FREE NEJM E-TOC    HOME   |   SUBSCRIBE   |   CURRENT ISSUE   |   PAST ISSUES   |   COLLECTIONS   |   Search Term  Advanced Search

Sign in | Get NEJM's E-Mail Table of Contents — Free | Subscribe

Previous Volume 337:748-753 September 11, 1997 Number 11 Next

Abstract PDF Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited PubMed Citation

ABSTRACT

Background Major-histocompatibility-complex (MHC) class II deficiency is an autosomal recessive primary immunodeficiency disease in which MHC class II molecules are absent. It is a genetically heterogeneous disease of gene regulation resulting from defects in several transactivating genes that regulate the expression of MHC class II genes. The mutations responsible for MHC class II deficiency are classified according to complementation group (a group in which the phenotype remains uncorrected in pairwise fusions of cells). There are three known complementation groups (A, B, and C).

Methods To elucidate the genetic defect in patients with MHC class II deficiency that was not classified genetically, we performed direct complementation assays with the three genes known to regulate the expression of MHC class II genes, CIITA, RFX5, and RFXAP, and the relevant mutations were identified in each patient.

Results Mutations in the RFXAP gene were found in three patients from unrelated families, and the resulting defect was classified as belonging to a novel complementation group (D). Transfection with the wild-type RFXAP gene restored the expression of MHC class II molecules in the patients' cells.

Conclusions Mutations in a novel MHC class II transactivating factor, RFXAP, can cause MHC class II deficiency. These mutations abolish the expression of MHC class II genes and lead to the same clinical picture of immunodeficiency as in patients with mutations in the other two MHC class II regulatory genes.

The clinical manifestations of the disease result from the lack of MHC class II molecules, but the primary genetic defect does not involve the MHC class II genes themselves or their promoters. Instead, the affected genes encode transactivating factors that regulate the expression of MHC class II genes. The demonstration that the disease does not segregate with the MHC class II locus established MHC class II deficiency as a disease of gene regulation.^4,5 Although clinically homogeneous, primary MHC class II deficiency is genetically heterogeneous. This was shown by cell-fusion experiments that identified three distinct complementation groups (i.e., groups in which the phenotype remains uncorrected in pairwise fusions of cells). These groups were named A, B, and C.^6,7,8 Mutant cells lacking MHC class II molecules have been produced in vitro, and they can also be classified according to complementation groups. One such mutant cell line (6.1.6) belongs to a fourth complementation group (D), which differs from the groups found thus far in MHC class II deficiency.^6,7,8

MHC class II molecules present antigens to T lymphocytes and are essential for the activation of T cells. The expression of MHC class II genes is under very tight and complex regulation. Epithelial cells in the thymus, dendritic cells, and B lymphocytes constitutively express MHC class II genes. In many other types of cells, the expression of these genes can be induced by certain stimuli, especially interferon-.⁹ In all these situations, the expression of MHC class II genes is controlled and directed by the MHC class II transactivator CIITA.^10,11

Studies of cell lines derived from patients with MHC class II deficiency and mutant cell lines have identified three key regulatory factors: CIITA, RFX5, and RFXAP.^{10,11,12,13,14} CIITA is defective in complementation group A. The molecular defect in groups B, C, and D is a deficiency of regulatory factor X (RFX), a multimeric protein complex that binds to promoters of MHC class II genes.⁵ One subunit of the RFX complex, RFX5, is mutated in complementation group C.¹² The mutant cell line 6.1.6 (complementation group D) has a mutation in RFXAP, a 36-kd subunit of the RFX complex.¹³ The identification of these regulatory genes has allowed us to study several patients with MHC class II deficiency whose genetic defect had not been previously classified or was thought to belong to complementation groups distinct from A, B, and C.^8,15 Our results show that in all the patients with bona fide MHC class II deficiency that we have studied, the mutations responsible belong to one of the four known complementation groups — A, B, C, or D.

Methods

Patients and Cell Lines

The ABI fibroblast cell line was derived from a Turkish patient (Patient 1).¹⁵ The ZM fibroblast and B-cell lines were derived from a Moroccan patient (Patient 2) (Fondanèche MC, et al.: unpublished data). The DA cell line was derived from an Algerian patient (Patient 3).^16,17 Cells were cultured, transfected, selected with hygromicin, and analyzed by flow cytometry (ABI and DA cells) or immunofluorescence (ZM cells) as described previously.^10,11,12,13 Transfected ABI and HeLa cells were stimulated with recombinant interferon- (GIBCO) for 72 hours. Transfected ZM fibroblasts were treated with interferon- for 48 hours.

