Mutation of RFXAP, a Regulator of MHC Class II Genes, in Primary MHC Class II Deficiency
Jean Villard, M.D., Barbara Lisowska-Grospierre, M.D., Peter van den Elsen, Ph.D., Alain Fischer, M.D., Ph.D., Walter Reith, Ph.D., and Bernard Mach, M.D., Ph.D.
Background Major-histocompatibility-complex (MHC) class II deficiencyis an autosomal recessive primary immunodeficiency disease inwhich MHC class II molecules are absent. It is a geneticallyheterogeneous disease of gene regulation resulting from defectsin several transactivating genes that regulate the expressionof MHC class II genes. The mutations responsible for MHC classII deficiency are classified according to complementation group(a group in which the phenotype remains uncorrected in pairwisefusions of cells). There are three known complementation groups(A, B, and C).
Methods To elucidate the genetic defect in patients with MHCclass II deficiency that was not classified genetically, weperformed direct complementation assays with the three genesknown to regulate the expression of MHC class II genes, CIITA,RFX5, and RFXAP, and the relevant mutations were identifiedin each patient.
Results Mutations in the RFXAP gene were found in three patientsfrom unrelated families, and the resulting defect was classifiedas belonging to a novel complementation group (D). Transfectionwith the wild-type RFXAP gene restored the expression of MHCclass II molecules in the patients' cells.
Conclusions Mutations in a novel MHC class II transactivatingfactor, RFXAP, can cause MHC class II deficiency. These mutationsabolish the expression of MHC class II genes and lead to thesame clinical picture of immunodeficiency as in patients withmutations in the other two MHC class II regulatory genes.
Major-histocompatibility-complex (MHC) class II deficiency,also referred to as the bare lymphocyte syndrome, is a rareautosomal recessive immunodeficiency disease in which a lackof all MHC class II molecules results in the inability to generateT-celldependent cellular and humoral immune responses.1,2,3Affected patients are extremely susceptible to viral, bacterial,and fungal infections, which usually involve the respiratoryand gastrointestinal tracts. Symptoms begin in the first yearof life.2,3
The clinical manifestations of the disease result from the lackof MHC class II molecules, but the primary genetic defect doesnot involve the MHC class II genes themselves or their promoters.Instead, the affected genes encode transactivating factors thatregulate the expression of MHC class II genes. The demonstrationthat the disease does not segregate with the MHC class II locusestablished MHC class II deficiency as a disease of gene regulation.4,5Although clinically homogeneous, primary MHC class II deficiencyis genetically heterogeneous. This was shown by cell-fusionexperiments that identified three distinct complementation groups(i.e., groups in which the phenotype remains uncorrected inpairwise fusions of cells). These groups were named A, B, andC.6,7,8 Mutant cells lacking MHC class II molecules have beenproduced in vitro, and they can also be classified accordingto complementation groups. One such mutant cell line (6.1.6)belongs to a fourth complementation group (D), which differsfrom the groups found thus far in MHC class II deficiency.6,7,8
MHC class II molecules present antigens to T lymphocytes andare essential for the activation of T cells. The expressionof MHC class II genes is under very tight and complex regulation.Epithelial cells in the thymus, dendritic cells, and B lymphocytesconstitutively express MHC class II genes. In many other typesof cells, the expression of these genes can be induced by certainstimuli, especially interferon-.9 In all these situations, theexpression of MHC class II genes is controlled and directedby the MHC class II transactivator CIITA.10,11
Studies of cell lines derived from patients with MHC class IIdeficiency and mutant cell lines have identified three key regulatoryfactors: CIITA, RFX5, and RFXAP.10,11,12,13,14 CIITA is defectivein complementation group A. The molecular defect in groups B,C, and D is a deficiency of regulatory factor X (RFX), a multimericprotein complex that binds to promoters of MHC class II genes.5One subunit of the RFX complex, RFX5, is mutated in complementationgroup C.12 The mutant cell line 6.1.6 (complementation groupD) has a mutation in RFXAP, a 36-kd subunit of the RFX complex.13The identification of these regulatory genes has allowed usto study several patients with MHC class II deficiency whosegenetic defect had not been previously classified or was thoughtto belong to complementation groups distinct from A, B, andC.8,15 Our results show that in all the patients with bona fideMHC class II deficiency that we have studied, the mutationsresponsible belong to one of the four known complementationgroups A, B, C, or D.
