Background Bone mass is under strong genetic control, and recentstudies in adults have suggested that allelic differences inthe gene for the vitamin D receptor may account for inheritedvariability in bone mass. We studied the relations of the vitaminDreceptor genotype to skeletal development and variationin the size, volume, and density of bone in children.
Methods We identified three allelic variants of the vitaminDreceptor gene using the polymerase chain reaction andthree restriction enzymes (ApaI, BsmI, and TaqI) in 100 normalprepubertal American girls of Mexican descent. We then determinedthe relations of the different vitamin Dreceptor genotypes(AA, Aa, aa, BB, Bb, bb, TT, Tt, and tt) to the cross-sectionalarea, cortical area, and cortical bone density of the femoralshaft and the cross-sectional area and density of the lumbarvertebrae.
Results The vitamin Dreceptor genotype was associatedwith femoral and vertebral bone density. Girls with aa and bbgenotypes had 2 to 3 percent higher femoral bone density (P= 0.008 and P = 0.04, respectively) and 8 to 10 percent highervertebral bone density (P = 0.01 and P = 0.03, respectively)than girls with AA and BB genotypes. There was no associationbetween the cross-sectional area of the vertebrae or the cross-sectionalor cortical area of the femur and the vitamin Dreceptorgenotype. The chronologic age, bone age, height, weight, body-surfacearea, and body-mass index did not differ significantly amonggirls with different vitamin Dreceptor genotypes.
Conclusions Vitamin Dreceptor gene alleles predict thedensity of femoral and vertebral bone in prepubertal Americangirls of Mexican descent.
Defining the genetic and environmental factors responsible forvariations in bone mass during skeletal growth should aid inthe identification of children at risk for osteoporosis andfractures later in life.1 Although the influence of environmentalfactors such as nutrition and physical exercise on the amountof bone that is gained during childhood has been the subjectof several studies,2 knowledge of the genetic components ofbone mass is limited to studies of motherdaughter pairsand twins.3,4,5 Consequently, great interest was generated bya recent report suggesting that allelic differences in the genefor the vitamin D receptor account for inherited variabilityin bone mass.6 However, not all subsequent studies confirmedthe relation, and the results of positive studies differed withregard to the magnitude of the association.7,8,9 Further controversyarose from data suggesting that vitamin Dreceptor genepolymorphisms were not related to bone mass but were relatedto variations in diaphyseal cross-sectional growth resultingfrom periosteal apposition of new bone.10,11,12 These discrepanciescould, in part, be due to the technique used to study bone.Measurements of bone density by absorptiometry are based ona two-dimensional projection of a three-dimensional structure,cannot accurately account for variations in cross-sectionalarea, and are influenced not only by bone mass, but also bythe size of the bone.13
Quantitative computed tomography (CT) allows accurate assessmentof both the size of the bones and the various components thatinfluence bone mass.14 In this study, we used quantitative CTto investigate whether there is an association between vitaminDreceptor genotype and the skeletal development of prepubertalgirls and, if so, whether this link is related to variationsin the size of the femurs or the lumbar vertebrae, the volumeof cortical bone in the femurs, or the density of cortical bonein the femurs or of cancellous bone in the vertebrae.
Methods
Subjects
We studied 100 normal, prepubertal, American girls of Mexicandescent who were between 6.7 and 11.7 years of age and wererecruited from schools in Los Angeles County, California. Theprotocol was approved by the Children's Hospital of Los AngelesInstitutional Review Board, and informed consent was obtainedfrom all subjects and their parents or guardians.
Subjects were excluded if they had any chronic illness, hadbeen ill for more than two weeks during the previous six months,had ever been hospitalized, or had taken any medications, vitaminpreparations, or calcium supplements within the previous sixmonths. Girls were also excluded if their parents or grandparentswere not of Mexican descent.
All the children underwent a physical examination by a pediatricendocrinologist to determine their stage of sexual development.Only girls who were prepubertal and whose height and weightwere between the 5th and 95th percentiles for the mean age-adjustednormal values for white girls were enrolled. Body-surface areaand body-mass index were calculated as previously described.15Skeletal maturation was determined by the method of Greulichand Pyle16; girls whose chronologic and bone age differed bymore than one year were also excluded.