Preparatory Measures and Assays

The plasmids used to transfect the ABI and ZM fibroblast-cell lines were pREP4 (Invitrogen) and pREP4–RFXAP. The RFXAP complementary DNA (cDNA)¹³ was cloned between the BamHI and HindIII site of pREP4. For DA cells, the plasmids used for transfection were pCD¹⁰ and pCD–RFXAP.¹³ The ³²P-labeled riboprobe used to detect RFX5 messenger RNA (mRNA) was transcribed with T7 RNA polymerase from a Bluescript plasmid (Stratagene) containing a 372-bp fragment of RFX5 (nucleotides 739 to 1110). The ³²P-labeled riboprobes used to detect mRNA of CI ITA, HLA-DRA, and guanylate-binding protein have been described previously.^10,18,19

Preparation of whole-cell extracts,²⁰ procedures for electrophoretic mobility shift assays,^12,21 binding conditions for RFX, nuclear factor Y (NF-Y),²² and the double-stranded oligonucleotides (WX2 and Y) used as probes^23,24 have been described previously. Binding reactions were carried out with 10 µg of whole-cell extract. For ABI cells, decreasing amounts of nonspecific competitor DNA were used.

Rnase Protection Experiments

Cytoplasmic RNA was extracted from 5 million cells as described previously.²⁵ To generate the probes, the plasmids were linearized and transcribed in the presence of [³²P]uridine triphosphate with T7 RNA polymerase in the case of RFX5, CIITA, and guanylate-binding protein; T3 RNA polymerase in the case of TATA-binding protein; or SP6 RNA polymerase in the case of HLA-DRA. The specific activity of the HLA-DRA probe was 30 times less than that of the other probes. For each sample, 30 µg of cytoplasmic RNA was analyzed as described previously.¹¹

Amplification and Sequencing

Full-length RFXAP cDNA clones were isolated by a reverse-transcription–polymerase-chain-reaction (PCR) assay and analyzed for mutations as described previously.¹³ The RFXAP gene was also examined for mutations by direct sequencing of PCR-amplified fragments derived from genomic DNA. The following primers were used: RFXAPC5 (5'ATggaggcgcagggtgtag3'), which is situated at the translation-initiation codon (nucleotides 116 to 133 of RFXAP cDNA), and RFX5APDA2 (5'TGCAGGTCTTGCTCATGCTG3'), which is situated between nucleotides 521 and 540 of RFXAP cDNA. PCR was performed with the Expand high-fidelity PCR system (Boehringer Mannheim). Sequencing was performed directly with the Applied Biosystems PRISM dye terminator cycle-sequencing kit and an Applied Biosystems DNA sequencer.

Results

Defect in the Binding of RFX to MHC Class II Promoters in Patient 1

A fibroblast cell line (ABI) from Patient 1, with an unidentified genetic defect,¹⁵ was studied for the expression of mRNA for the MHC class II gene HLA-DRA and the transactivators CIITA and RFX5. Figure 1A shows that the level of RFX5 mRNA was normal in the ABI cell line, and that interferon- induced similar degrees of expression of CIITA mRNA in ABI and control cells. By contrast, interferon- induced the expression of HLA-DRA mRNA in control cells but not in ABI cells. Thus, in Patient 1 the molecular defect does not affect RFX5 mRNA or the inducibility of CIITA mRNA by interferon-.

View larger version (24K): [in this window] [in a new window]   Figure 1. Analysis of the Expression of CIITA and RFX in Patient 1. The induction of CIITA is normal in Patient 1, as shown in Panel A. RNase protection experiments were performed with total RNA extracted from the HeLa cell line, in which the induction of CIITA is normal, and the ABI cell line from Patient 1. Each lane 1 shows probes for CIITA and guanylate-binding protein (GBP) mRNA. The GBP probe was used as a positive control for induction by interferon-. Each lane 2 shows probes for RFX5 and HLA-DRA mRNA. The exposure time for GBP differed from that for the other probes (24 hours vs. 48 hours). In Panel B, there is no binding of the RFX complex in cells from Patient 1 (ABI). In lanes 1 through 7, extracts from ABI cells; a normal B-cell line (Raji), which is positive for MHC class II molecules; and the HeLa cell line were analyzed by an electrophoretic mobility shift assay with an X-box oligonucleotide (WX2) as a probe. Binding reactions with the ABI extract were done with decreasing amounts of nonspecific competitor DNA (concentrations in lanes 4, 5, 6, and 7, respectively: 1.0, 0.8, 0.7, and 0.5 µg of poly[dIdC].poly[dIdC] per reaction, and 0.5, 0.4, 0.35, and 0.25 µg of single-stranded Escherichia coli DNA per reaction). In lanes 8 and 9, binding of nuclear factor Y (NF-Y) to a Y-box oligonucleotide was analyzed in the two extracts.

