. [CrossRef][Medline]
28. Finesmith TH, Shrum JP. Kaposi's sarcoma. Int J Dermatol 1994;33:755-762. [Medline]
29. Ioachim HL, Adsay V, Giancotti FR, Dorsett B, Melamed J. Kaposi's sarcoma of internal organs: a multiparameter study of 86 cases. Cancer 1995;75:1376-1385. [CrossRef][Medline]
30. Jones K, Rivera C, Sgadari C, et al. Infection of human endothelial cells with Epstein-Barr virus. J Exp Med 1995;182:1213-1221. [Free Full Text]
31. Boshoff C, Talbot S, Kennedy M, O'Leary J, Schulz T, Chang Y. HHV8 and skin cancers in immunosuppressed patients. Lancet 1996;347:338-339. [Erratum, Lancet 1996;348:138.] [Medline]
32. Moore PS, Gao SJ, Dominguez G, et al. Primary characterization of a herpesvirus agent associated with Kaposi's sarcoma. J Virol 1996;70:549-558. [Free Full Text]
33. Kedes DH, Operskalski E, Busch M, Kohn R, Flood J, Ganem D. The seroepidemiology of human herpesvirus 8 (Kaposi's sarcoma-associated herpesvirus): distribution of infection in KS risk groups and evidence for sexual transmission. Nat Med 1996;2:918-924. [CrossRef][Medline]
34. Gao SJ, Kingsley L, Li M, et al. KSHV antibodies among Americans, Italians and Ugandans with and without Kaposi's sarcoma. Nat Med 1996;2:925-928. [CrossRef][Medline]

Abstract PDF Letters Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited PubMed Citation

Related Letters:

Propagation of a Human Herpesvirus from AIDS-Associated Kaposi's Sarcoma
Blauvelt A., Herndier B. G., Orenstein J. M., Friborg J., Nabel G. J., Nickoloff B. J.
Extract | Full Text  
N Engl J Med 1997; 336:1837-1839, Jun 19, 1997. Correspondence

This article has been cited by other articles:

• Gonzalez, C. M., Wang, L., Damania, B. (2009). Kaposi's Sarcoma-Associated Herpesvirus Encodes a Viral Deubiquitinase. J. Virol. 83: 10224-10233 [Abstract] [Full Text]  
• Subramanian, R., D'Auvergne, O., Kong, H., Kousoulas, K. G. (2008). The Cytoplasmic Terminus of Kaposi's Sarcoma-Associated Herpesvirus Glycoprotein B Is Not Essential for Virion Egress and Infectivity. J. Virol. 82: 7144-7154 [Abstract] [Full Text]  
• Curry, C. L., Reed, L. L., Broude, E., Golde, T. E., Miele, L., Foreman, K. E. (2007). Notch inhibition in Kaposi's sarcoma tumor cells leads to mitotic catastrophe through nuclear factor-{kappa}B signaling. Molecular Cancer Therapeutics 6: 1983-1992 [Abstract] [Full Text]  
• Brinkmann, M. M., Pietrek, M., Dittrich-Breiholz, O., Kracht, M., Schulz, T. F. (2007). Modulation of Host Gene Expression by the K15 Protein of Kaposi's Sarcoma-Associated Herpesvirus. J. Virol. 81: 42-58 [Abstract] [Full Text]  
• Pan, H., Xie, J., Ye, F., Gao, S.-J. (2006). Modulation of Kaposi's Sarcoma-Associated Herpesvirus Infection and Replication by MEK/ERK, JNK, and p38 Multiple Mitogen-Activated Protein Kinase Pathways during Primary Infection. J. Virol. 80: 5371-5382 [Abstract] [Full Text]  
• Teo, C.G. (2006). Conceptual Emergence of Human Herpesvirus 8 (Kaposi's Sarcoma-associated Herpesvirus) as an Oral Herpesvirus. ADR 19: 85-90 [Abstract] [Full Text]  
• Lu, F., Day, L., Lieberman, P. M. (2005). Kaposi's Sarcoma-Associated Herpesvirus Virion-Induced Transcription Activation of the ORF50 Immediate-Early Promoter. J. Virol. 79: 13180-13185 [Abstract] [Full Text]  