Methods
Patients and Cell Lines
The ABI fibroblast cell line was derived from a Turkish patient(Patient 1).15 The ZM fibroblast and B-cell lines were derivedfrom a Moroccan patient (Patient 2) (Fondanèche MC, etal.: unpublished data). The DA cell line was derived from anAlgerian patient (Patient 3).16,17 Cells were cultured, transfected,selected with hygromicin, and analyzed by flow cytometry (ABIand DA cells) or immunofluorescence (ZM cells) as describedpreviously.10,11,12,13 Transfected ABI and HeLa cells were stimulatedwith recombinant interferon- (GIBCO) for 72 hours. TransfectedZM fibroblasts were treated with interferon- for 48 hours.
Preparatory Measures and Assays
The plasmids used to transfect the ABI and ZM fibroblast-celllines were pREP4 (Invitrogen) and pREP4RFXAP. The RFXAPcomplementary DNA (cDNA)13 was cloned between the BamHI andHindIII site of pREP4. For DA cells, the plasmids used for transfectionwere pCD10 and pCDRFXAP.13 The 32P-labeled riboprobeused to detect RFX5 messenger RNA (mRNA) was transcribed withT7 RNA polymerase from a Bluescript plasmid (Stratagene) containinga 372-bp fragment of RFX5 (nucleotides 739 to 1110). The 32P-labeledriboprobes used to detect mRNA of CI ITA, HLA-DRA, and guanylate-bindingprotein have been described previously.10,18,19
Preparation of whole-cell extracts,20 procedures for electrophoreticmobility shift assays,12,21 binding conditions for RFX, nuclearfactor Y (NF-Y),22 and the double-stranded oligonucleotides(WX2 and Y) used as probes23,24 have been described previously.Binding reactions were carried out with 10 µg of whole-cellextract. For ABI cells, decreasing amounts of nonspecific competitorDNA were used.
Rnase Protection Experiments
Cytoplasmic RNA was extracted from 5 million cells as describedpreviously.25 To generate the probes, the plasmids were linearizedand transcribed in the presence of [32P]uridine triphosphatewith T7 RNA polymerase in the case of RFX5, CIITA, and guanylate-bindingprotein; T3 RNA polymerase in the case of TATA-binding protein;or SP6 RNA polymerase in the case of HLA-DRA. The specific activityof the HLA-DRA probe was 30 times less than that of the otherprobes. For each sample, 30 µg of cytoplasmic RNA wasanalyzed as described previously.11
Amplification and Sequencing
Full-length RFXAP cDNA clones were isolated by a reverse-transcriptionpolymerase-chain-reaction(PCR) assay and analyzed for mutations as described previously.13The RFXAP gene was also examined for mutations by direct sequencingof PCR-amplified fragments derived from genomic DNA. The followingprimers were used: RFXAPC5 (5'ATggaggcgcagggtgtag3'), whichis situated at the translation-initiation codon (nucleotides116 to 133 of RFXAP cDNA), and RFX5APDA2 (5'TGCAGGTCTTGCTCATGCTG3'),which is situated between nucleotides 521 and 540 of RFXAP cDNA.PCR was performed with the Expand high-fidelity PCR system (BoehringerMannheim). Sequencing was performed directly with the AppliedBiosystems PRISM dye terminator cycle-sequencing kit and anApplied Biosystems DNA sequencer.
Results
Defect in the Binding of RFX to MHC Class II Promoters in Patient 1
A fibroblast cell line (ABI) from Patient 1, with an unidentifiedgenetic defect,15 was studied for the expression of mRNA forthe MHC class II gene HLA-DRA and the transactivators CIITAand RFX5. Figure 1A shows that the level of RFX5 mRNA was normalin the ABI cell line, and that interferon- induced similar degreesof expression of CIITA mRNA in ABI and control cells. By contrast,interferon- induced the expression of HLA-DRA mRNA in controlcells but not in ABI cells. Thus, in Patient 1 the moleculardefect does not affect RFX5 mRNA or the inducibility of CIITAmRNA by interferon-.
Figure 1. Analysis of the Expression of CIITA and RFX in Patient 1.
