The Risk of Recurrent Venous Thromboembolism in Patients with an Arg506Gln Mutation in the Gene for Factor V (Factor V Leiden)
Paolo Simioni, M.D., Paolo Prandoni, M.D., Ph.D., Anthonie W.A. Lensing, M.D., Ph.D., Alberta Scudeller, M.D., Corrado Sardella, M.D., Martin H. Prins, M.D., Ph.D., Sabina Villalta, M.D., Francesco Dazzi, M.D., and Antonio Girolami, M.D.
Background A recently discovered mutation in coagulation factorV (Arg506Gln, referred to as factor V Leiden), which resultsin resistance to activated protein C, is found in approximatelyone fifth of patients with venous thromboembolism. However,the risk of recurrent thromboembolism in heterozygous carriersof this genetic abnormality is unknown.
Methods We searched for factor V Leiden in 251 unselected patientswith a first episode of symptomatic deep-vein thrombosis diagnosedby venography. The patients were followed prospectively fora mean of 3.9 years to determine the frequency of recurrentvenous thrombosis and pulmonary embolism.
Results Factor V Leiden was found in 41 of the patients (16.3percent; 95 percent confidence interval, 11.8 to 20.9 percent).The cumulative incidence of recurrent venous thromboembolismafter follow-up of up to eight years was 39.7 percent (95 percentconfidence interval, 22.8 to 56.5 percent) among carriers ofthe mutation, as compared with 18.3 percent (95 percent confidenceinterval, 12.3 to 24.3 percent) among patients without the mutation(hazard ratio, 2.4; 95 percent confidence interval, 1.3 to 4.5;P<0.01).
Conclusions The risk of recurrent thromboembolic events is significantlyhigher in carriers of factor V Leiden than in patients withoutthis abnormality. Large trials assessing the riskbenefitratio of long-term anticoagulation in carriers of the mutationwho have had a first episode of venous thromboembolism are indicated.
Patients who have symptomatic deep-vein thrombosis of the legsremain at risk for recurrent venous thromboembolism despiteadequate treatment with heparin and warfarin.1 In a recent long-termfollow-up study of a consecutive series of patients with a firstepisode of symptomatic deep-vein thrombosis, the cumulativeincidence of recurrent venous thrombosis or pulmonary embolismexceeded 30 percent over a period of eight years.2
Venous thromboembolism can occur without apparent cause, aftersurgical procedures or trauma, and in the presence of canceror molecular defects in several hemostatic components (antithrombin,protein C, protein S, plasminogen, and fibrinogen). The prevalenceof these protein abnormalities among patients with venous thromboembolism,however, is only 5 to 10 percent.3,4
Recently, resistance to activated protein C, a newly discoveredhereditary trait potentially accounting for a far greater proportionof patients with thromboembolic disorders, has been described.5,6This abnormality is caused by the substitution of a single aminoacid glutamine for arginine at position 506(Arg506Gln, also referred to as factor V Leiden), in the coagulationfactor V molecule.7,8,9 In its activated form protein C is anatural anticoagulant that cleaves two activated coagulant factors,factor VIIIa and factor Va, thereby inhibiting the conversionof factor X to factor Xa and of prothrombin to thrombin. Themutation in the factor V molecule renders factor Va resistantto proteolysis by activated protein C. Venous thromboembolismdevelops in up to 40 percent of patients with resistance toactivated protein C.10,11,12
Although it is important to know the risk of recurrent venousthromboembolic disease in order to make decisions about therapyin carriers of the factor V Leiden mutation, the few studiesof the risk have yielded conflicting results.13,14 Therefore,we studied the prevalence of this mutation in a large cohortof unselected patients with a first episode of symptomatic deep-veinthrombosis who underwent long-term, prospective follow-up forrecurrent thromboembolic events.
Methods
Identification of Study Cohort
All outpatients who were referred to the thrombosis unit ofthe University of Padua between January 1986 and June 1994 becauseof a first episode of deep-vein thrombosis diagnosed by venographyand who underwent long-term follow-up were potentially eligiblefor the study.2 Patients were excluded from the study if theyhad malignant disease or confirmed abnormalities in the coagulationor fibrinolytic system (defects of antithrombin, protein C,protein S, fibrinogen, or plasminogen or the presence of lupus-likeanticoagulants), or if they had received warfarin therapy formore than six months for reasons other than recurrent thromboembolicevents. For all remaining patients, resistance to activatedprotein C was assessed.
Surviving patients who met the eligibility criteria and whoprovided informed consent were asked to come to the thrombosiscenter for assessment of factor V Leiden status. For all patientsin whom the mutation was confirmed, family members were testedto determine whether the defect was familial. Laboratory testswere performed by technicians unaware of the identity of thesubjects. The study protocol was approved by the ethics boardof the University of Padua.
Collection of Blood Samples and Routine Coagulation Tests
Blood samples were collected by venipuncture with 21-gauge butterflyinfusion sets connected to plastic tubes containing 3.8 percentsodium citrate in a ratio of 0.1:0.9 (vol/vol, anticoagulantto blood). Platelet-poor plasma was obtained by centrifugationat 2000xg for 20 minutes and stored at -80°C until it wasanalyzed.