• Caselli, E., Galvan, M., Cassai, E., Caruso, A., Sighinolfi, L., Di Luca, D. (2005). Human herpesvirus 8 enhances human immunodeficiency virus replication in acutely infected cells and induces reactivation in latently infected cells. Blood 106: 2790-2797 [Abstract] [Full Text]  
• Dittmer, D. P., Gonzalez, C. M., Vahrson, W., DeWire, S. M., Hines-Boykin, R., Damania, B. (2005). Whole-Genome Transcription Profiling of Rhesus Monkey Rhadinovirus. J. Virol. 79: 8637-8650 [Abstract] [Full Text]  
• Gasperini, P., Barbierato, M., Martinelli, C., Rigotti, P., Marchini, F., Masserizzi, G., Leoncini, F., Chieco-Bianchi, L., Schulz, T. F., Calabro, M. L. (2005). Use of a BJAB-Derived Cell Line for Isolation of Human Herpesvirus 8. J. Clin. Microbiol. 43: 2866-2875 [Abstract] [Full Text]  
• Lu, C., Zeng, Y., Huang, Z., Huang, L., Qian, C., Tang, G., Qin, D. (2005). Human Herpesvirus 6 Activates Lytic Cycle Replication of Kaposi's Sarcoma-Associated Herpesvirus. Am. J. Pathol. 166: 173-183 [Abstract] [Full Text]  
• Malik, P., Blackbourn, D. J., Cheng, M. F., Hayward, G. S., Clements, J. B. (2004). Functional co-operation between the Kaposi's sarcoma-associated herpesvirus ORF57 and ORF50 regulatory proteins. J. Gen. Virol. 85: 2155-2166 [Abstract] [Full Text]  
• Luna, R. E., Zhou, F., Baghian, A., Chouljenko, V., Forghani, B., Gao, S.-J., Kousoulas, K. G. (2004). Kaposi's Sarcoma-Associated Herpesvirus Glycoprotein K8.1 Is Dispensable for Virus Entry. J. Virol. 78: 6389-6398 [Abstract] [Full Text]  
• Damania, B., Jeong, J. H., Bowser, B. S., DeWire, S. M., Staudt, M. R., Dittmer, D. P. (2004). Comparison of the Rta/Orf50 Transactivator Proteins of Gamma-2-Herpesviruses. J. Virol. 78: 5491-5499 [Abstract] [Full Text]  
• Duus, K. M., Lentchitsky, V., Wagenaar, T., Grose, C., Webster-Cyriaque, J. (2004). Wild-Type Kaposi's Sarcoma-Associated Herpesvirus Isolated from the Oropharynx of Immune-Competent Individuals Has Tropism for Cultured Oral Epithelial Cells. J. Virol. 78: 4074-4084 [Abstract] [Full Text]  
• Lu, F., Zhou, J., Wiedmer, A., Madden, K., Yuan, Y., Lieberman, P. M. (2003). Chromatin Remodeling of the Kaposi's Sarcoma-Associated Herpesvirus ORF50 Promoter Correlates with Reactivation from Latency. J. Virol. 77: 11425-11435 [Abstract] [Full Text]  
• Gao, S.-J., Deng, J.-H., Zhou, F.-C. (2003). Productive Lytic Replication of a Recombinant Kaposi's Sarcoma-Associated Herpesvirus in Efficient Primary Infection of Primary Human Endothelial Cells. J. Virol. 77: 9738-9749 [Abstract] [Full Text]  
• Dourmishev, L. A., Dourmishev, A. L., Palmeri, D., Schwartz, R. A., Lukac, D. M. (2003). Molecular Genetics of Kaposi's Sarcoma-Associated Herpesvirus (Human Herpesvirus 8) Epidemiology and Pathogenesis. Microbiol. Mol. Biol. Rev. 67: 175-212 [Abstract] [Full Text]  
• Bechtel, J. T., Liang, Y., Hvidding, J., Ganem, D. (2003). Host Range of Kaposi's Sarcoma-Associated Herpesvirus in Cultured Cells. J. Virol. 77: 6474-6481 [Abstract] [Full Text]  
• Tang, J., Gordon, G. M., Muller, M. G., Dahiya, M., Foreman, K. E. (2003). Kaposi's Sarcoma-Associated Herpesvirus Latency-Associated Nuclear Antigen Induces Expression of the Helix-Loop-Helix Protein Id-1 in Human Endothelial Cells. J. Virol. 77: 5975-5984 [Abstract] [Full Text]  
• Bowser, B. S., DeWire, S. M., Damania, B. (2002). Transcriptional Regulation of the K1 Gene Product of Kaposi's Sarcoma-Associated Herpesvirus. J. Virol. 76: 12574-12583 [Abstract] [Full Text]  