 
Patients with MHC class II deficiency of complementation groups B and C (as well as the mutant cell line 6.1.6, classified in group D) all have a defect that impairs the binding of RFX to the X box of MHC class II promoters.⁵ The X box is a cis-acting DNA sequence characteristic of MHC class II promoters. We therefore used electrophoretic mobility shift assays to test cell extracts, which normally contain the RFX protein, for binding to an oligonucleotide containing the DNA sequence of the X box (Figure 1B). Extracts from control HeLa and Raji cells bound RFX normally, whereas no binding to the X-box oligonucleotide was detected with extracts from ABI cells. In contrast, the NF-Y was detected in the extracts of both ABI and control cells. Patient 1 thus had the same specific defect in RFX binding that has been reported in complementation groups B, C, and D.

Effect of Transfection with the RFXAP Gene on the Expression of MHC Class II Molecules in the ABI Cell Line

In view of the defect in RFX binding in ABI cells, we investigated whether transfection with cDNA encoding the two subunits of RFX (RFX5 and RFXAP) would allow interferon- to induce the expression of MHC class II genes in ABI cells. The cDNA encoding RFX5, the gene affected in complementation group C, had no effect (data not shown), whereas transfection with the cDNA of RFXAP enabled interferon- to induce the expression of the HLA-DR gene in ABI cells (Figure 2A). The wild-type RFXAP gene can thus correct the defect in the expression of MHC class II in cells from Patient 1.

View larger version (5K): [in this window] [in a new window]   Figure 2. Complementation of HeLa Cells and Cells from Patient 1 (ABI) by RFXAP. In Panel A, ABI cells from Patient 1 were transfected with pREP4, an expression vector, and the expression of MHC class II molecules was induced with 5000 U of interferon- per milliliter (upper left-hand corner), or ABI cells were transfected with pREP4–RFXAP and expression was induced with either 1000 U of interferon- per milliliter (lower left-hand corner) or 5000 U of interferon- per milliliter (lower right-hand corner). Expression of MHC class II molecules by control HeLa cells was induced with 1000 U of interferon- per milliliter (upper right-hand corner). Cells were stained for HLA-DR and analyzed by flow cytometry (FACScan). The open profiles are those of uninduced cells and the solid profiles those of cells treated with interferon-. Panel B shows the RFXAP protein. The position of regions rich in acidic amino acids (39 percent aspartic acid and glutamic acid; DE), basic amino acids (54 percent arginine and lysine; RK), and glutamine (52 percent; Q) are indicated. Both cDNA clones and PCR-amplified genomic DNA from Patient 1 contained a point mutation at nucleotide 279 (asterisk) that leads to a premature stop codon (TAG).

 
The RFXAP Gene in Patient 1

To characterize the RFXAP gene in Patient 1, the entire coding region of RFXAP mRNA from ABI cells was amplified by PCR, subcloned, and sequenced. All the cDNA clones that we isolated contained a point mutation at nucleotide 279 that converts a glutamine codon to a premature stop codon (from CAG to TAG). This mutation would lead to a severely truncated protein of only 52 amino acids. Direct sequencing of a genomic PCR fragment demonstrated that Patient 1 is homozygous for the mutated allele (Figure 2B). In this patient the defect is therefore in the same regulatory gene as the defect in the mutant cell line 6.1.6, and thus belongs to complementation group D.