The laboratory investigations included the measurement of theactivated partial-thromboplastin time and prothrombin time.Assays for fibrinogen, plasminogen, antithrombin, protein C,protein S, and antiphospholipid antibodies were performed aspreviously described.15,16 A reference pool of normal plasmafor all these assays was obtained from 40 healthy subjects ofboth sexes (age, 20 to 60 years). Normal values for each testwere determined in 80 healthy subjects of both sexes (age, 20to 70 years).
Assay for Resistance to Activated Protein C
The assay for resistance to activated protein C was performedas described previously.7 Briefly, 50 µl of undilutedplasma was incubated with 50 µl of NAPPT reagent (Cephotest,Immuno, Pisa, Italy) for 360 seconds at 37°C. Clot formationwas started by the addition of either 50 µl of 33 mM calciumchloride, 25 mM TRIShydrochloric acid (pH 7.5), 50 mMsodium chloride, and 0.05 percent ovalbumin (to measure theactivated partial-thromboplastin time in the absence of activatedprotein C) or 50 µl of the same reagent containing 1.0µl of human activated protein C per milliliter (finalconcentration; Enzyme Research Laboratory, South Bend, Ind.)(to measure the activated partial-thromboplastin time in thepresence of activated protein C). A normalized ratio of sensitivityto activated protein C was then calculated. Resistance to activatedprotein C was defined as a normalized ratio of less than 0.84.7
DNA Analysis for Factor V Leiden
High-molecular-weight DNA was extracted from 5 µl of peripheralblood with a binding matrix (Bio-Rad Laboratories, Hercules,Calif.). DNA analysis was performed as previously describedwith minor modifications.7,8,9 Briefly, the 220-bp fragmentof factor V exon 10intron 10 was amplified by the polymerasechain reaction, with 5'TGCCCAGTGCTTAACAAGACCA3' as the forwardprimer and 5'CTTGAAGGAAATGCCCCATTA3' as the reverse primer.Amplification involved 36 cycles consisting of denaturationat 91°C for 40 seconds, annealing at 55°C for 40 seconds,and extension at 71°C for 2 minutes in the presence of 2U of Taq polymerase. Subsequently, the 220-bp fragment was digestedby 0.4 U of MnlI at 37°C over a 16-hour period. MnlI digeststhe 220-bp fragment of the normal factor V allele into threefragments of 37, 67, and 116 bp each. The factor V Leiden allelewas cleaved in only two fragments of 67 and 153 bp. Finally,the digestion products were separated by electrophoresis on2 percent agarose gels stained with ethidium bromide for 30minutes at 150 V.
Treatment
Patients were admitted to the hospital and treated with an initialcourse of high-dose intravenous standard heparin (a bolus of5000 U was followed by a continuous infusion of 30,000 U perday, with the dose subsequently adjusted to maintain an activatedpartial-thromboplastin time between 1.5 and 2.5 times the normalvalue) or subcutaneous low-molecular-weight heparin (90 U ofantifactor Xa per kilogram of body weight twice daily). Therapywith oral anticoagulant agents (warfarin) was started on day5, 6, or 7 of treatment and continued for a period of threeor six months; the dose was adjusted daily to maintain an internationalnormalized ratio between 2.0 and 3.0. Treatment with low-molecular-weightheparin was discontinued on day 10 or later if the internationalnormalized ratio was less than 2.0. All patients were instructedto wear elastic graduated-compression stockings (providing 40mm Hg of pressure at the ankle) for at least two years.
Diagnosis of Recurrent Venous Thromboembolism
Recurrent deep-vein thrombosis was identified by venographyor compression ultrasonography, according to standard methods.If the results of venography were not diagnostic, recurrentvenous thrombosis was diagnosed on the basis of abnormal resultson scanning of the legs with fibrinogen I 125 or on the basisof a change in the results of noninvasive tests from normalto abnormal.17,18,19,20 Patients thought to have pulmonary embolismunderwent lung scanning or venography if they had concurrentsymptoms of thromboembolism in the legs. Patients with lungscans indicating a low or intermediate probability of pulmonaryembolism underwent pulmonary angiography. Lung scanning andpulmonary angiography were performed and interpreted accordingto standard procedures.21,22 A diagnosis of fatal pulmonaryembolism was based on the findings at autopsy or the opinionof a physician who was not associated with the study. Recurrentvenous thromboembolic events were assessed by a committee thatwas unaware of further clinical details (including factor VLeiden status) of the patients.
Statistical Analysis
The cumulative incidence of recurrent thromboembolic eventsamong patients with and those without factor V Leiden was calculatedaccording to the method of Kaplan and Meier. The Cox proportional-hazardsmodel was used to assess the significance of the differencebetween groups and to determine the hazard ratios and 95 percentconfidence intervals. All P values of less than 0.05 were consideredto indicate statistical significance.
Results
Patients
Of the 517 patients who were referred for a first episode ofdeep-vein thrombosis, 170 were excluded from the study for thefollowing reasons: 101 had malignant disease at the time ofthe initial diagnosis, 51 had documented abnormalities in thecoagulation or fibrinolytic system, and 18 had been taking oralanticoagulants for more than six months for reasons other thanvenous thromboembolism. Of the remaining 347 patients, 85 werenot available for genetic testing. Resistance to activated proteinC was found in 13 of these 85 patients (15.3 percent). Of theremaining 262 patients, 251 gave their informed consent andwere enrolled in the study.