The induction of CIITA is normal in Patient 1, as shown in Panel A. RNase protection experiments were performed with total RNA extracted from the HeLa cell line, in which the induction of CIITA is normal, and the ABI cell line from Patient 1. Each lane 1 shows probes for CIITA and guanylate-binding protein (GBP) mRNA. The GBP probe was used as a positive control for induction by interferon-. Each lane 2 shows probes for RFX5 and HLA-DRA mRNA. The exposure time for GBP differed from that for the other probes (24 hours vs. 48 hours). In Panel B, there is no binding of the RFX complex in cells from Patient 1 (ABI). In lanes 1 through 7, extracts from ABI cells; a normal B-cell line (Raji), which is positive for MHC class II molecules; and the HeLa cell line were analyzed by an electrophoretic mobility shift assay with an X-box oligonucleotide (WX2) as a probe. Binding reactions with the ABI extract were done with decreasing amounts of nonspecific competitor DNA (concentrations in lanes 4, 5, 6, and 7, respectively: 1.0, 0.8, 0.7, and 0.5 µg of poly[dIdC].poly[dIdC] per reaction, and 0.5, 0.4, 0.35, and 0.25 µg of single-stranded Escherichia coli DNA per reaction). In lanes 8 and 9, binding of nuclear factor Y (NF-Y) to a Y-box oligonucleotide was analyzed in the two extracts.
Patients with MHC class II deficiency of complementation groupsB and C (as well as the mutant cell line 6.1.6, classified ingroup D) all have a defect that impairs the binding of RFX tothe X box of MHC class II promoters.5 The X box is a cis-actingDNA sequence characteristic of MHC class II promoters. We thereforeused electrophoretic mobility shift assays to test cell extracts,which normally contain the RFX protein, for binding to an oligonucleotidecontaining the DNA sequence of the X box (Figure 1B). Extractsfrom control HeLa and Raji cells bound RFX normally, whereasno binding to the X-box oligonucleotide was detected with extractsfrom ABI cells. In contrast, the NF-Y was detected in the extractsof both ABI and control cells. Patient 1 thus had the same specificdefect in RFX binding that has been reported in complementationgroups B, C, and D.
Effect of Transfection with the RFXAP Gene on the Expression of MHC Class II Molecules in the ABI Cell Line
In view of the defect in RFX binding in ABI cells, we investigatedwhether transfection with cDNA encoding the two subunits ofRFX (RFX5 and RFXAP) would allow interferon- to induce the expressionof MHC class II genes in ABI cells. The cDNA encoding RFX5,the gene affected in complementation group C, had no effect(data not shown), whereas transfection with the cDNA of RFXAPenabled interferon- to induce the expression of the HLA-DR genein ABI cells (Figure 2A). The wild-type RFXAP gene can thuscorrect the defect in the expression of MHC class II in cellsfrom Patient 1.
Figure 2. Complementation of HeLa Cells and Cells from Patient 1 (ABI) by RFXAP.
In Panel A, ABI cells from Patient 1 were transfected with pREP4, an expression vector, and the expression of MHC class II molecules was induced with 5000 U of interferon- per milliliter (upper left-hand corner), or ABI cells were transfected with pREP4RFXAP and expression was induced with either 1000 U of interferon- per milliliter (lower left-hand corner) or 5000 U of interferon- per milliliter (lower right-hand corner). Expression of MHC class II molecules by control HeLa cells was induced with 1000 U of interferon- per milliliter (upper right-hand corner). Cells were stained for HLA-DR and analyzed by flow cytometry (FACScan). The open profiles are those of uninduced cells and the solid profiles those of cells treated with interferon-. Panel B shows the RFXAP protein. The position of regions rich in acidic amino acids (39 percent aspartic acid and glutamic acid; DE), basic amino acids (54 percent arginine and lysine; RK), and glutamine (52 percent; Q) are indicated. Both cDNA clones and PCR-amplified genomic DNA from Patient 1 contained a point mutation at nucleotide 279 (asterisk) that leads to a premature stop codon (TAG).
The RFXAP Gene in Patient 1
To characterize the RFXAP gene in Patient 1, the entire codingregion of RFXAP mRNA from ABI cells was amplified by PCR, subcloned,and sequenced. All the cDNA clones that we isolated containeda point mutation at nucleotide 279 that converts a glutaminecodon to a premature stop codon (from CAG to TAG). This mutationwould lead to a severely truncated protein of only 52 aminoacids. Direct sequencing of a genomic PCR fragment demonstratedthat Patient 1 is homozygous for the mutated allele (Figure 2B).In this patient the defect is therefore in the same regulatorygene as the defect in the mutant cell line 6.1.6, and thus belongsto complementation group D.
