|
| |||||||||||||||||||||||||||||||||
Background Some patients with autosomal recessive limb-girdle muscular dystrophy have mutations in the genes coding for the sarcoglycan proteins (
Methods Antibody against
Results Levels of
Conclusions Defects in the genes coding for the sarcoglycan proteins are limited to patients with Duchenne-like and limb-girdle muscular dystrophy with normal dystrophin and occur in 11 percent of such patients.
-,
-,
-, and
-sarcoglycan). To determine the frequency of sarcoglycan-gene mutations and the relation between the clinical features and genotype, we studied several hundred patients with myopathy.
-sarcoglycan was used to stain muscle-biopsy specimens from 556 patients with myopathy and normal dystrophin genes (the gene frequently deleted in X-linked muscular dystrophy). Patients whose biopsy specimens showed a deficiency of
-sarcoglycan on immunostaining were studied for mutations of the
-,
-, and
-sarcoglycan genes with reverse transcription of muscle RNA, analysis involving single-strand conformation polymorphisms, and sequencing.
-sarcoglycan were found to be decreased on immunostaining of muscle-biopsy specimens from 54 of the 556 patients (10 percent); in 25 of these patients no
-sarcoglycan was detected. Screening for sarcoglycan-gene mutations in 50 of the 54 patients revealed mutations in 29 patients (58 percent): 17 (34 percent) had mutations in the
-sarcoglycan gene, 8 (16 percent) in the
-sarcoglycan gene, and 4 (8 percent) in the
-sarcoglycan gene. No mutations were found in 21 patients (42 percent). The prevalence of sarcoglycan-gene mutations was highest among patients with severe (Duchenne-like) muscular dystrophy that began in childhood (18 of 83 patients, or 22 percent); the prevalence among patients with proximal (limb-girdle) muscular dystrophy with a later onset was 6 percent (11 of 180 patients).
|
In addition to dystrophin, other proteins, often referred to as dystrophin-associated proteins, contribute to the membrane cytoskeleton of myofibers. These proteins are divided into the dystroglycan, sarcoglycan, and syntrophin subcomplexes (Figure 1). 3,6 Recently, genetic defects of the sarcoglycan complex (sarcoglycanopathies) were found in some patients with autosomal recessive muscular dystrophy.7,8,9,10,11,12,13,14,15,16,17,18,19,20 The genes and proteins corresponding to these genetic defects are
-sarcoglycan,7
-sarcoglycan,9,10
-sarcoglycan,8 and
-sarcoglycan.20 Each of these sarcoglycans is a relatively small transmembrane protein expressed either only (
,
, and
) or predominantly (
) in striated muscle (skeletal and cardiac).7,8,9,10,20,21,22,23 No patients with primary defects of the other dystrophin-associated proteins (dystroglycans and syntrophins) have been identified; however, the expression of these proteins is not limited to striated muscle.24,25
Studies with antibodies directed against
-,
-,
-, and
-sarcoglycan have revealed deficiencies of all components of the sarcoglycan complex in muscle-biopsy specimens from patients with mutations in any of the sarcoglycan genes.8,9,10,17,20 Apparently, mutations in a single sarcoglycan gene lead to destabilization of the entire complex and secondary deficiency of the other sarcoglycan proteins. Thus, a genetic defect of any component of the protein complex should be detectable with antibody against any of the sarcoglycan proteins.26 Because biopsy specimens from patients with dystrophin-gene abnormalities reveal secondary deficiencies of the sarcoglycans,27,28 testing for sarcoglycan proteins is informative only if dystrophin is normal. Thus, testing of biopsy specimens from patients with normal dystrophin with antibody directed against
-sarcoglycan should identify most or all patients with mutations of the
-,
-,
-, and
-sarcoglycan genes. We used both biochemical and molecular approaches to screen for abnormalities and genetic defects in the sarcoglycan proteins in patients with myopathy.
Methods
Selection of Patients
We selected muscle-biopsy specimens for
-sarcoglycan immunostaining from patients with myopathy whose records and biopsy specimens were available at the University of Padua (322 patients) and University of Pittsburgh (234 patients) and who had normal dystrophin on the basis of immunofluorescence or immunoblot analysis and histopathological evidence of myopathy. The Italian patients were from northeastern Italy and were examined in Padua by a single team. The patients whose biopsy specimens were studied in Pittsburgh were examined in neuromuscular clinics throughout the United States with a standard clinical-assessment protocol (manual muscle testing and muscle biopsy). The Italian patients (or their parents) provided written informed consent. The studies done in Pittsburgh were approved by the institutional review board, but did not require informed consent because the biopsy specimens were "preexisting pathological specimens" obtained for diagnostic purposes (to rule out a dystrophin abnormality).