Demographic and Clinical Characteristics
The demographic and clinical characteristics of the study patientsare presented in Table 1, according to their factor V Leidenstatus. Additional risk factors that may contribute to the developmentof deep-vein thrombosis (recent trauma or fracture, recent surgery,the use of oral contraceptive drugs, and pregnancy or childbirth)were equally distributed between the groups.
Table 1. Demographic, Clinical, and Treatment-Related Characteristics of Patients with and Those without Factor V Leiden.
A total of 112 patients (44.6 percent) completed five yearsof follow-up, and 45 (17.9 percent) completed eight years offollow-up. The mean duration of follow-up was 3.9 years.
Prevalence of Factor V Leiden
Factor V Leiden was found in 41 patients (16.3 percent; 95 percentconfidence interval, 11.8 to 20.9 percent). The prevalence ofthis abnormality in patients with idiopathic deep-vein thrombosis(28 of 145, 19.3 percent) did not differ from that in patientswhose thrombotic episode was associated with a well-recognizedrisk factor (13 of 106, 12.3 percent). All carriers of the factorV gene were heterozygous for the mutation. The hereditary natureof the defect was confirmed in all 41 patients by the identificationof at least one first-degree relative who carried the mutation.
Recurrent Venous Thromboembolism in Patients with and Those without Factor V Leiden
Of the 251 patients, 49 had had one or more documented recurrentvenous thromboembolic events. Fourteen patients with factorV Leiden (10 of the 28 patients with idiopathic deep-vein thrombosis[35.7 percent] and 4 of the 13 patients with risk factors fordeep-vein thrombosis [30.7 percent]) had recurrent thromboembolicevents. Thirty-five patients without the mutation had recurrences(29 of the 128 patients with idiopathic deep-vein thrombosis[22.7 percent] and 6 of the 82 patients with secondary deep-veinthrombosis [7.3 percent]). Of the 49 first recurrences, 25 (51.0percent) were in the leg that was involved in the initial episode,17 (34.7 percent) were in the contralateral leg, and 7 (14.3percent) were pulmonary embolisms. Forty-four of the recurrenceswere not associated with any apparent risk factor, and 5 wereassociated with a (new) risk factor; 2 of these 5 recurrenceswere in carriers of factor V Leiden.
The cumulative incidence of recurrent thromboembolism amongpatients with factor V Leiden after eight years of follow-upwas 39.7 percent (95 percent confidence interval, 22.8 to 56.5percent), as compared with 18.3 percent (95 percent confidenceinterval, 12.3 to 24.3 percent) among patients without thismutation (Figure 1). The hazard ratio for recurrent venous thromboembolismamong patients with the mutation, as compared with patientswithout the defect, was 2.4 (95 percent confidence interval,1.3 to 4.5; P<0.01). The hazard ratio for patients with secondarydeep-vein thrombosis, as compared with those with idiopathicdeep-vein thrombosis, was 0.41 (95 percent confidence interval,0.20 to 0.82). A test for an interaction between factor V Leidenstatus and the type of deep-vein thrombosis was negative (P>0.15).
Figure 1. Cumulative Incidence of Recurrent Venous Thromboembolism after a First Episode of Symptomatic Deep-Vein Thrombosis in Patients with and Those without Factor V Leiden.
Seventeen of the 85 patients who were not available for genetictesting had recurrent thromboembolic events: 5 of the 13 patientswith resistance to activated protein C and 12 of the 72 patientswithout this abnormality (relative risk of a recurrence amongpatients with resistance to activated protein C, 2.4).
Six of the patients without the mutation had recurrent thromboembolicepisodes while receiving anticoagulant therapy (2.9 percent),all within the first three months, and four of the patientswith the mutation had recurrences (9.8 percent), three withinthe first three months.
Discussion
Hereditary abnormalities in the coagulation or fibrinolyticsystem are well-recognized but uncommon conditions predisposingpatients to venous thrombosis. Recently, it was demonstratedthat a large proportion of patients with venous thromboembolicdisease have factor V Leiden.10,11,12 The activated form offactor V Leiden is resistant to proteolytic cleavage by thenatural anticoagulant activated protein C. The results of ourstudy in a large cohort of consecutive patients with venousthrombosis confirm that the prevalence of the genetic mutationresponsible for resistance to activated protein C is higher(16.3 percent) than that of all the previously described inheriteddefects (5 to 10 percent). Furthermore, it is equally distributedin patients with idiopathic or secondary thrombosis.
Once factor V Leiden has been demonstrated to be associatedwith venous thromboembolism, it is important to know the riskof recurrent thrombotic events in carriers of this mutationto aid in decisions about widespread screening and therapeuticmanagement in identified carriers. Studies in small and selectedgroups of patients have yielded conflicting results.13,14 Ridkeret al. found a higher incidence of recurrent thrombosis in carriersof the mutation,13 whereas Rintelen et al. did not.14
Our study clearly shows that the risk of recurrent thromboembolicevents is strongly and significantly higher in carriers of factorV Leiden than in patients without this abnormality (relativerisk, 2.4), with a cumulative incidence of almost 40 percentafter eight years. These results are similar to those in patientswith hereditary defects of antithrombin, protein C, and proteinS.2 Although in our study all the recurrent thrombotic eventsin patients with factor V Leiden occurred during the first threeyears of follow-up, this finding could be due to the small numberof patients who were followed for more than three years.