Additional Defects in the Regulatory Gene RFXAP
A cell line (ZM) from Patient 2 was studied in the same wayas the ABI cell line. The expression of MHC class II genes wasfully corrected by transfection of ZM cells with the cDNA ofRFXAP (Figure 3A), indicating that the defect in Patient 2 alsobelongs to complementation group D. A cell line (DA) from another,unrelated patient with MHC class II deficiency (Patient 3) wasalso fully corrected by transfection with the cDNA of the RFXAPgene.13
Figure 3.RFXAP Defects Identified in Patients 2 and 3.
In Panel A, the expression of HLA-DR on the surface of cells from Patient 2 transfected with pREP4 or pREP4RFXAP was analyzed by immunofluorescence after the addition of 200 U of interferon- per milliliter. Transfection with pREP4RFXAP restored the expression of HLA-DR on fibroblasts from Patient 2 (top), but transfection with pREP4 did not (bottom). Panel B shows the RFXAP protein, with regions rich in acidic amino acids (39 percent aspartic acid and glutamic acid; DE), basic amino acids (54 percent arginine and lysine; RK), and glutamine (52 percent; Q). Both cDNA and PCR-amplified genomic DNA from Patients 2 and 313 had a deletion of a G (asterisk) at nucleotide 484.
The entire coding region of RFXAP mRNA from the ZM cell linewas amplified by PCR, subcloned, and sequenced. All the cDNAclones that were isolated had a deletion of a G residue at nucleotide484. The resulting frame shift leads to an out-of-frame stopcodon at nucleotide 525 and would thus give rise to a severelytruncated and inactive RFXAP protein of only 136 amino acids(Figure 3B). This mutation is identical to that observed inPatient 3.13 Direct sequencing (in the case of Patient 2) andoligotyping (in the case of Patient 3) of genomic PCR fragmentsspanning the mutation have shown that the two patients are homozygousfor the mutated allele of RFXAP.
Discussion
MHC class II deficiency is a disease of gene regulation involvingregulatory factors that are essential for the expression ofMHC class II genes. CIITA, the gene affected in complementationgroup A (Figure 4), encodes a transactivator that does not bindto DNA and serves as a general controller of both the constitutiveand inducible expression of MHC class II genes.5,10,11 The expressionof CIITA is very tightly controlled by several alternative promoters.14Mutations in the gene encoding RFX5, a subunit of the ubiquitousRFX complex, cause the defect in complementation group C (Figure 4).12,26 Recently, a second subunit of the RFX complex, RFXAP,has been cloned.13 We found that mutations in the RFXAP genedefine a novel complementation group group D (Figure 4).The genes affected in groups A (CIITA) and C (RFX5) havebeen mapped to chromosomes 16 and 1, respectively.5,26 Usinga novel high-resolution mapping method,27 we have mapped RFXAP(group D) to chromosome 13 (Table 1). The defect in complementationgroup B entails the same lack of binding of the RFX proteinto the X box of the promoters of MHC class II genes as in groupsC and D. We have recently identified a third protein subunitwithin RFX, which might be affected in complementation groupB.
Figure 4. The MHC Class II Promoter and the Transcription Factors Affected in Complementation Groups A, C, and D.
CIITA is mutated in complementation group A.10 Mutations in CIITA do not affect binding of transcription factors to the promoter in vivo. CIITA presumably controls transcription by contacting promoter-bound transcription factors, but its mechanism of action is unknown. RFX5 and RFXAP are two subunits of the RFX complex and are mutated in complementation groups C12 and D,13 respectively. A third subunit of the RFX complex is shown. X2BP and nuclear factor Y (NF-Y) are proteins that bind to the X2 and Y boxes and interact with the RFX protein complex.21,24 The S box is a less well characterized binding site. A deficiency of any of the components of the RFX complex does not allow transcription of class II MHC genes. Plus and minus signs indicate transcriptional activity.
Table 1. Genetic Defects in Patients with MHC Class II Deficiency, According to Complementation Group.
Mutations in RFXAP account for the lack of expression of MHCclass II molecules in complementation group D, and all the patientsthat we studied were homozygous for a mutation in this gene(Figure 2A, Figure 2B, Figure 3A, and Figure 3B). Patients 2and 3 have the same defect but are from different families,originating from Algeria and Morocco, respectively. An identicalmutation, in a homozygous state, in such a rare genetic disease,suggests both consanguinity and common ancestry.