• Ueda, K., Ishikawa, K., Nishimura, K., Sakakibara, S., Do, E., Yamanishi, K. (2002). Kaposi's Sarcoma-Associated Herpesvirus (Human Herpesvirus 8) Replication and Transcription Factor Activates the K9 (vIRF) Gene through Two Distinct cis Elements by a Non-DNA-Binding Mechanism. J. Virol. 76: 12044-12054 [Abstract] [Full Text]  
• Dezube, B. J., Zambela, M., Sage, D. R., Wang, J.-F., Fingeroth, J. D. (2002). Characterization of Kaposi sarcoma-associated herpesvirus/human herpesvirus-8 infection of human vascular endothelial cells: early events. Blood 100: 888-896 [Abstract] [Full Text]  
• Ablashi, D. V., Chatlynne, L. G., Whitman, J. E. Jr., Cesarman, E. (2002). Spectrum of Kaposi's Sarcoma-Associated Herpesvirus, or Human Herpesvirus 8, Diseases. Clin. Microbiol. Rev. 15: 439-464 [Abstract] [Full Text]  
• Zhou, F.-C., Zhang, Y.-J., Deng, J.-H., Wang, X.-P., Pan, H.-Y., Hettler, E., Gao, S.-J. (2002). Efficient Infection by a Recombinant Kaposi's Sarcoma-Associated Herpesvirus Cloned in a Bacterial Artificial Chromosome: Application for Genetic Analysis. J. Virol. 76: 6185-6196 [Abstract] [Full Text]  
• Pertel, P. E. (2002). Human Herpesvirus 8 Glycoprotein B (gB), gH, and gL Can Mediate Cell Fusion. J. Virol. 76: 4390-4400 [Abstract] [Full Text]  
• Lagunoff, M., Bechtel, J., Venetsanakos, E., Roy, A.-M., Abbey, N., Herndier, B., McMahon, M., Ganem, D. (2002). De Novo Infection and Serial Transmission of Kaposi's Sarcoma-Associated Herpesvirus in Cultured Endothelial Cells. J. Virol. 76: 2440-2448 [Abstract] [Full Text]  
• An, J., Lichtenstein, A. K., Brent, G., Rettig, M. B. (2002). The Kaposi sarcoma-associated herpesvirus (KSHV) induces cellular interleukin 6 expression: role of the KSHV latency-associated nuclear antigen and the AP1 response element. Blood 99: 649-654 [Abstract] [Full Text]  
• Hyun, T. S., Subramanian, C., Cotter, M. A. II, Thomas, R. A., Robertson, E. S. (2001). Latency-Associated Nuclear Antigen Encoded by Kaposi's Sarcoma-Associated Herpesvirus Interacts with Tat and Activates the Long Terminal Repeat of Human Immunodeficiency Virus Type 1 in Human Cells. J. Virol. 75: 8761-8771 [Abstract] [Full Text]  
• Garber, A. C., Shu, M. A., Hu, J., Renne, R. (2001). DNA Binding and Modulation of Gene Expression by the Latency-Associated Nuclear Antigen of Kaposi's Sarcoma-Associated Herpesvirus. J. Virol. 75: 7882-7892 [Abstract] [Full Text]  
• Sakurada, S., Katano, H., Sata, T., Ohkuni, H., Watanabe, T., Mori, S. (2001). Effective Human Herpesvirus 8 Infection of Human Umbilical Vein Endothelial Cells by Cell-Mediated Transmission. J. Virol. 75: 7717-7722 [Abstract] [Full Text]  
• Ciufo, D. M., Cannon, J. S., Poole, L. J., Wu, F. Y., Murray, P., Ambinder, R. F., Hayward, G. S. (2001). Spindle Cell Conversion by Kaposi's Sarcoma-Associated Herpesvirus: Formation of Colonies and Plaques with Mixed Lytic and Latent Gene Expression in Infected Primary Dermal Microvascular Endothelial Cell Cultures. J. Virol. 75: 5614-5626 [Abstract] [Full Text]  
• Cerimele, F., Curreli, F., Ely, S., Friedman-Kien, A. E., Cesarman, E., Flore, O. (2001). Kaposi's Sarcoma-Associated Herpesvirus Can Productively Infect Primary Human Keratinocytes and Alter Their Growth Properties. J. Virol. 75: 2435-2443 [Abstract] [Full Text]  