We believe that our estimate of the risk of recurrence associatedwith the presence of factor V Leiden is accurate. Only patientsreferred with a first episode of objectively documented deep-veinthrombosis who did not have conditions confounding the riskof recurrence (i.e., cancer, known thrombophilic states, andother conditions requiring long-term treatment with oral anticoagulants)were enrolled. Also, although 15 percent of potentially eligiblepatients died during follow-up and could not be tested for themutation, only a small minority (about 10 percent) of thesepatients died of pulmonary embolism.2 Furthermore, patientswho declined to participate constituted a negligible proportion(4.2 percent) of the cohort. Finally, interpretation bias wasavoided by having observers with no knowledge of the patientsassess recurrent events and the factor V Leiden status. Therelative risk of recurrent venous thromboembolic episodes associatedwith resistance to activated protein C in the 85 patients inwhom a genetic analysis could not be performed was 2.4. Thisvalue is similar to the hazard ratio for the patients who underwentgenetic testing. Therefore, it is unlikely that an importantbias influenced our results.
Although recurrent venous thromboembolism is more frequent inpatients with factor V Leiden, such a statistic does not automaticallyimply that anticoagulant treatment should be prolonged in allthese patients. Because the duration of treatment is also amajor determinant of the risk of hemorrhage, it is essentialto balance the protective effect of these agents against theirrisk of inducing bleeding. A large trial evaluating the useof coumarins for more than the currently recommended three-monthperiod in carriers of this genetic mutation is clearly warranted.This trial should include both patients with idiopathic thrombosisand those with secondary thrombosis.
We are indebted to Paolo Radossi, M.D., Daniela Tormene, M.D.,and Sabrina Gavasso, M.D., for collecting blood samples andproviding technical assistance in laboratory analyses.
Source Information
From the Institute of Medical Semiotics, University Hospital of Padua, Padua, Italy (P.S., P.P., A.S., C.S., S.V., F.D., A.G.); and the Center for Hemostasis, Thrombosis, Atherosclerosis, and Inflammation Research (A.W.A.L.) and the Department of Clinical Epidemiology (M.H.P.), Academic Medical Center, University of Amsterdam, Amsterdam.
Address reprint requests to Dr. Lensing at the Center for Hemostasis, Thrombosis, Atherosclerosis, and Inflammation Research, Academic Medical Center F4-237, Meibergdreef 9, 1105 AZ Amsterdam, the Netherlands.
References
Schulman S, Rhedin A-S, Lindmarker P, et al. A comparison of six weeks with six months of oral anticoagulant therapy after a first episode of venous thromboembolism. N Engl J Med 1995;332:1661-1665. [Free Full Text]
Prandoni P, Lensing AWA, Cogo A, et al. The long-term clinical course of acute deep venous thrombosis. Ann Intern Med 1996;125:1-7. [Free Full Text]
Heijboer H, Brandjes DPM, Büller HR, Sturk A, ten Cate JW. Deficiencies of coagulation-inhibiting and fibrinolytic proteins in outpatients with deep-vein thrombosis. N Engl J Med 1990;323:1512-1516. [Abstract]
Pabinger I, Brucker S, Kyrle PA, et al. Hereditary deficiency of antithrombin III, protein C and protein S: prevalence in patients with a history of venous thrombosis and criteria for rational patient screening. Blood Coagul Fibrinolysis 1992;3:547-553. [Medline]
Dahlbäck B, Carlsson M, Svensson PJ. Familial thrombophilia due to a previously unrecognized mechanism characterized by poor anticoagulant response to activated protein C: prediction of a cofactor to activated protein C. Proc Natl Acad Sci U S A 1993;90:1004-1008. [Free Full Text]
Griffin JH, Evatt B, Wideman C, Fernandez JA. Anticoagulant protein C pathway defective in majority of thrombophilic patients. Blood 1993;82:1989-1993. [Free Full Text]
Bertina RM, Koeleman BPC, Koster T, et al. Mutation in blood coagulation factor V associated with resistance to activated protein C. Nature 1994;369:64-67. [CrossRef][Medline]
Voorberg J, Roelse J, Koopman R, et al. Association of idiopathic venous thromboembolism with single point-mutation at Arg506 of factor V. Lancet 1994;343:1535-1536. [CrossRef][Medline]
Zöller B, Dahlbäck B. Linkage between inherited resistance to activated protein C and factor V gene mutation in venous thrombosis. Lancet 1994;343:1536-1538. [CrossRef][Medline]
Koster T, Rosendaal FR, de Ronde H, Briët E, Vandenbroucke JP, Bertina RM. Venous thrombosis due to poor anticoagulant response to activated protein C: Leiden Thrombophilia Study. Lancet 1993;342:1503-1506. [CrossRef][Medline]
Svensson PJ, Dahlbäck B. Resistance to activated protein C as a basis for venous thrombosis. N Engl J Med 1994;330:517-522. [Free Full Text]
Ridker PM, Hennekens CH, Lindpaintner K, Stampfer MJ, Eisenberg PR, Miletich JP. Mutation in the gene coding for coagulation factor V and the risk of myocardial infarction, stroke, and venous thrombosis in apparently healthy men. N Engl J Med 1995;332:912-917. [Free Full Text]
Ridker PM, Miletich JP, Stampfer MJ, Goldhaber SZ, Lindpaintner K, Hennekens CH. Factor V Leiden and risks of recurrent idiopathic venous thromboembolism. Circulation 1995;92:2800-2802. [Free Full Text]
Rintelen C, Pabinger I, Knobl P, Lechner K, Mannhalter C. Probability of recurrence of thrombosis in patients with and without factor V Leiden. Thromb Haemost 1996;75:229-232. [Medline]
Girolami A, Simioni P, Girolami B, et al. A novel dysfunctional protein C (protein C Padua 2) associated with a thrombotic tendency: substitution of Cys for Arg-1 results in a strongly reduced affinity for binding of Ca++. Br J Haematol 1993;85:521-527. [Medline]
Triplett DA. Antiphospholipid-protein antibodies: laboratory detection and clinical relevance. Thromb Res 1995;78:1-31. [CrossRef][Medline]
Prandoni P, Cogo A, Bernardi E, et al. A simple ultrasound approach for detection of recurrent proximal-vein thrombosis. Circulation 1993;88:1730-1735. [Free Full Text]
Hull RD, Carter CJ, Jay RM, et al. The diagnosis of acute, recurrent, deep-vein thrombosis: a diagnostic challenge. Circulation 1983;67:901-906. [Free Full Text]
Huisman MV, Büller HR, ten Cate JW. Utility of impedance plethysmography in the diagnosis of recurrent deep-vein thrombosis. Arch Intern Med 1988;148:681-683. [Free Full Text]
Hirsh J, Bettman M, Coates G, Hull RD. Diagnosis of pulmonary embolism. In: Colman RW, Hirsh J, Marder VJ, Salzman EW, eds. Hemostasis and thrombosis: basic principles and clinical practice. Philadelphia: J.B. Lippincott, 1993:1322-30.