Patient 2 is of special interest because his genetic defecthas been shown by cell-fusion experiments to be related to thedefect in five other patients from three unrelated families(Fondanèche MC, et al.: unpublished data). Thus, at leasteight patients from six unrelated families have a defect inthe RFXAP gene and thus belong to complementation group D (Table 1).This complementation group is the largest after group B.It also appears that the four complementation groups accountfor all currently known types of true MHC class II deficiency(Table 1). A family with an almost asymptomatic form of immunodeficiencyand with only selective defects in the expression of certainHLA class II genes has been described,28,29 but this atypicalphenotype probably represents a distinct syndrome.
The clinical manifestations and immunologic abnormalities inMHC class II deficiency are similar in all four complementationgroups,2,3,5 probably because the distinct regulatory factorsinvolved in this disease, although having very different structuresand functions, are all essential for the control of the expressionof MHC class II genes. Interestingly, the three regulatory genesaffected in MHC class II deficiency, CIITA, RFX5, and RFXAP,are not only absolutely essential, with no bypass or alternativepathways, but also highly specific for MHC class II genes. Theseproperties are unusual for transcriptional regulatory factors,which generally control multiple genes and thus have pleiotropiceffects.
Symptomatic and prophylactic treatment of infections in patientswith MHC class II deficiency does not prevent progressive organdysfunction, and death is usual before the age of 18 years.Allogeneic bone marrow transplantation is considered the treatmentof choice, but the success rate is lower than that for otherimmunodeficiency syndromes.30 Now that three of the genes affectedin MHC class II deficiency have been identified, gene therapybecomes a possibility in this disease. In the case of complementationgroup A, it would not be possible to reproduce the complex patternof physiologic control of CIITA expression,14 and uncontrolledexpression of CIITA is likely to lead to aberrant expressionof MHC class II molecules. In the case of the novel complementationgroup D, however, the RFXAP gene is not regulated, and genetherapy can now be envisaged.
Supported by the Swiss National Science Foundation and the LouisJeantet Foundation.
We are indebted to M.C. Fondanèche, E. Barras, and M.Zufferey for expert technical assistance.
Source Information
From the Louis Jeantet Laboratory of Molecular Genetics, Department of Genetics and Microbiology, University of Geneva Medical School, Geneva (J.V., W.R., B.M.); INSERM Unité 429, Hôpital NeckerEnfants Malades, Paris (B.L.-G., A.F.); and the Department of Immunohematology and Bloodbank, University Hospital Leiden, Leiden, the Netherlands (P.E.).
Address reprint requests to Dr. Mach at the Department of Genetics and Microbiology, University of Geneva Medical School, 1 rue Michel-Servet, CH-1211 Geneva 4, Switzerland.
References
Rosen FS, Cooper MD, Wedgwood RJP. The primary immunodeficiencies. N Engl J Med 1995;333:431-440. [Free Full Text]
Griscelli C, Lisowska-Grospierre B, Mach B. Combined immunodeficiency with defective expression in MHC class II genes. In: Gupta S, Griscelli C, eds. New concepts in immunodeficiency diseases. Chichester, England: John Wiley, 1993:177-90.