The patients were divided into three groups on the basis of a clinical examination (Padua) or clinical summaries (Pittsburgh): those with congenital muscular dystrophy, those with a dystrophinopathy-like disorder, and those with other neuromuscular disorders (Table 1). Congenital muscular dystrophy was defined as the presence of weakness or hypotonia at birth, contractures before six months of age, and dystrophy on muscle biopsy. This category included patients with and those without central nervous system involvement. A dystrophinopathy-like disorder was defined on the basis of the presence of progressive proximal muscle weakness beginning after six months of age, high serum creatine kinase concentrations, and dystrophy on muscle biopsy. Other neuromuscular disorders were defined on the basis of findings of muscle weakness or wasting, hypotonia, calf hypertrophy, or high serum creatine kinase concentrations and included the following diagnoses: inflammatory myopathy (9 patients), metabolic myopathy (9), congenital structural myopathy (10), myoglobinuria (14), distal myopathy (2), congenital hypotonia (2), familial myopathy with high serum creatine kinase concentrations (5), isolated high serum creatine kinase concentrations (23), isolated myopathy with high serum creatine kinase concentrations or cramps (40), and other muscular dystrophies (78). An additional 32 patients from the Pittsburgh referral center had inadequate clinical information for precise classification of the neuromuscular disorder. All the patients in the group with other neuromuscular disorders had normal results of
-sarcoglycan immunostaining.
|
Biochemical Analysis
Frozen sections (4 to 6 µm) of muscle obtained by biopsy were stained with
-sarcoglycan antibody (NCL-50DAG, Novocastra Laboratories, Newcastle, United Kingdom) as previously described.15 The sections were scored as being completely or partially deficient in
-sarcoglycan relative to results in muscle tissue obtained and processed in parallel from subjects with no histologic evidence of muscle disease, as previously described.15 The identification of partial deficiencies of
-sarcoglycan was subjective, but interobserver reliability was increased by the use of only two observers for all biopsy specimens (one each in Padua and Pittsburgh), who were unaware of the clinical diagnosis.
Molecular Analyses
RNA Extraction and Reverse Transcription
Total RNA was isolated from the muscle-biopsy specimens of patients with decreased or no
-sarcoglycan staining and reverse transcribed as previously described.15
Polymerase Chain Reaction
Overlapping polymerase-chain-reaction (PCR) products for the complete coding sequences of complementary DNA for the
-,
-, and
-sarcoglycan genes were generated. The
-sarcoglycan PCR products, primers, and conditions have been described previously.14,15 The
-sarcoglycan PCR products were generated with two primer pairs in addition to those previously described9: primer pairs 5 (nucleotides -40 to 267; 5'ACAGTCGGGCGGGGAGCT3' and 5'CACGGCCCAAATAACAAGTG3') and 6 (nucleotides 773 to 982; 5'ATGGATCTGTATGGTCAGC3' and 5'CATGTTGGTGACCTCTGGG3'), designed on the basis of the
-sarcoglycan messenger RNA sequence9 with use of the Primer program (Daly MJ, et al.: unpublished data). PCR conditions were as described previously,9,15 except that an annealing temperature of 60°C and 5 percent dimethylsulfoxide were used for primer pair 5. The
-sarcoglycan PCR products, primers, and conditions have been described previously.8,17
Analysis Involving Single-Strand Conformation Polymorphisms
Radiolabeled PCR product was mixed with an equal volume of stop solution, and the samples were denatured and analyzed with three single-strand conformation polymorphism (SSCP) gels as described previously.15,29
DNA Sequencing
Bands showing an electrophoretic shift in mobility on the basis of SSCP analysis were directly sequenced with the original PCR primers and the prism Ready Reaction Dyedeoxy Terminator Cycle Sequencing Kit (Applied Biosystems, Foster City, Calif.) according to the manufacturer's recommendations.15
Confirmation of Nucleotide Changes
Nucleotide changes and an autosomal recessive pattern of inheritance were confirmed in the genomic DNA of the patients and their parents with exon-specific PCR primers.18,19 When the identified sequence variant destroyed or created a restriction-enzyme site, the appropriate PCR product was digested with a specific restriction endonuclease. When the identified sequence variant did not change a restriction-enzyme site, amplification-refractory mutation tests were designed.30 Insertions, duplications, and deletions were analyzed by size fractionation with denaturing polyacrylamide-gel electrophoresis.
DNA Analysis
Genomic DNA was isolated from peripheral-blood lymphocytes of the patients and their parents or the patients' muscle-biopsy specimens as described previously.31,32 Approximately 100 ng of DNA was used for PCR amplification.