Lensing AWA, van Beek EJR, Demers C, et al. Ventilation-perfusion lung scanning and the diagnosis of pulmonary embolism: improvement of observer agreement by the use of a lung segment reference chart. Thromb Haemost 1992;68:245-249. [Medline]
Simioni, P., Tormene, D., Tognin, G., Gavasso, S., Bulato, C., Iacobelli, N. P., Finn, J. D., Spiezia, L., Radu, C., Arruda, V. R.
(2009). X-Linked Thrombophilia with a Mutant Factor IX (Factor IX Padua). NEJM
361: 1671-1675
[Abstract][Full Text]
Goldenberg, N. A.
(2008). Thrombophilia States and Markers of Coagulation Activation in the Prediction of Pediatric Venous Thromboembolic Outcomes: A Comparative Analysis with Respect to Adult Evidence. ASH Education Book
2008: 236-244
[Abstract][Full Text]
Marchiori, A., Mosena, L., Prins, M. H., Prandoni, P.
(2007). The risk of recurrent venous thromboembolism among heterozygous carriers of factor V Leiden or prothrombin G20210A mutation. A systematic review of prospective studies. haematol
92: 1107-1114
[Abstract][Full Text]
Vanschoonbeek, K., Feijge, M. A. H., Saris, W. H. M., de Maat, M. P. M., Heemskerk, J. W. M.
(2007). Plasma Triacylglycerol and Coagulation Factor Concentrations Predict the Anticoagulant Effect of Dietary Fish Oil in Overweight Subjects. J. Nutr.
137: 7-13
[Abstract][Full Text]
Mari, T, Zullo, A, Hassan, C, Di Giulio, L, Morini, S
(2006). Genetic association between factor V Leiden and coeliac disease.. Gut
55: 1677-1678
[Full Text]
Ho, W. K., Hankey, G. J., Quinlan, D. J., Eikelboom, J. W.
(2006). Risk of recurrent venous thromboembolism in patients with common thrombophilia: a systematic review.. Arch Intern Med
166: 729-736
[Abstract][Full Text]
Bick, R. L.
(2006). Hereditary and Acquired Thrombophilic Disorders. CLIN APPL THROMB HEMOST
12: 125-135
Juul, K., Tybjaerg-Hansen, A., Mortensen, J., Lange, P., Vestbo, J., Nordestgaard, B. G.
(2005). Factor V Leiden Homozygosity, Dyspnea, and Reduced Pulmonary Function. Arch Intern Med
165: 2032-2036
[Abstract][Full Text]
Christiansen, S. C., Cannegieter, S. C., Koster, T., Vandenbroucke, J. P., Rosendaal, F. R.
(2005). Thrombophilia, Clinical Factors, and Recurrent Venous Thrombotic Events. JAMA
293: 2352-2361
[Abstract][Full Text]
Connor, J. A.
(2005). Factor V Leiden and Its Effect on Children With Cardiac Pathology. Journal of Pediatric Oncology Nursing
22: 176-181
[Abstract]
Cushman, M.
(2005). Inherited Risk Factors for Venous Thrombosis. ASH Education Book
2005: 452-457
[Abstract][Full Text]
Frederiksen, J., Juul, K., Grande, P., Jensen, G. B., Schroeder, T. V., Tybjaerg-Hansen, A., Nordestgaard, B. G.
(2004). Methylenetetrahydrofolate reductase polymorphism (C677T), hyperhomocysteinemia, and risk of ischemic cardiovascular disease and venous thromboembolism: prospective and case-control studies from the Copenhagen City Heart Study. Blood
104: 3046-3051
[Abstract][Full Text]
Buller, H. R., Agnelli, G., Hull, R. D., Hyers, T. M., Prins, M. H., Raskob, G. E.