Genotypic Analysis of Polymorphisms of the Vitamin DReceptor Gene
The genotype for three restriction-fragmentlength polymorphismsof the vitamin Dreceptor gene was determined by polymerase-chain-reaction(PCR) amplification and enzymatic digestion of the productswith ApaI, BsmI, and TaqI. The primers for the BsmI polymorphismhave been described previously.6 The forward primer for theApaI and TaqI polymorphisms, located in exon 7, was the sameas that used for amplification of the BsmI polymorphism:5'CAACCAAGACTACAAGTACCGCGTCAGTGA3'.The reverse primer for the ApaI and TaqI polymorphisms was locatedin exon 9: 5'CACTTCGAGCACAAGGGGCGTTAGC3'. PCR was performedwith a Biometra Trio thermoblock (Floral City, Fla.) under standardconditions, for 35 cycles, and with 65°C as annealing temperature.With the enzymes ApaI, BsmI, and TaqI, the respective genotypeswere defined as A, B, T (indicating the absence of the restrictionsite) or a, b, t (indicating the presence of the restrictionsite). The PCR product for the BsmI polymorphism was 825 basepairs (bp) long, and the restriction fragments were 650 bp and175 bp long. The PCR products for the ApaI and TaqI polymorphismswere 2000 bp long; the lengths of the fragments after digestionwith ApaI were 1700 and 300 bp, and the lengths of the fragmentsafter digestion with TaqI were 1800 and 200 bp.
Biochemical Studies
After an overnight fast, blood was taken for measurement ofserum biochemical values, calciotropic hormones, and markersof bone turnover. Serum parathyroid hormone, 25-hydroxyvitaminD, 1,25-dihydroxyvitamin D, alkaline phosphatase, bone-specificalkaline phosphatase, and osteocalcin were measured at CorningNichols Institute, San Juan Capistrano, California.
Techniques and Definitions of Bone Measurements
All CT bone measurements were performed with the same instrument(CT-T 9800, General Electric, Milwaukee) and mineral referencephantom (CT-T bone densitometry package, General Electric).The density of cancellous bone and the cross-sectional areaof the vertebrae were measured at the midportion of vertebralbodies L1 through L3, and the cross-sectional area, the areaof cortical bone, and the density of cortical bone were measuredat the midshaft of both femurs, as previously described.17,18
The size of the axial skeleton was defined as the cross-sectionalarea at the midportion of the vertebral body in square centimeters,and the density of cancellous bone was defined as the amountof bone and marrow in milligrams per cubic centimeter per pixel,the CT unit of measurement. Because of the small size of thetrabeculae as compared with that of the pixel, the CT valuesfor cancellous bone density reflect not only the amount of mineralizedbone and osteoid, but also the amount of marrow per pixel.14These measurements are analogous to in vitro determinationsof the volumetric density of trabecular bone, which are obtainedby washing the marrow from the pores of a specimen of cancellousbone, weighing it, and dividing the weight by the volume ofthe specimen, including the pores.19
The size of the appendicular skeleton was defined as the cross-sectionalarea at the midshaft of the femur in square centimeters, thevolume of cortical bone as the cortical bone area at the midshaftof the femur in square centimeters, and the density of corticalbone as the amount of bone in milligrams per cubic centimeterper pixel. Because of the thickness and relative lack of porosityof cortical bone at the midshaft of the femur, the CT valuesreflect the density of the bone (the amount of collagen andmineral in a given volume of bone).17 These measurements areanalogous to in vitro determinations of the intrinsic mineraldensity of bone, which are commonly expressed as the ash weightper unit volume of bone.20
The coefficients of variation for repeated CT measurements offemoral cortical bone density, cortical bone area, and cross-sectionalarea and of vertebral cancellous bone density and cross-sectionalarea were 0.6 to 2 percent.17,18 The time required for the procedurewas approximately 10 minutes, and the radiation exposure wasapproximately 100 to 200 mrem (1 to 2 mJ per kilogram), localizedto the midportions of the first three lumbar vertebrae and thefemurs; the effective radiation dose was approximately 8 mrem(0.08 mJ per kilogram).21,22
Statistical Analysis
Anthropometric, biochemical, and bone measurements were assessedby analysis of variance with the Bonferroni correction for multiplecomparisons and by linear regression analysis.23 Linkage disequilibriumwas assessed by a chi-square test with the null hypothesis ofno linkage disequilibrium between the different polymorphicalleles. To estimate haplotype frequencies, the computer programEstimated Haplotype (Linkage Program version 5.1) was used.24All statistical tests were two-sided.