Results
Muscle-biopsy specimens from 556 patients with myopathy and normal dystrophin were available for immunostaining for
-sarcoglycan (Figure 2A and Figure 2B). The clinical classifications of these patients and the staining results are shown in Table 1. Deficiency of
-sarcoglycan was evident in biopsy specimens from 54 patients (10 percent). The deficiency was complete in 25 patients (4.5 percent) and partial in 29 patients (5.2 percent). Fifty-two of the 54 patients with
-sarcoglycan deficiency had clinical manifestations of either Duchenne-like or limb-girdle muscular dystrophy (a dystrophinopathy-like disorder). Two of the 69 patients with congenital muscular dystrophy had a partial deficiency of
-sarcoglycan. The prevalence of
-sarcoglycan deficiency in the three groups of patients was similar in the Italian and American patients.
|
-sarcoglycan immunostaining and screened for mutations in the
-,
-, and
-sarcoglycan genes. Mutations were detected in 29 (58 percent) of the patients (Table 1, Table 2 and Table 3): 18 of 29 patients with Duchenne-like muscular dystrophy (62 percent) and 11 of 19 patients with limb-girdle muscular dystrophy (58 percent). The homozygous or compound heterozygous status of the 25 patients who had mutations of both sarcoglycan-gene alleles was confirmed by tests on genomic DNA from all the patients and, when available, both their parents (17 of 25 patients); in each case their parents were heterozygous for one of the two identified mutant alleles. In four patients (Patients 6, 18, 39, and 40), only one mutant allele was identified. In Patient 6, only mutant RNA (T371C) was present in the muscle-biopsy specimen, whereas analysis of genomic DNA revealed the patient to be heterozygous (one wild-type and one mutant allele) at this nucleotide position. This patient probably had a second undetected mutation that prevented the expression of the wild-type allele, allowing only the mutant allele to be detected in the RNA of the muscle. Because all patients with a primary sarcoglycanopathy are assumed to have an autosomal recessive pattern of inheritance with two mutant alleles, Patients 18, 39, and 40 were presumed to have a second, unidentified mutation. One hundred normal chromosomes were examined for all novel mutations, and all tested negative. Thus, among the 50 patients with a deficiency of
-sarcoglycan on immunostaining, mutations in the
-sarcoglycan gene were detected in 17 (34 percent), mutations in the
-sarcoglycan gene were detected in 8 (16 percent), and mutations in the
-sarcoglycan gene were detected in 4 (8 percent).
|
|
-sarcoglycan gene was 6±4 years; it was 3±2 and 6±4 years, respectively, in the patients with mutations in the
-sarcoglycan and
-sarcoglycan genes. All patients presented with clinical findings that included calf hypertrophy, Gowers' sign, and a deficit in motor skills. The mean serum creatine kinase concentrations in the patients with mutations in the
-sarcoglycan,
-sarcoglycan, and
-sarcoglycan genes were 13,732±6196, 15,226±12,528, and 16,900±8224 IU per liter, respectively (normal, <200). Discussion
Mutations of any component of the sarcoglycan complex result in the secondary loss of the other components of the complex. Thus, we hypothesized that we could identify patients who were likely to have mutations in the
-,
-, or
-sarcoglycan gene by immunostaining for
-sarcoglycan. Among the 556 patients with normal dystrophin whom we studied, 54 had a deficiency of
-sarcoglycan on immunostaining. Molecular studies were performed in 50 of these 54 patients and revealed that 58 percent had mutations of the
-,
-, or
-sarcoglycan gene. It is therefore clear that a mutation in these genes does not account for all cases of
-sarcoglycan deficiency, even after adjustment for the secondary deficiency of the sarcoglycan complex in Duchenne's and Becker's muscular dystrophies.
Some patients with primary sarcoglycan deficiency (that involving a mutation) might have been missed by our use of
-sarcoglycan immunostaining as the initial screening test. However, the available data suggest that we should have identified most if not all patients with sarcoglycan-gene mutations using this approach.8,9,10 Previous studies have identified two unrelated families with mutations in the
-sarcoglycan gene and four unrelated families with mutations in the
-sarcoglycan gene; all patients had
-sarcoglycan deficiency in muscle, even though this deficiency was not a criterion for the identification of the study patients. Moreover, the patients with mutations in the
- or
-sarcoglycan gene in this study all had marked reductions in the levels of these proteins on immunostaining (data not shown).
We may not have detected all sarcoglycan mutations in the biopsy specimens tested, but we think that this possibility is unlikely. In autosomal recessive disorders there are mutations in both alleles of the particular gene, and if the mutation-detection strategy lacks sensitivity, then only one mutation will be detected in some patients (they will appear to be heterozygous). We found only 4 of 29 patients to be heterozygous in this study, suggesting that the sensitivity of our mutation analysis was approximately 93 percent (54 of 58 possible mutant alleles detected) and that our ability to identify patients with at least one mutant allele exceeded 99 percent.