(2004). Antithrombotic Therapy for Venous Thromboembolic Disease: The Seventh ACCP Conference on Antithrombotic and Thrombolytic Therapy. Chest
126: 401S-428S
[Abstract][Full Text]
Kearon, C.
(2004). Long-Term Management of Patients After Venous Thromboembolism. Circulation
110: I-10-I-18
[Abstract][Full Text]
Humphries, S. E., Ridker, P. M., Talmud, P. J.
(2004). Genetic Testing for Cardiovascular Disease Susceptibility: A Useful Clinical Management Tool or Possible Misinformation?. Arterioscler. Thromb. Vasc. Bio.
24: 628-636
[Abstract][Full Text]
Juul, K., Tybjaerg-Hansen, A., Schnohr, P., Nordestgaard, B. G.
(2004). Factor V Leiden and the Risk for Venous Thromboembolism in the Adult Danish Population. ANN INTERN MED
140: 330-337
[Abstract][Full Text]
Weitz, J. I., Middeldorp, S., Geerts, W., Heit, J. A.
(2004). Thrombophilia and New Anticoagulant Drugs. ASH Education Book
2004: 424-438
[Abstract][Full Text]
McBane, R. D. II
(2003). Genetically Determined Procoagulant States and Heparin Use. SEMIN CARDIOTHORAC VASC ANESTH
7: 427-442
[Abstract]
Guirguis, N. G., Eicher, C., Hock, L., Lynch, J., Graham, V. D., Rajagopalan, P. R., Guirguis, A., Lazarchick, J.
(2003). Thromboembolic Risk Factors in Patients Undergoing Kidney Transplant: Implication of Abnormally Short Activated Partial Thromboplastin Time. Annals of Clinical & Laboratory Science
33: 396-400
[Abstract][Full Text]
Duggan, C., Marriott, K., Edwards, R., Cuzick, J.
(2003). Inherited and Acquired Risk Factors for Venous Thromboembolic Disease Among Women Taking Tamoxifen to Prevent Breast Cancer. JCO
21: 3588-3593
[Abstract][Full Text]
Frazee, L. A, Chomo, D. L
(2003). Duration of Anticoagulant Therapy After Initial Idiopathic Venous Thromboembolism. The Annals of Pharmacotherapy
37: 1489-1496
[Abstract][Full Text]
Palareti, G., Legnani, C., Cosmi, B., Valdre, L., Lunghi, B., Bernardi, F., Coccheri, S.
(2003). Predictive Value of D-Dimer Test for Recurrent Venous Thromboembolism After Anticoagulation Withdrawal in Subjects With a Previous Idiopathic Event and in Carriers of Congenital Thrombophilia. Circulation
108: 313-318
[Abstract][Full Text]
Kearon, C.
(2003). Natural History of Venous Thromboembolism. Circulation
107: I-22-30
[Abstract][Full Text]
van Dongen, C. J. J., Vink, R., Hutten, B. A., Buller, H. R., Prins, M. H.
(2003). The Incidence of Recurrent Venous Thromboembolism After Treatment With Vitamin K Antagonists in Relation to Time Since First Event: A Meta-analysis. Arch Intern Med
163: 1285-1293
[Abstract][Full Text]
Prandoni, P., Bilora, F., Marchiori, A., Bernardi, E., Petrobelli, F., Lensing, A. W.A., Prins, M. H., Girolami, A.
(2003). An Association between Atherosclerosis and Venous Thrombosis. NEJM
348: 1435-1441
[Abstract][Full Text]
Ridker, P. M, Goldhaber, S. Z., Danielson, E., Rosenberg, Y., Eby, C. S., Deitcher, S. R., Cushman, M., Moll, S., Kessler, C. M., Elliott, C. G., Paulson, R., Wong, T., Bauer, K. A., Schwartz, B. A., Miletich, J. P., Bounameaux, H., Glynn, R. J., the PREVENT Investigators,
(2003). Long-Term, Low-Intensity Warfarin Therapy for the Prevention of Recurrent Venous Thromboembolism. NEJM
348: 1425-1434
[Abstract][Full Text]
Eckman, M. H., Erban, J. K., Singh, S. K., Kao, G. S.
(2003). Screening for the Risk for Bleeding or Thrombosis. ANN INTERN MED
138: W-15-W-24
[Abstract][Full Text]
Deitcher, S. R, Gomes, M. P.
(2003). Hypercoagulable state testing and malignancy screening following venous thromboembolic events. Vasc Med
8: 33-46
[Abstract]
Kelly, P.J., Furie, K.L., Kistler, J.P., Barron, M., Picard, E.H., Mandell, R., Shih, V.E.
(2003). Stroke in young patients with hyperhomocysteinemia due to cystathionine beta-synthase deficiency. Neurology
60: 275-279
[Abstract][Full Text]
Eichinger, S., Weltermann, A., Mannhalter, C., Minar, E., Bialonczyk, C., Hirschl, M., Schonauer, V., Lechner, K., Kyrle, P. A.
(2002). The Risk of Recurrent Venous Thromboembolism in Heterozygous Carriers of Factor V Leiden and a First Spontaneous Venous Thromboembolism. Arch Intern Med
162: 2357-2360
[Abstract][Full Text]
Ruberg, F. L, Loscalzo, J.
(2002). Prothrombotic determinants of coronary atherothrombosis. Vasc Med
7: 289-299
[Abstract]
Dalen, J. E.