Additional Defects in the Regulatory Gene RFXAP

A cell line (ZM) from Patient 2 was studied in the same way as the ABI cell line. The expression of MHC class II genes was fully corrected by transfection of ZM cells with the cDNA of RFXAP (Figure 3A), indicating that the defect in Patient 2 also belongs to complementation group D. A cell line (DA) from another, unrelated patient with MHC class II deficiency (Patient 3) was also fully corrected by transfection with the cDNA of the RFXAP gene.¹³

View larger version (61K): [in this window] [in a new window]   Figure 3. RFXAP Defects Identified in Patients 2 and 3. In Panel A, the expression of HLA-DR on the surface of cells from Patient 2 transfected with pREP4 or pREP4–RFXAP was analyzed by immunofluorescence after the addition of 200 U of interferon- per milliliter. Transfection with pREP4–RFXAP restored the expression of HLA-DR on fibroblasts from Patient 2 (top), but transfection with pREP4 did not (bottom). Panel B shows the RFXAP protein, with regions rich in acidic amino acids (39 percent aspartic acid and glutamic acid; DE), basic amino acids (54 percent arginine and lysine; RK), and glutamine (52 percent; Q). Both cDNA and PCR-amplified genomic DNA from Patients 2 and 313 had a deletion of a G (asterisk) at nucleotide 484.

 
The entire coding region of RFXAP mRNA from the ZM cell line was amplified by PCR, subcloned, and sequenced. All the cDNA clones that were isolated had a deletion of a G residue at nucleotide 484. The resulting frame shift leads to an out-of-frame stop codon at nucleotide 525 and would thus give rise to a severely truncated and inactive RFXAP protein of only 136 amino acids (Figure 3B). This mutation is identical to that observed in Patient 3.¹³ Direct sequencing (in the case of Patient 2) and oligotyping (in the case of Patient 3) of genomic PCR fragments spanning the mutation have shown that the two patients are homozygous for the mutated allele of RFXAP.

Discussion

MHC class II deficiency is a disease of gene regulation involving regulatory factors that are essential for the expression of MHC class II genes. CIITA, the gene affected in complementation group A (Figure 4), encodes a transactivator that does not bind to DNA and serves as a general controller of both the constitutive and inducible expression of MHC class II genes.^5,10,11 The expression of CIITA is very tightly controlled by several alternative promoters.¹⁴ Mutations in the gene encoding RFX5, a subunit of the ubiquitous RFX complex, cause the defect in complementation group C (Figure 4). ^12,26 Recently, a second subunit of the RFX complex, RFXAP, has been cloned.¹³ We found that mutations in the RFXAP gene define a novel complementation group — group D (Figure 4). The genes affected in groups A (CIITA) and C (RFX5) have been mapped to chromosomes 16 and 1, respectively.^5,26 Using a novel high-resolution mapping method,²⁷ we have mapped RFXAP (group D) to chromosome 13 (Table 1). The defect in complementation group B entails the same lack of binding of the RFX protein to the X box of the promoters of MHC class II genes as in groups C and D. We have recently identified a third protein subunit within RFX, which might be affected in complementation group B.

View larger version (23K): [in this window] [in a new window]   Figure 4. The MHC Class II Promoter and the Transcription Factors Affected in Complementation Groups A, C, and D. CIITA is mutated in complementation group A.10 Mutations in CIITA do not affect binding of transcription factors to the promoter in vivo. CIITA presumably controls transcription by contacting promoter-bound transcription factors, but its mechanism of action is unknown. RFX5 and RFXAP are two subunits of the RFX complex and are mutated in complementation groups C12 and D,13 respectively. A third subunit of the RFX complex is shown. X2BP and nuclear factor Y (NF-Y) are proteins that bind to the X2 and Y boxes and interact with the RFX protein complex.21,24 The S box is a less well characterized binding site. A deficiency of any of the components of the RFX complex does not allow transcription of class II MHC genes. Plus and minus signs indicate transcriptional activity.

 

View this table: [in this window] [in a new window]   Table 1. Genetic Defects in Patients with MHC Class II Deficiency, According to Complementation Group.

 
Mutations in RFXAP account for the lack of expression of MHC class II molecules in complementation group D, and all the patients that we studied were homozygous for a mutation in this gene (Figure 2A, Figure 2B, Figure 3A, and Figure 3B). Patients 2 and 3 have the same defect but are from different families, originating from Algeria and Morocco, respectively. An identical mutation, in a homozygous state, in such a rare genetic disease, suggests both consanguinity and common ancestry.