• Jeong, J., Papin, J., Dittmer, D. (2001). Differential Regulation of the Overlapping Kaposi's Sarcoma-Associated Herpesvirus vGCR (orf74) and LANA (orf73) Promoters. J. Virol. 75: 1798-1807 [Abstract] [Full Text]  
• Renne, R., Barry, C., Dittmer, D., Compitello, N., Brown, P. O., Ganem, D. (2001). Modulation of Cellular and Viral Gene Expression by the Latency-Associated Nuclear Antigen of Kaposi's Sarcoma-Associated Herpesvirus. J. Virol. 75: 458-468 [Abstract] [Full Text]  
• Cannon, J. S., Ciufo, D., Hawkins, A. L., Griffin, C. A., Borowitz, M. J., Hayward, G. S., Ambinder, R. F. (2000). A New Primary Effusion Lymphoma-Derived Cell Line Yields a Highly Infectious Kaposi's Sarcoma Herpesvirus-Containing Supernatant. J. Virol. 74: 10187-10193 [Abstract] [Full Text]  
• Keller, S. A., Schattner, E. J., Cesarman, E. (2000). Inhibition of NF-kappa B induces apoptosis of KSHV-infected primary effusion lymphoma cells. Blood 96: 2537-2542 [Abstract] [Full Text]  
• Chen, J., Ueda, K., Sakakibara, S., Okuno, T., Yamanishi, K. (2000). Transcriptional Regulation of the Kaposi's Sarcoma-Associated Herpesvirus Viral Interferon Regulatory Factor Gene. J. Virol. 74: 8623-8634 [Abstract] [Full Text]  
• Chang, J., Ganem, D. (2000). On the control of late gene expression in Kaposi's sarcoma-associated herpesvirus (human herpesvirus-8). J. Gen. Virol. 81: 2039-2047 [Abstract] [Full Text]  
• Mori, Y., Dhepakson, P., Shimamoto, T., Ueda, K., Gomi, Y., Tani, H., Matsuura, Y., Yamanishi, K. (2000). Expression of Human Herpesvirus 6B rep within Infected Cells and Binding of Its Gene Product to the TATA-Binding Protein In Vitro and In Vivo. J. Virol. 74: 6096-6104 [Abstract] [Full Text]  
• Mercader, M., Taddeo, B., Panella, J. R., Chandran, B., Nickoloff, B. J., Foreman, K. E. (2000). Induction of HHV-8 Lytic Cycle Replication by Inflammatory Cytokines Produced by HIV-1-Infected T Cells. Am. J. Pathol. 156: 1961-1971 [Abstract] [Full Text]  
• Alexander, L., Denekamp, L., Knapp, A., Auerbach, M. R., Damania, B., Desrosiers, R. C. (2000). The Primary Sequence of Rhesus Monkey Rhadinovirus Isolate 26-95: Sequence Similarities to Kaposi's Sarcoma-Associated Herpesvirus and Rhesus Monkey Rhadinovirus Isolate 17577. J. Virol. 74: 3388-3398 [Abstract] [Full Text]  
• Haque, M., Chen, J., Ueda, K., Mori, Y., Nakano, K., Hirata, Y., Kanamori, S., Uchiyama, Y., Inagi, R., Okuno, T., Yamanishi, K. (2000). Identification and Analysis of the K5 Gene of Kaposi's Sarcoma-Associated Herpesvirus. J. Virol. 74: 2867-2875 [Abstract] [Full Text]  
• Haramati, L. B., Wong, J. (2000). Intrathoracic Kaposi’s Sarcoma in Women With AIDS. Chest 117: 410-414 [Abstract] [Full Text]  
• Dittmer, D., Stoddart, C., Renne, R., Linquist-Stepps, V., Moreno, M.E., Bare, C., McCune, J.M., Ganem, D. (1999). Experimental Transmission of Kaposi's Sarcoma-Associated Herpesvirus (Kshv/Hhv-8) to Scid-Hu Thy/Liv Mice. JEM 190: 1857-1868 [Abstract] [Full Text]  
• Moses, A. V., Fish, K. N., Ruhl, R., Smith, P. P., Strussenberg, J. G., Zhu, L., Chandran, B., Nelson, J. A. (1999). Long-Term Infection and Transformation of Dermal Microvascular Endothelial Cells by Human Herpesvirus 8. J. Virol. 73: 6892-6902 [Abstract] [Full Text]  
• Mueller, B. U. (1999). Cancers in Children Infected With the Human Immunodeficiency Virus. The Oncologist 4: 309-317 [Abstract] [Full Text]  