(2002). Pulmonary Embolism: What Have We Learned Since Virchow?: Natural History, Pathophysiology, and Diagnosis. Chest
122: 1440-1456
[Full Text]
Keavney, B.
(2002). Genetic epidemiological studies of coronary heart disease. Int J Epidemiol
31: 730-736
[Full Text]
Juul, K., Tybjarg-Hansen, A., Steffensen, R., Kofoed, S., Jensen, G., Nordestgaard, B. G.
(2002). Factor V Leiden: The Copenhagen City Heart Study and 2 meta-analyses. Blood
100: 3-10
[Abstract][Full Text]
Joffe, H. V, Goldhaber, S. Z
(2002). Laboratory thrombophilias and venous thromboembolism. Vasc Med
7: 93-102
[Abstract]
Eckman, M. H., Singh, S. K., Erban, J. K., Kao, G.
(2002). Testing for Factor V Leiden in Patients with Pulmonary or Venous Thromboembolism: A Cost-Effectiveness Analysis. Med Decis Making
22: 108-124
[Abstract]
Nicolaes, G. A.F., Dahlback, B.
(2002). Factor V and Thrombotic Disease: Description of a Janus-Faced Protein. Arterioscler. Thromb. Vasc. Bio.
22: 530-538
[Abstract][Full Text]
Simioni, P., Tormene, D., Prandoni, P., Zerbinati, P., Gavasso, S., Cefalo, P., Girolami, A.
(2002). Incidence of venous thromboembolism in asymptomatic family members who are carriers of factor V Leiden: a prospective cohort study. Blood
99: 1938-1942
[Abstract][Full Text]
Bauer, K. A., Rosendaal, F. R., Heit, J. A.
(2002). Hypercoagulability: Too Many Tests, Too Much Conflicting Data. ASH Education Book
2002: 353-368
[Abstract][Full Text]
Dragoni, F., Tormene, D., Simioni, P., Arcieri, P., Avvisati, G., Girolami, A.
(2001). ProC Global: A New Automated Screening Assay for the Evaluation of Total Function of the Protein C System. CLIN APPL THROMB HEMOST
7: 351-355
[Abstract]
Bauer, K. A.
(2001). The Thrombophilias: Well-Defined Risk Factors with Uncertain Therapeutic Implications. ANN INTERN MED
135: 367-373
[Abstract][Full Text]
Mira, Y., Todoli, J., Alonso, R., Mico, M. L., Vaya, A., Ferrando, F., Estelles, A., Villa, P., Aznar, J.
(2001). Factor V Leiden and Prothrombin G20210A in Relation to Arterial and/or Vein Rethrombosis: Two Cases. CLIN APPL THROMB HEMOST
7: 234-237
[Abstract]
Marchetti, M., Quaglini, S., Barosi, G.
(2001). Cost-effectiveness of screening and extended anticoagulation for carriers of both factor V Leiden and prothrombin G20210A. QJM
94: 365-372
[Abstract][Full Text]
Federman, D. G., Kirsner, R. S.
(2001). An Update on Hypercoagulable Disorders. Arch Intern Med
161: 1051-1056
[Abstract][Full Text]
Nowak-Gottl, U., Junker, R., Kreuz, W., von Eckardstein, A., Kosch, A., Nohe, N., Schobess, R., Ehrenforth, S.
(2001). Risk of recurrent venous thrombosis in children with combined prothrombotic risk factors. Blood
97: 858-862
[Abstract][Full Text]
Deltenre, P, Denninger, M-H, Hillaire, S, Guillin, M-C, Casadevall, N, Briere, J, Erlinger, S, Valla, D-C
(2001). Factor V Leiden related Budd-Chiari syndrome. Gut
48: 264-268
[Abstract][Full Text]
Miles, J. S., Miletich, J. P., Goldhaber, S. Z., Hennekens, C. H., Ridker, P. M.
(2001). G20210A mutation in the prothrombin gene and the risk of recurrent venous thromboembolism. J Am Coll Cardiol
37: 215-218
[Abstract][Full Text]
Simioni, P., Prandoni, P., Lensing, A. W. A., Manfrin, D., Tormene, D., Gavasso, S., Girolami, B., Sardella, C., Prins, M., Girolami, A.
(2000). Risk for subsequent venous thromboembolic complications in carriers of the prothrombin or the factor V gene mutation with a first episode of deep-vein thrombosis. Blood
96: 3329-3333
[Abstract][Full Text]
Beyth, R. J
(2000). The recurrence rate of venous thromboembolism after a first or second episode of deep venous thrombosis was high. Evid. Based Med.
5: 188-188
[Full Text]
Girolami, A., Simioni, P., Girolami, B., Scarano, L.
(2000). State-of-the-Art Review : G to A 20210 Prothrombin Polymorphism and Venous Thrombosis: Simple Association or Causal Relationship?. CLIN APPL THROMB HEMOST
6: 135-138
Fears, R., Roberts, D., Poste, G.
(2000). Rational or rationed medicine? The promise of genetics for improved clinical practice. BMJ
320: 933-935
[Full Text]
Heit, J. A., Mohr, D. N., Silverstein, M. D., Petterson, T. M., O'Fallon, W. M., Melton III, L. J.
(2000). Predictors of Recurrence After Deep Vein Thrombosis and Pulmonary Embolism: A Population-Based Cohort Study. Arch Intern Med
160: 761-768
[Abstract][Full Text]
Baglin, T.