Patient 2 is of special interest because his genetic defect has been shown by cell-fusion experiments to be related to the defect in five other patients from three unrelated families (Fondanèche MC, et al.: unpublished data). Thus, at least eight patients from six unrelated families have a defect in the RFXAP gene and thus belong to complementation group D (Table 1). This complementation group is the largest after group B. It also appears that the four complementation groups account for all currently known types of true MHC class II deficiency (Table 1). A family with an almost asymptomatic form of immunodeficiency and with only selective defects in the expression of certain HLA class II genes has been described,^28,29 but this atypical phenotype probably represents a distinct syndrome.

The clinical manifestations and immunologic abnormalities in MHC class II deficiency are similar in all four complementation groups,^2,3,5 probably because the distinct regulatory factors involved in this disease, although having very different structures and functions, are all essential for the control of the expression of MHC class II genes. Interestingly, the three regulatory genes affected in MHC class II deficiency, CIITA, RFX5, and RFXAP, are not only absolutely essential, with no bypass or alternative pathways, but also highly specific for MHC class II genes. These properties are unusual for transcriptional regulatory factors, which generally control multiple genes and thus have pleiotropic effects.

Symptomatic and prophylactic treatment of infections in patients with MHC class II deficiency does not prevent progressive organ dysfunction, and death is usual before the age of 18 years. Allogeneic bone marrow transplantation is considered the treatment of choice, but the success rate is lower than that for other immunodeficiency syndromes.³⁰ Now that three of the genes affected in MHC class II deficiency have been identified, gene therapy becomes a possibility in this disease. In the case of complementation group A, it would not be possible to reproduce the complex pattern of physiologic control of CIITA expression,¹⁴ and uncontrolled expression of CIITA is likely to lead to aberrant expression of MHC class II molecules. In the case of the novel complementation group D, however, the RFXAP gene is not regulated, and gene therapy can now be envisaged.

Supported by the Swiss National Science Foundation and the Louis Jeantet Foundation.

We are indebted to M.C. Fondanèche, E. Barras, and M. Zufferey for expert technical assistance.

Source Information

From the Louis Jeantet Laboratory of Molecular Genetics, Department of Genetics and Microbiology, University of Geneva Medical School, Geneva (J.V., W.R., B.M.); INSERM Unité 429, Hôpital Necker–Enfants Malades, Paris (B.L.-G., A.F.); and the Department of Immunohematology and Bloodbank, University Hospital Leiden, Leiden, the Netherlands (P.E.).

Address reprint requests to Dr. Mach at the Department of Genetics and Microbiology, University of Geneva Medical School, 1 rue Michel-Servet, CH-1211 Geneva 4, Switzerland.