Results
Characteristics of the Study Population
Table 1 shows the anthropometric characteristics of the 100girls. By design, the average values for bone age were similarto those for chronologic age. Also by design, the heights andweights of the girls were between the 5th and 95th percentilesfor age; mean height was at the 50th percentile, and mean weightwas at the 70th percentile.
Table 1. Vitamin DReceptor Genotype, Age, and Anthropometric Characteristics in 100 Normal Prepubertal American Girls of Mexican Descent.
The most common vitamin Dreceptor genotypes were Aa (55percent), Bb (42 percent), and TT (54 percent). Genotypes aaand bb were more frequent (24 percent and 44 percent, respectively)than AA and BB (21 percent and 14 percent, respectively). Whenthe genotypes for all polymorphisms were combined, the mostfrequent were AaBbTt (29 percent) and aabbTT (23 percent).
Genotype, Phenotype, and Biochemical Association
There were no significant differences in developmental statusamong girls with different vitamin Dreceptor genotypes,and the mean values for age, bone age, height, weight, body-surfacearea, and body-mass index were similar in all groups (Table 1).There were significant relations between vitamin Dreceptorgenotype and the range of values for bone density in both thefemurs and the vertebrae. Girls with genotypes aa and bb had2 to 3 percent higher femoral bone density (P = 0.008 and P= 0.04, respectively) and 8 to 10 percent higher vertebral bonedensity (P = 0.01 and P = 0.03, respectively) than those withAA and BB genotypes (Figure 1A and Figure 1B). The presenceof these homozygous genotypes predicted higher femoral (r =0.35, P = 0.03) and vertebral (r = 0.44, P = 0.02) bone density.Although the bone densities did not differ according to TaqIgenotype, there was a trend toward higher values for vertebraland femoral bone density in girls with the TT genotype, andtoward lower values in girls with the homozygous tt genotype(Table 2).
Figure 1. Femoral Cortical (Panel A) and Vertebral Cancellous (Panel B) Bone Density in Relation to Vitamin DReceptor Genotypes Determined with the Restriction Enzymes ApaI and BsmI in 100 Normal Prepubertal American Girls of Mexican Descent.
AA and BB denote homozygosity for the absence of the ApaI and BsmI sites, respectively; aa and bb, homozygosity for the presence of the ApaI and BsmI sites; and Aa and Bb, heterozygosity. Values shown are means ±SE. P values are for differences between homozygosity genotypes by multiple-comparison tests.
Table 2. Vitamin DReceptor Genotype and CT Measurements of the Femoral Shafts and Lumbar Vertebrae in 100 Normal Prepubertal American Girls of Mexican Descent.
The 23 girls with the most favorable genotype (aabb) had 2 percenthigher femoral bone density (P = 0.03) and 12 percent highervertebral bone density (P = 0.01) than the 14 girls with theleast favorable genotype (AABB). The estimated frequencies ofthe AB and ab haplotypes indicate that these alleles were inlinkage disequilibrium (P<0.001).24 Neither age nor anthropometricmeasurements contributed to the variance in bone density (datanot shown).
In contrast to the findings for bone density, the vitamin Dreceptoralleles in the three genotypic groups were not associated withvertebral cross-sectional area or with femoral cross-sectionalor cortical bone area (Table 2). However, these dimensions correlatedstrongly with age and with all anthropometric measurements;the strongest correlation was with body weight (r = 0.76 to0.80). In the multivariate analysis, once weight was includedin the regression model, the predictive power was not improvedby the addition of chronologic age, bone age, or height.
The vitamin Dreceptor alleles in the three genotypicgroups were not associated with the serum concentrations ofcalcium or other biochemical values, calciotropic hormones,or markers of bone turnover (data not shown). Similarly, therewas no relation between the measurements of bone density andany of the biochemical variables. However, femoral and vertebralcross-sectional areas were weakly correlated with serum concentrationsof osteocalcin, alkaline phosphatase, and bone-specific alkalinephosphatase (r = 0.24 to 0.28).
Discussion
We found that in normal, prepubertal, American girls of Mexicandescent, polymorphisms in the vitamin Dreceptor geneaccounted for a significant proportion of the variance in thebone density of the femoral shaft and the lumbar vertebrae.The polymorphisms accounted for a difference of more than 1SD in femoral and vertebral bone density between the groupsof homozygotes defined by restriction enzymes BsmI and ApaI.However, because of the very narrow range of values for femoralbone density, girls with the aa and bb genotypes had femoralbone density that was an average of only 2 percent higher thanthat in girls with the AA and BB genotypes, whereas vertebralbone density differed by about 9 percent between the same groups.