(2000). Thrombophilia testing: what do we think the tests mean and what should we do with the results?. J. Clin. Pathol.
53: 167-170
[Full Text]
Lane, D. A., Grant, P. J.
(2000). Role of hemostatic gene polymorphisms in venous and arterial thrombotic disease. Blood
95: 1517-1532
[Full Text]
Sartori, M. T., Simioni, P., Patrassi, G. M., Theodoridis, P., Tormene, D., Girolami, A.
(2000). State-of-the-Art-Review : Combined Heterozygous Plasminogen Deficiency and Factor V Leiden Defect in the Same Kindred. CLIN APPL THROMB HEMOST
6: 36-40
[Abstract]
Murphy, R. P., Donoghue, C., Nallen, R. J., D'Mello, M., Regan, C., Whitehead, A. S., Fitzgerald, D. J.
(2000). Prospective Evaluation of the Risk Conferred by Factor V Leiden and Thermolabile Methylenetetrahydrofolate Reductase Polymorphisms in Pregnancy. Arterioscler. Thromb. Vasc. Bio.
20: 266-270
[Abstract][Full Text]
De Stefano, V., Martinelli, I., Mannucci, P. M., Paciaroni, K., Chiusolo, P., Casorelli, I., Rossi, E., Leone, G.
(1999). The Risk of Recurrent Deep Venous Thrombosis among Heterozygous Carriers of Both Factor V Leiden and the G20210A Prothrombin Mutation. NEJM
341: 801-806
[Abstract][Full Text]
Rodeghiero, F., Tosetto, A.
(1999). Activated Protein C Resistance and Factor V Leiden Mutation Are Independent Risk Factors for Venous Thromboembolism. ANN INTERN MED
130: 643-650
[Abstract][Full Text]
Fraser, J. D., Anderson, D. R.
(1999). Deep Venous Thrombosis: Recent Advances and Optimal Investigation with US. Radiology
211: 9-24
[Full Text]
Schafer, A. I.
(1999). Venous Thrombosis as a Chronic Disease. NEJM
340: 955-956
[Full Text]
Ridker, P. M., Hennekens, C. H., Miletich, J. P.
(1999). G20210A Mutation in Prothrombin Gene and Risk of Myocardial Infarction, Stroke, and Venous Thrombosis in a Large Cohort of US Men. Circulation
99: 999-1004
[Abstract][Full Text]
Borrowman, T., Love, R., Mason, J. W.
(1999). Dilated Cardiomyopathy: Problems in Diagnosis and Management. Chest
115: 569-571
[Full Text]
Ludemann, P., Nabavi, D. G., Junker, R., Wolff, E., Papke, K., Buchner, H., Assmann, G., Ringelstein, E. B.
(1998). Factor V Leiden Mutation Is a Risk Factor for Cerebral Venous Thrombosis : A Case-Control Study of 55 Patients. Stroke
29: 2507-2510
[Abstract][Full Text]
MURIN, S., MARELICH, G. P., ARROLIGA, A. C., MATTHAY, R. A.
(1998). Hereditary Thrombophilia and Venous Thromboembolism. Am. J. Respir. Crit. Care Med.
158: 1369-1373
[Abstract][Full Text]
Cote, H. C.F., Lord, S. T., Pratt, K. P.
(1998). gamma -Chain Dysfibrinogenemias: Molecular Structure-Function Relationships of Naturally Occurring Mutations in the gamma Chain of Human Fibrinogen. Blood
92: 2195-2212
[Full Text]
Laffan, M.
(1998). Genetics and pulmonary medicine bullet 4: Pulmonary embolism. Thorax
53: 698-702
[Full Text]
Goldhaber, S. Z.
(1998). Pulmonary Embolism. NEJM
339: 93-104
[Full Text]
Prandoni, P., Lensing, A. W., Prins, M. R
(1998). Long-term outcomes after deep venous thrombosis of the lower extremities. Vasc Med
3: 57-60
[Abstract]
Ridker, P. M, PREVENT Investigators,
(1998). Long-term, low-dose warfarin among venous thrombosis patients with and without factor V Leiden mutation: rationale and design for the Prevention of Recurrent Venous Thromboembolism (PREVENT) trial. Vasc Med
3: 67-73
[Abstract]
Sarasin, F. P, Bounameaux, H.
(1998). Decision analysis model of prolonged oral anticoagulant treatment in factor V Leiden carriers with first episode of deep vein thrombosis. BMJ
316: 95-99
[Abstract][Full Text]
Hirsh, J., Kearon, C., Ginsberg, J.
(1997). Duration of Anticoagulant Therapy After First Episode of Venous Thrombosis in Patients With Inherited Thrombophilia. Arch Intern Med
157: 2174-2177
[Abstract]
Ridker, P. M., Miletich, J. P., Hennekens, C. H., Buring, J. E.
(1997). Ethnic Distribution of Factor V Leiden in 4047 Men and Women: Implications for Venous Thromboembolism Screening. JAMA
277: 1305-1307
[Abstract]
(1997). Factor V Leiden and Recurrent Thromboembolism. Journal Watch Cardiology
1997: 8-8
[Full Text]
Nicolaes, G. A.F., Dahlback, B.
(2002). Factor V and Thrombotic Disease: Description of a Janus-Faced Protein. Arterioscler. Thromb. Vasc. Bio.
22: 530-538
[Abstract][Full Text]