References

1. Rosen FS, Cooper MD, Wedgwood RJP. The primary immunodeficiencies. N Engl J Med 1995;333:431-440. [Free Full Text]
2. Griscelli C, Lisowska-Grospierre B, Mach B. Combined immunodeficiency with defective expression in MHC class II genes. In: Gupta S, Griscelli C, eds. New concepts in immunodeficiency diseases. Chichester, England: John Wiley, 1993:177-90.
3. Klein C, Lisowska-Grospierre B, LeDeist F, Fischer A, Griscelli C. Major histocompatibility complex class II deficiency: clinical manifestations, immunologic features, and outcome. J Pediatr 1993;123:921-928. [CrossRef][Medline]
4. de Preval C, Lisowska-Grospierre B, Loche M, Griscelli C, Mach B. A trans-acting class II regulatory gene unlinked to the MHC controls expression of HLA class II genes. Nature 1985;318:291-293. [CrossRef][Medline]
5. Mach B, Steimle V, Martinez-Soria E, Reith W. Regulation of MHC class II genes: lessons from a disease. Annu Rev Immunol 1996;14:301-331. [CrossRef][Medline]
6. Benichou B, Strominger JL. Class II-antigen-negative patient and mutant B-cell lines represent at least three, and probably four, distinct genetic defects defined by complementation analysis. Proc Natl Acad Sci U S A 1991;88:4285-4288. [Free Full Text]
7. Seidl C, Saraiya C, Osterweil Z, Fu YP, Lee JS. Genetic complexity of regulatory mutants defective for HLA class II gene expression. J Immunol 1992;148:1576-1584. [Abstract]
8. Lisowska-Grospierre B, Fondaneche MC, Rols MP, Griscelli C, Fischer A. Two complementation groups account for most cases of inherited MHC class II deficiency. Hum Mol Genet 1994;3:953-958. [Free Full Text]
9. Glimcher LH, Kara CJ. Sequences and factors: a guide to MHC class-II transcription. Annu Rev Immunol 1992;10:13-49. [CrossRef][Medline]
10. Steimle V, Otten LA, Zufferey M, Mach B. Complementation cloning of an MHC class II transactivator mutated in hereditary MHC class II deficiency (or bare lymphocyte syndrome). Cell 1993;75:135-146. [CrossRef][Medline]
11. Steimle V, Siegrist C, Mottet A, Lisowska-Grospierre B, Mach B. Regulation of MHC class II expression by interferon-gamma mediated by the transactivator gene CIITA. Science 1994;265:106-109. [Free Full Text]
12. Steimle V, Durand B, Barras E, et al. A novel DNA-binding regulatory factor is mutated in primary MHC class II deficiency (bare lymphocyte syndrome). Genes Dev 1995;9:1021-1032. [Free Full Text]
13. Durand B, Sperisen P, Emery P, et al. RFXAP, a novel subunit of the RFX DNA binding complex is mutated in MHC class II deficiency. EMBO J 1997;16:1045-1055. [CrossRef][Medline]
14. Muhlethaler-Mottet A, Otten LA, Steimle V, Mach B. Expression of MHC class II molecules in different cellular and functional compartments is controlled by differential usage of multiple promoters of the transactivator CIITA. EMBO J 1997;16:2851-2860. [CrossRef][Medline]
15. Peijnenburg A, Godthelp B, van Boxel-Dezaire A, van den Elsen PJ. Definition of a novel complementation group in MHC class II deficiency. Immunogenetics 1995;41:287-294. [Medline]
16. Touraine JL, Betuel H, Souillet G, Jeune M. Combined immunodeficiency disease associated with absence of cell-surface HLA-A and B antigens. J Pediatr 1978;93:47-51. [Medline]
17. Touraine JL, Bétuel H. Immunodeficiency diseases and expression of HLA antigens. Hum Immunol 1981;2:147-153. [Medline]
18. Amaldi I, Reith W, Berte C, Mach B. Induction of HLA class II genes by IFN-gamma is transcriptional and requires a trans-acting protein. J Immunol 1989;142:999-1004. [Abstract]
19. Cheng YS, Becker-Manley MF, Nguyen TD, DeGrado WF, Jonak GJ. Nonidentical induction of the guanylate binding protein and the 56K protein by type I and type II interferons. J Interferon Res 1986;6:417-427. [Medline]
20. Kumar V, Chambon P. The estrogen receptor binds tightly to its responsive element as a ligand-induced homodimer. Cell 1988;55:145-156. [CrossRef][Medline]
21. Durand B, Kobr M, Reith W, Mach B. Functional complementation of major histocompatibility complex class II regulatory mutants by the purified X-box-binding protein RFX. Mol Cell Biol 1994;14:6839-6847. [Free Full Text]
22. Reith W, Siegrist CA, Durand B, Barras E, Mach B. Function of major histocompatibility complex class II promoters requires cooperative binding between factors RFX and NF-Y. Proc Natl Acad Sci U S A 1994;91:554-558. [Free Full Text]
23. Reith W, Satola S, Sanchez CH, et al. Congenital immunodeficiency with a regulatory defect in MHC class II gene expression lacks a specific HLA-DR promoter binding protein, RF-X. Cell 1988;53:897-906. [CrossRef][Medline]
24. Reith W, Kobr M, Emery P, Durand B, Siegrist CA, Mach B. Cooperative binding between factors RFX and X2bp to the X and X2 boxes of MHC class II promoters. J Biol Chem 1994;269:20020-20025. [Free Full Text]
25. Wilkinson M. A rapid and convenient method for isolation of nuclear, cytoplasmic and total cellular RNA. Nucleic Acids Res 1988;16:10934-10934. [Free Full Text]
26. Villard J, Reith W, Barras E, et al. Chromosomal localization of the gene encoding RFX5, a novel transcription factor that is mutated in major histocompatibility complex class II deficiency. Hum Mutat (in press).
27. Gyapay G, Schmitt K, Fizames C, et al. A radiation hybrid map of the human genome. Hum Mol Genet 1996;5:339-346. [Free Full Text]
28. Hauber I, Gulle H, Wolf HM, Maris M, Eggenbauer H, Eibl MM. Molecular characterization of major histocompatibility complex class II gene expression and demonstration of antigen-specific T cell response indicate a new phenotype in class-II deficient patients. J Exp Med 1995;181:1411-1423. [Free Full Text]
29. Wolf HM, Hauber I, Gulle H, et al. Twin boys with major histocompatibility complex class II deficiency but inducible immune responses. N Engl J Med 1995;332:86-90. [Free Full Text]
30. Klein C, Cavazzana-Calvo M, Le Deist F, et al. Bone marrow transplantation in major histocompatibility complex class II deficiency: a single-center study of 19 patients. Blood 1995;85:580-587. [Free Full Text]