Femoral bone density was eight times as high as vertebral bonedensity, a finding consistent with histomorphometric studiesindicating an equivalent difference in the porosity of thesetwo forms of bone.19,20 Chronologic age, bone age, height, andweight did not influence bone density at either site, a findingthat corroborates previous results indicating that skeletalgrowth in prepubertal children is not associated with significantchanges in bone density.17,25
Two characteristics of the population studied should be noted.First, the girls were of Mexican-American heritage, and previousstudies have suggested a large degree of genetic homogeneityin this population.26 The genotypic frequencies were very similarto those previously found in France and in people of Europeandescent in Australia and the United States.27,28,29 Second,we chose to study prepubertal children to avoid the confoundingeffect of the pubertal growth spurt on skeletal development.Differences among girls with different vitamin Dreceptorgene alleles might be more difficult to demonstrate if the studieswere done during puberty, when large increases in skeletal sizeand bone mass occur within a short period.25,30
The mechanism or mechanisms by which the vitamin Dreceptorgenotypes are linked to bone density have yet to be determined,but they are probably related to the established actions ofvitamin D. Premenopausal women with the bb genotype have a greaterdecrease in the serum parathyroid hormone concentration afterthe administration of calcitriol than women with the BB genotype.31Vitamin Dreceptor genotypes have also been linked tothe regulation of the intestinal absorption of calcium: whenthe dietary intake of calcium is low, women with BB allelesmay absorb calcium less efficiently than those with bb alleles.32Thus, differences in allelic status may be related to bone mineralizationthrough the effects of the vitamin Dreceptor genotypeon the intestinal absorption of calcium.
We found that vitamin Dreceptor genotypes were associatedwith bone density but not with the volume of femoral bone orthe cross-sectional area of the femurs or the vertebrae. Ourresults differ from those of previous studies that used projectionaltechniques and that were limited by the assumption that thecross-sectional areas of the vertebral bodies and the femoralshaft have a uniform shape.10,11,12 Our results also differfrom those of previous studies suggesting that the b alleleof the vitamin Dreceptor gene is associated with lowerserum osteocalcin and calcitriol concentrations6,28 but agreewith the results of other studies that found no such relation.27,33,34
The variations in bone density according to allelic status foundin this study have important implications with regard to thestructural strength of bone, and they provide guidelines foridentifying a subgroup of normal girls who may be at risk forosteoporosis later in life. However, several investigators havebeen unable to find an association between bone mass and vitaminDreceptor polymorphisms in elderly women, and othershave suggested that the association is present only before menopause.9,34,35Determination of the reasons for possible age-related changesin this association is likely to yield valuable informationregarding other factors that determine the strength of bonesin adults.
In conclusion, vitamin Dreceptor gene alleles predictthe density of the lumbar vertebrae and the femoral shaft inprepubertal American girls of Mexican descent. Careful evaluationof the genetic mechanism responsible for the differences inbone density among normal girls may provide a method for identifyinggirls who are at risk for fractures later in life.
Supported in part by grants from the National Institute of Arthritisand Musculoskeletal and Skin Diseases (R01-AR4-1853-01A1) andthe National Cancer Institute (1K11 CA61870 02).
We are indebted to Ms. Cara L. Beck for technical assistanceand comments on the manuscript.
Source Information
From the Departments of Radiology (J.S., M.L.L., V.G.) and Pediatrics (J.M.V.T., T.F.R.), Children's Hospital of Los Angeles and the University of Southern California; and the Department of Biostatistics, University of California, Los Angeles, School of Medicine (J.S.) all in Los Angeles.
Address reprint requests to Dr. Gilsanz at the Radiology Dept., Children's Hospital of Los Angeles, 4650 Sunset Blvd., M.S. 81, Los Angeles, CA 90027.
References
Riggs BL, Melton LJ III. Involutional osteoporosis. N Engl J Med 1986;14:1676-1686.
Dawson-Hughes B. Prevention. In: Riggs LB, Melton LJ III, eds. Osteoporosis: etiology, diagnosis, and management. 2nd ed. Philadelphia: Lippincott-Raven, 1995:335-50.