The large number of patients studied allowed us to estimate the frequencies of sarcoglycan-gene mutations in patients with myopathies and normal dystrophin (Table 1). We found a deficiency of
-sarcoglycan protein in 10 percent of patients with normal dystrophin. If we include only patients with Duchenne-like or limb-girdle muscular dystrophy in the analysis, this figure rises to 20 percent. In the patients with
-sarcoglycan deficiency on immunostaining, a complete deficiency (absence of staining) was more specific for mutations in the
-sarcoglycan gene than for mutations in the
- or
-sarcoglycan gene (Table 2). On the other hand, a partial deficiency of
-sarcoglycan on immunostaining was not specific for mutations of any one of the three genes, and the majority (61 percent) of patients with a partial deficiency had no mutations.
We, like others, found that patients with a primary sarcoglycanopathy are clinically indistinguishable from those with either Duchenne's or Becker's muscular dystrophy.7,8,9,10,11,12,13,14,15,16,17 Cognitive function was normal in all patients with sarcoglycan-gene mutations. Although sarcoglycans are normally present in both skeletal and cardiac muscle, there were no electrocardiographic or echocardiographic abnormalities in the seven patients tested. There were differences in the clinical severity, in that all patients with mutations in the
-sarcoglycan gene had severe dystrophy, whereas half those with mutations in the
- or
-sarcoglycan gene had milder disease.
Many genes are known to cause muscular dystrophy, including the genes for dystrophin (Duchenne's or Becker's muscular dystrophy), calpain III (limb-girdle muscular dystrophy type 2A), merosin (congenital muscular dystrophy with merosin deficiency), and
-,
-,
-, and
-sarcoglycan (limb-girdle muscular dystrophy types 2D, 2E, 2C, and 2F, respectively). Molecular genetic analyses can now identify the disease-causing mutations in all these genes.
The muscular dystrophies characterized by progressive muscle weakness of the pelvic and shoulder girdle (Duchenne's, Becker's, and limb-girdle muscular dystrophies) are a clinically and genetically heterogeneous group of diseases. The elucidation of the genetic defect leading to the dystrophy has implications for the diagnosis and care of affected patients (and their families). Because defects in several genes can cause phenotypically similar clinical and biochemical manifestations, a definitive diagnosis can only be made by testing of candidate genes or proteins.
Supported by grants from the National Institutes of Health (NS-28403 [to Dr. Hoffman]), the Muscular Dystrophy Association (to Dr. Hoffman), and TelethonItaly (695 [to Ms. Fanin] and 552 [to Dr. Angelini]). Dr. Hoffman is an Established Investigator of the American Heart Association.
Source Information
From the Departments of Human Genetics, Molecular Genetics and Biochemistry, Pediatrics, and Neurology, University of Pittsburgh, Pittsburgh (D.J.D., J.R.G., E.P.H.); and the Regional Neuromuscular Center, Department of Neurology, University of Padua, Padua, Italy (M.F., C.A.).
Address reprint requests to Dr. Hoffman at Biomedical Science Tower W1211, Department of Molecular Genetics and Biochemistry, University of Pittsburgh School of Medicine, Pittsburgh, PA 15261.
References
-D-glucoside. Eur J Biochem 1994;222:1055-1061. [Medline]
-sarcoglycan in chromosome 13 muscular dystrophy. Science 1995;270:819-822.
-Sarcoglycan (A3b) mutations cause autosomal recessive muscular dystrophy with loss of the sarcoglycan complex. Nat Genet 1995;11:266-273. [CrossRef][Medline]
-Sarcoglycan: characterization and role in limb-girdle muscular dystrophy linked to 4q12. Nat Genet 1995;11:257-265. [CrossRef][Medline]
-Sarcoglycan (adhalin) deficiency: complete deficiency patients are 5% of childhood-onset dystrophin-normal muscular dystrophy and most partial deficiency patients do not have gene mutations. J Neurol Sci 1996;140:30-39. [CrossRef][Medline]
-sarcoglycan (adhalin) gene. Basic Appl Myol 1996;6:95-100.
-sarcoglycan cause muscular dystrophy. Hum Mol Genet 1996;5:1841-1847.
-sarcoglycan gene mutation. Am J Hum Genet 1996;59:1040-1047. [Medline]
-sarcoglycan gene mutations: missense mutations may cause severe limb-girdle muscular dystrophy type 2E (LGMD 2E). Hum Mol Genet 1996;5:1953-1961.
| |||||||||||||||||||||||||||||||||
This article has been cited by other articles:
HOME | SUBSCRIBE | SEARCH | CURRENT ISSUE | PAST ISSUES | COLLECTIONS | PRIVACY | TERMS OF USE | HELP | beta.nejm.org Comments and questions? Please contact us. The New England Journal of Medicine is owned, published, and copyrighted © 2009 Massachusetts Medical Society. All rights reserved. |