Abstract PDF Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited PubMed Citation

This article has been cited by other articles:

• Matheux, F., Villard, J. (2004). Cellular and Gene Therapy for Major Histocompatibility Complex Class II Deficiency. Physiology 19: 154-158 [Abstract] [Full Text]  
• Das, S., Lin, J.-H., Papamatheakis, J., Sykulev, Y., Tsichlis, P. N. (2002). Differential Splicing Generates Tvl-1/RFXANK Isoforms with Different Functions. J. Biol. Chem. 277: 45172-45180 [Abstract] [Full Text]  
• Shao, L., Sperber, K. (2002). Impaired Regulation of HLA-DR Expression in Human Immunodeficiency Virus-Infected Monocytes. CVI 9: 739-746 [Full Text]  
• Peretti, M., Villard, J., Barras, E., Zufferey, M., Reith, W. (2001). Expression of the Three Human Major Histocompatibility Complex Class II Isotypes Exhibits a Differential Dependence on the Transcription Factor RFXAP. Mol. Cell. Biol. 21: 5699-5709 [Abstract] [Full Text]  
• Wiszniewski, W., Fondaneche, M.-C., Le Deist, F., Kanariou, M., Selz, F., Brousse, N., Steimle, V., Barbieri, G., Alcaide-Loridan, C., Charron, D., Fischer, A., Lisowska-Grospierre, B. (2001). Mutation in the Class II trans-Activator Leading to a Mild Immunodeficiency. J. Immunol. 167: 1787-1794 [Abstract] [Full Text]  
• Lennon-Dumenil, A.-M., Barbouche, M.-R., Vedrenne, J., Prod'Homme, T., Bejaoui, M., Ghariani, S., Charron, D., Fellous, M., Dellagi, K., Alcaide-Loridan, C. (2001). Uncoordinated HLA-D Gene Expression in a RFXANK-Defective Patient with MHC Class II Deficiency. J. Immunol. 166: 5681-5687 [Abstract] [Full Text]  
• Gaspar, H B, Gilmour, K C, Jones, A M (2001). Current topic: Severe combined immunodeficiency{---}molecular pathogenesis and diagnosis. Arch. Dis. Child. 84: 169-173 [Full Text]  
• Villard, J., Peretti, M., Masternak, K., Barras, E., Caretti, G., Mantovani, R., Reith, W. (2000). A Functionally Essential Domain of RFX5 Mediates Activation of Major Histocompatibility Complex Class II Promoters by Promoting Cooperative Binding between RFX and NF-Y. Mol. Cell. Biol. 20: 3364-3376 [Abstract] [Full Text]  
• Nagarajan, U. M., Peijnenburg, A., Gobin, S. J. P., Boss, J. M., van den Elsen, P. J. (2000). Novel Mutations Within the RFX-B Gene and Partial Rescue of MHC and Related Genes Through Exogenous Class II Transactivator in RFX-B-Deficient Cells. J. Immunol. 164: 3666-3674 [Abstract] [Full Text]  
• Godthelp, B. C., van Eggermond, M. C.J.A., Peijnenburg, A., Tezcan, I., van Lierde, S., van Tol, M. J.D., Vossen, J. M., van den Elsen, P. J. (1999). Incomplete T-Cell Immune Reconstitution in Two Major Histocompatibility Complex Class II-Deficiency/Bare Lymphocyte Syndrome Patients After HLA-Identical Sibling Bone Marrow Transplantation. Blood 94: 348-358 [Abstract] [Full Text]  
• Villard, J., Muhlethaler-Mottet, A., Bontron, S., Mach, B., Reith, W. (1999). CIITA-induced occupation of MHC class II promoters is independent of the cooperative stabilization of the promoter-bound multi-protein complexes. Int Immunol 11: 461-469 [Abstract] [Full Text]  
• Schwartz, R. S. (1997). The Case of the Bare Lymphocyte Syndrome -- Tracking Down Faulty Transcription Factors. NEJM 337: 781-783 [Full Text]