Seeman E, Hopper JL, Bach LA, et al. Reduced bone mass in daughters of women with osteoporosis. N Engl J Med 1989;320:554-558. [Abstract]
Christian JC, Yu PL, Slemenda CW, Johnston CC Jr. Heritability of bone mass: a longitudinal study in aging male twins. Am J Hum Genet 1989;44:429-433. [Medline]
Sambrook PN, Kelly PJ, Morrison NA, Eisman JA. Genetics of osteoporosis. Br J Rheumatol 1994;33:1007-1011. [Free Full Text]
Morrison NA, Qi JC, Tokita A, et al. Prediction of bone density from vitamin D receptor alleles. Nature 1994;367:284-287. [CrossRef][Medline]
Eisman JA. Vitamin D receptor gene alleles and osteoporosis: an affirmative view. J Bone Miner Res 1995;10:1289-1293. [Medline]
Peacock M. Vitamin D receptor gene alleles and osteoporosis: a contrasting view. J Bone Miner Res 1995;10:1294-1297. [Medline]
Cooper GS, Umbach DM. Are vitamin D receptor polymorphisms associated with bone mineral density? A meta-analysis. J Bone Miner Res 1996;11:1841-1849. [Medline]
Barger-Lux MJ, Heaney RP, Hayes J, DeLuca HF, Johnson ML, Gong G. Vitamin D receptor gene polymorphism, bone mass, body size, and vitamin D receptor density. Calcif Tissue Int 1995;57:161-162. [CrossRef][Medline]
Matkovic V. Skeletal development and bone turnover revisited. J Clin Endocrinol Metab 1996;81:2013-2016. [CrossRef][Medline]
Need AG, Horowitz M, Stiliano A, Scopacasa F, Morris HA, Chatterton BE. Vitamin D receptor genotypes are related to bone size and bone density in men. Eur J Clin Invest 1996;26:793-796. [CrossRef][Medline]
Carter DR, Brouxsein ML, Marcus R. New approaches for interpreting projected bone densitometry data. J Bone Miner Res 1992;7:137-145. [Medline]
Genant HK, Engelke K, Fuerst T, et al. Noninvasive assessment of bone mineral and structure: state of the art. J Bone Miner Res 1996;11:707-730. [Medline]
Behrman RE, Vaughan VC III, eds. Nelson textbook of pediatrics. 13th ed. Philadelphia: W.B. Saunders, 1987:24-33.
Greulich WW, Pyle SI. Radiographic atlas of skeletal development of the hand and wrist. Stanford, Calif.: Stanford University Press, 1950.
Hangartner T, Gilsanz V. Evaluation of cortical bone by computed tomography. J Bone Miner Res 1996;11:1518-1525. [Medline]
Gilsanz V, Boechat MI, Roe TF, Loro ML, Sayre JW, Goodman WG. Gender differences in vertebral body sizes in children and adolescents. Radiology 1994;190:673-677. [Free Full Text]
Dyson ED, Jackson CK, Whitehouse WJ. Scanning electron microscope studies of human trabecular bone. Nature 1970;225:957-959. [CrossRef][Medline]
Gong JK, Arnold JS, Cohn SH. Composition of trabecular and cortical bone. Anat Rec 1964;149:325-331.
Kalender WA. Effective dose values in bone mineral measurements by photon absorptiometry and computed tomography. Osteoporos Int 1992;2:82-87. [CrossRef][Medline]
Cann CE. Why, when and how to measure bone mass: a guide for the beginning user. In: Frey GD, Yester MV, eds. Expanding the role of medical physics in nuclear medicine. Colchester, Vt.: American Physics Institute, 1991:250-79.
Dixon WJ, Massey FJ Jr. Introduction to statistical analysis. 4th ed. New York: McGraw-Hill, 1983.
Terwilliger JD, Ott J. Handbook of human genetic linkage. Baltimore: Johns Hopkins University Press, 1994.
Gilsanz V, Roe TF, Mora S, Costin G, Goodman WG. Changes in vertebral bone density in black girls and white girls during childhood and puberty. N Engl J Med 1991;325:1597-1600. [Abstract]
Shohat T, Shaw SJ, Sparkes RS, Vadheim CM, Rotter JI, Zeidler A. Polymorphic gene markers in Mexican-Americans residing in southern California. Hum Hered 1995;45:150-156. [Medline]
Garnero P, Borel O, Sornay-Rendu E, Delmas PD. Vitamin D receptor gene polymorphisms do not predict bone turnover and bone mass in healthy premenopausal women. J Bone Miner Res 1995;10:1283-1288. [Medline]
Morrison NA, Yeoman R, Kelly PJ, Eisman JA. Contribution of trans-acting factor alleles to normal physiological variability: vitamin D receptor gene polymorphism and circulating osteocalcin. Proc Natl Acad Sci U S A 1992;89:6665-6669. [Free Full Text]
Hustmyer FG, Peacock M, Hui S, Johnston CC, Christian JC. Bone mineral density in relation to polymorphism at the vitamin D receptor gene locus. J Clin Invest 1994;94:2130-2134.