Klein C, Lisowska-Grospierre B, LeDeist F, Fischer A, Griscelli C. Major histocompatibility complex class II deficiency: clinical manifestations, immunologic features, and outcome. J Pediatr 1993;123:921-928. [CrossRef][Medline]
de Preval C, Lisowska-Grospierre B, Loche M, Griscelli C, Mach B. A trans-acting class II regulatory gene unlinked to the MHC controls expression of HLA class II genes. Nature 1985;318:291-293. [CrossRef][Medline]
Mach B, Steimle V, Martinez-Soria E, Reith W. Regulation of MHC class II genes: lessons from a disease. Annu Rev Immunol 1996;14:301-331. [CrossRef][Medline]
Benichou B, Strominger JL. Class II-antigen-negative patient and mutant B-cell lines represent at least three, and probably four, distinct genetic defects defined by complementation analysis. Proc Natl Acad Sci U S A 1991;88:4285-4288. [Free Full Text]
Seidl C, Saraiya C, Osterweil Z, Fu YP, Lee JS. Genetic complexity of regulatory mutants defective for HLA class II gene expression. J Immunol 1992;148:1576-1584. [Abstract]
Lisowska-Grospierre B, Fondaneche MC, Rols MP, Griscelli C, Fischer A. Two complementation groups account for most cases of inherited MHC class II deficiency. Hum Mol Genet 1994;3:953-958. [Free Full Text]
Glimcher LH, Kara CJ. Sequences and factors: a guide to MHC class-II transcription. Annu Rev Immunol 1992;10:13-49. [CrossRef][Medline]
Steimle V, Otten LA, Zufferey M, Mach B. Complementation cloning of an MHC class II transactivator mutated in hereditary MHC class II deficiency (or bare lymphocyte syndrome). Cell 1993;75:135-146. [CrossRef][Medline]
Steimle V, Siegrist C, Mottet A, Lisowska-Grospierre B, Mach B. Regulation of MHC class II expression by interferon-gamma mediated by the transactivator gene CIITA. Science 1994;265:106-109. [Free Full Text]
Steimle V, Durand B, Barras E, et al. A novel DNA-binding regulatory factor is mutated in primary MHC class II deficiency (bare lymphocyte syndrome). Genes Dev 1995;9:1021-1032. [Free Full Text]
Durand B, Sperisen P, Emery P, et al. RFXAP, a novel subunit of the RFX DNA binding complex is mutated in MHC class II deficiency. EMBO J 1997;16:1045-1055. [CrossRef][Medline]
Muhlethaler-Mottet A, Otten LA, Steimle V, Mach B. Expression of MHC class II molecules in different cellular and functional compartments is controlled by differential usage of multiple promoters of the transactivator CIITA. EMBO J 1997;16:2851-2860. [CrossRef][Medline]
Peijnenburg A, Godthelp B, van Boxel-Dezaire A, van den Elsen PJ. Definition of a novel complementation group in MHC class II deficiency. Immunogenetics 1995;41:287-294. [Medline]
Touraine JL, Betuel H, Souillet G, Jeune M. Combined immunodeficiency disease associated with absence of cell-surface HLA-A and B antigens. J Pediatr 1978;93:47-51. [Medline]
Touraine JL, Bétuel H. Immunodeficiency diseases and expression of HLA antigens. Hum Immunol 1981;2:147-153. [Medline]
Amaldi I, Reith W, Berte C, Mach B. Induction of HLA class II genes by IFN-gamma is transcriptional and requires a trans-acting protein. J Immunol 1989;142:999-1004. [Abstract]
Cheng YS, Becker-Manley MF, Nguyen TD, DeGrado WF, Jonak GJ. Nonidentical induction of the guanylate binding protein and the 56K protein by type I and type II interferons. J Interferon Res 1986;6:417-427. [Medline]
Kumar V, Chambon P. The estrogen receptor binds tightly to its responsive element as a ligand-induced homodimer. Cell 1988;55:145-156. [CrossRef][Medline]
Durand B, Kobr M, Reith W, Mach B. Functional complementation of major histocompatibility complex class II regulatory mutants by the purified X-box-binding protein RFX. Mol Cell Biol 1994;14:6839-6847. [Free Full Text]
Reith W, Siegrist CA, Durand B, Barras E, Mach B. Function of major histocompatibility complex class II promoters requires cooperative binding between factors RFX and NF-Y. Proc Natl Acad Sci U S A 1994;91:554-558. [Free Full Text]
Reith W, Satola S, Sanchez CH, et al. Congenital immunodeficiency with a regulatory defect in MHC class II gene expression lacks a specific HLA-DR promoter binding protein, RF-X. Cell 1988;53:897-906. [CrossRef][Medline]
Reith W, Kobr M, Emery P, Durand B, Siegrist CA, Mach B. Cooperative binding between factors RFX and X2bp to the X and X2 boxes of MHC class II promoters. J Biol Chem 1994;269:20020-20025. [Free Full Text]
Wilkinson M. A rapid and convenient method for isolation of nuclear, cytoplasmic and total cellular RNA. Nucleic Acids Res 1988;16:10934-10934. [Free Full Text]
Villard J, Reith W, Barras E, et al. Chromosomal localization of the gene encoding RFX5, a novel transcription factor that is mutated in major histocompatibility complex class II deficiency. Hum Mutat (in press).