• Drago, F., Rebora, A. (1999). The New Herpesviruses: Emerging Pathogens of Dermatological Interest. Arch Dermatol 135: 71-75 [Abstract] [Full Text]  
• Friborg, J. Jr., Kong, W.-P., Flowers, C. C., Flowers, S. L., Sun, Y., Foreman, K. E., Nickoloff, B. J., Nabel, G. J. (1998). Distinct Biology of Kaposi's Sarcoma-Associated Herpesvirus from Primary Lesions and Body Cavity Lymphomas. J. Virol. 72: 10073-10082 [Abstract] [Full Text]  
• Kliche, S., Kremmer, E., Hammerschmidt, W., Koszinowski, U., Haas, J. (1998). Persistent Infection of Epstein-Barr Virus-Positive B Lymphocytes by Human Herpesvirus 8. J. Virol. 72: 8143-8149 [Abstract] [Full Text]  
• Dittmer, D., Lagunoff, M., Renne, R., Staskus, K., Haase, A., Ganem, D. (1998). A Cluster of Latently Expressed Genes in Kaposi's Sarcoma-Associated Herpesvirus. J. Virol. 72: 8309-8315 [Abstract] [Full Text]  
• Foreman, K. E., Alkan, S., Krueger, A. E., Panella, J. R., Swinnen, L. J., Nickoloff, B. J. (1998). Geographically Distinct HHV-8 DNA Sequences in Saudi Arabian Iatrogenic Kaposi's Sarcoma Lesions. Am. J. Pathol. 153: 1001-1004 [Abstract] [Full Text]  
• Renne, R., Blackbourn, D., Whitby, D., Levy, J., Ganem, D. (1998). Limited Transmission of Kaposi's Sarcoma-Associated Herpesvirus in Cultured Cells. J. Virol. 72: 5182-5188 [Abstract] [Full Text]  
• Moore, P. S., Chang, Y. (1998). Kaposi's Sarcoma-Associated Herpesvirus-Encoded Oncogenes and Oncogenesis. J Natl Cancer Inst Monogr 1998: 65-71 [Abstract] [Full Text]  
• Sarid, R., Flore, O., Bohenzky, R. A., Chang, Y., Moore, P. S. (1998). Transcription Mapping of the Kaposi's Sarcoma-Associated Herpesvirus (Human Herpesvirus 8) Genome in a Body Cavity-Based Lymphoma Cell Line (BC-1). J. Virol. 72: 1005-1012 [Abstract] [Full Text]  
• Fiorelli, V., Gendelman, R., Caterina Sirianni, M., Chang, H.-K., Colombini, S., Markham, P. D., Monini, P., Sonnabend, J., Pintus, A., Gallo, R. C., Ensoli, B. (1998). gamma -Interferon Produced by CD8+ T Cells Infiltrating Kaposi's Sarcoma Induces Spindle Cells With Angiogenic Phenotype and Synergy With Human Immunodeficiency Virus-1 Tat Protein: An Immune Response to Human Herpesvirus-8 Infection?. Blood 91: 956-967 [Abstract] [Full Text]  
• Sirianni, M. C., Vincenzi, L., Fiorelli, V., Topino, S., Scala, E., Uccini, S., Angeloni, A., Faggioni, A., Cerimele, D., Cottoni, F., Aiuti, F., Ensoli, B. (1998). gamma -Interferon Production in Peripheral Blood Mononuclear Cells and Tumor Infiltrating Lymphocytes From Kaposi's Sarcoma Patients: Correlation With the Presence of Human Herpesvirus-8 in Peripheral Blood Mononuclear Cells and Lesional Macrophages. Blood 91: 968-976 [Abstract] [Full Text]  
• Blauvelt, A., Herndier, B. G., Orenstein, J. M., Friborg, J., Nabel, G. J., Nickoloff, B. J. (1997). Propagation of a Human Herpesvirus from AIDS-Associated Kaposi's Sarcoma. NEJM 336: 1837-1839 [Full Text]  
• (1997). Infectious Diseases. JAMA 277: 1865-1866  
• (1997). KSHV Grown from KS Lesions. AIDS Clin Care 1997: 3-3 [Full Text]  
• Mocarski, E. S. (1997). Propagating Kaposi's Sarcoma-Associated Herpesvirus. NEJM 336: 213-215 [Full Text]  
• Knight, J. S., Cotter, M. A. II, Robertson, E. S. (2001). The Latency-associated Nuclear Antigen of Kaposi's Sarcoma-associated Herpesvirus Transactivates the Telomerase Reverse Transcriptase Promoter. J. Biol. Chem. 276: 22971-22978 [Abstract] [Full Text]