Gyapay G, Schmitt K, Fizames C, et al. A radiation hybrid map of the human genome. Hum Mol Genet 1996;5:339-346. [Free Full Text]
Hauber I, Gulle H, Wolf HM, Maris M, Eggenbauer H, Eibl MM. Molecular characterization of major histocompatibility complex class II gene expression and demonstration of antigen-specific T cell response indicate a new phenotype in class-II deficient patients. J Exp Med 1995;181:1411-1423. [Free Full Text]
Wolf HM, Hauber I, Gulle H, et al. Twin boys with major histocompatibility complex class II deficiency but inducible immune responses. N Engl J Med 1995;332:86-90. [Free Full Text]
Klein C, Cavazzana-Calvo M, Le Deist F, et al. Bone marrow transplantation in major histocompatibility complex class II deficiency: a single-center study of 19 patients. Blood 1995;85:580-587. [Free Full Text]
Matheux, F., Villard, J.
(2004). Cellular and Gene Therapy for Major Histocompatibility Complex Class II Deficiency. Physiology
19: 154-158
[Abstract][Full Text]
Das, S., Lin, J.-H., Papamatheakis, J., Sykulev, Y., Tsichlis, P. N.
(2002). Differential Splicing Generates Tvl-1/RFXANK Isoforms with Different Functions. J. Biol. Chem.
277: 45172-45180
[Abstract][Full Text]
Shao, L., Sperber, K.
(2002). Impaired Regulation of HLA-DR Expression in Human Immunodeficiency Virus-Infected Monocytes. CVI
9: 739-746
[Full Text]
Peretti, M., Villard, J., Barras, E., Zufferey, M., Reith, W.
(2001). Expression of the Three Human Major Histocompatibility Complex Class II Isotypes Exhibits a Differential Dependence on the Transcription Factor RFXAP. Mol. Cell. Biol.
21: 5699-5709
[Abstract][Full Text]
Wiszniewski, W., Fondaneche, M.-C., Le Deist, F., Kanariou, M., Selz, F., Brousse, N., Steimle, V., Barbieri, G., Alcaide-Loridan, C., Charron, D., Fischer, A., Lisowska-Grospierre, B.
(2001). Mutation in the Class II trans-Activator Leading to a Mild Immunodeficiency. J. Immunol.
167: 1787-1794
[Abstract][Full Text]
Lennon-Dumenil, A.-M., Barbouche, M.-R., Vedrenne, J., Prod'Homme, T., Bejaoui, M., Ghariani, S., Charron, D., Fellous, M., Dellagi, K., Alcaide-Loridan, C.
(2001). Uncoordinated HLA-D Gene Expression in a RFXANK-Defective Patient with MHC Class II Deficiency. J. Immunol.
166: 5681-5687
[Abstract][Full Text]
Gaspar, H B, Gilmour, K C, Jones, A M
(2001). Current topic: Severe combined immunodeficiency{---}molecular pathogenesis and diagnosis. Arch. Dis. Child.
84: 169-173
[Full Text]
Villard, J., Peretti, M., Masternak, K., Barras, E., Caretti, G., Mantovani, R., Reith, W.
(2000). A Functionally Essential Domain of RFX5 Mediates Activation of Major Histocompatibility Complex Class II Promoters by Promoting Cooperative Binding between RFX and NF-Y. Mol. Cell. Biol.
20: 3364-3376
[Abstract][Full Text]
Nagarajan, U. M., Peijnenburg, A., Gobin, S. J. P., Boss, J. M., van den Elsen, P. J.
(2000). Novel Mutations Within the RFX-B Gene and Partial Rescue of MHC and Related Genes Through Exogenous Class II Transactivator in RFX-B-Deficient Cells. J. Immunol.
164: 3666-3674
[Abstract][Full Text]
Godthelp, B. C., van Eggermond, M. C.J.A., Peijnenburg, A., Tezcan, I., van Lierde, S., van Tol, M. J.D., Vossen, J. M., van den Elsen, P. J.
(1999). Incomplete T-Cell Immune Reconstitution in Two Major Histocompatibility Complex Class II-Deficiency/Bare Lymphocyte Syndrome Patients After HLA-Identical Sibling Bone Marrow Transplantation. Blood
94: 348-358
[Abstract][Full Text]
Villard, J., Muhlethaler-Mottet, A., Bontron, S., Mach, B., Reith, W.
(1999). CIITA-induced occupation of MHC class II promoters is independent of the cooperative stabilization of the promoter-bound multi-protein complexes. Int Immunol
11: 461-469
[Abstract][Full Text]
Schwartz, R. S.
(1997). The Case of the Bare Lymphocyte Syndrome -- Tracking Down Faulty Transcription Factors. NEJM
337: 781-783
[Full Text]