Bonjour J-P, Theintz G, Buchs B, Slosman D, Rizzoli R. Critical years and stages of puberty for spinal and femoral bone mass accumulation during adolescence. J Clin Endocrinol Metab 1991;73:555-563. [Abstract]
Howard G, Nguyen T, Morrison N, et al. Genetic influences on bone density: physiological correlates of vitamin D receptor gene alleles in premenopausal women. J Clin Endocrinol Metab 1995;80:2800-2805. [Abstract]
Dawson-Hughes B, Harris SS, Finneran S. Calcium absorption on high and low calcium intakes in relation to vitamin D receptor genotype. J Clin Endocrinol Metab 1995;80:3657-3661. [Abstract]
Melhus H, Kindmark A, Amér S, Wilén B, Lindh E, Ljunghall S. Vitamin D receptor genotypes in osteoporosis. Lancet 1994;344:949-950.
Fleet JC, Harris SS, Wood RJ, Dawson-Hughes B. The BsmI vitamin D receptor restriction fragment length polymorphism (BB) predicts low bone density in premenopausal black and white women. J Bone Miner Res 1995;10:985-990. [Medline]
Viitanen AM, Kärkkäinen M, Laitinen K, et al. Common polymorphism of the vitamin D receptor gene is associated with variation of peak bone mass in young Finns. Calcif Tissue Int 1996;59:231-234. [CrossRef][Medline]
Bezerra, F. F., Cabello, G. M. K., Mendonca, L. M. C., Donangelo, C. M.
(2008). Bone Mass and Breast Milk Calcium Concentration Are Associated with Vitamin D Receptor Gene Polymorphisms in Adolescent Mothers. J. Nutr.
138: 277-281
[Abstract][Full Text]
Wedren, S., Magnusson, C., Humphreys, K., Melhus, H., Kindmark, A., Stiger, F., Branting, M., Persson, I., Baron, J., Weiderpass, E.
(2007). Associations between Androgen and Vitamin D Receptor Microsatellites and Postmenopausal Breast Cancer. Cancer Epidemiol. Biomarkers Prev.
16: 1775-1783
[Abstract][Full Text]
Kishi, S., Cheng, C., French, D., Pei, D., Das, S., Cook, E. H., Hijiya, N., Rizzari, C., Rosner, G. L., Frudakis, T., Pui, C.-H., Evans, W. E., Relling, M. V.
(2007). Ancestry and pharmacogenetics of antileukemic drug toxicity. Blood
109: 4151-4157
[Abstract][Full Text]
Fang, Y., van Meurs, J. B. J., Rivadeneira, F., van Schoor, N. M., van Leeuwen, J. P. T., Lips, P., Pols, H. A. P., Uitterlinden, A. G.
(2007). Vitamin D Receptor Gene Haplotype Is Associated with Body Height and Bone Size. J. Clin. Endocrinol. Metab.
92: 1491-1501
[Abstract][Full Text]
Gilsanz, V., Wren, T.
(2007). Assessment of Bone Acquisition in Childhood and Adolescence. Pediatrics
119: S145-S149
[Abstract][Full Text]
Dempfle, A., Wudy, S. A., Saar, K., Hagemann, S., Friedel, S., Scherag, A., Berthold, L. D., Alzen, G., Gortner, L., Blum, W. F., Hinney, A., Nurnberg, P., Schafer, H., Hebebrand, J.
(2006). Evidence for involvement of the vitamin D receptor gene in idiopathic short stature via a genome-wide linkage study and subsequent association studies. Hum Mol Genet
15: 2772-2783
[Abstract][Full Text]
d'Alesio, A., Garabedian, M., Sabatier, J. P., Guaydier-Souquieres, G., Marcelli, C., Lemacon, A., Walrant-Debray, O., Jehan, F.
(2005). Two single-nucleotide polymorphisms in the human vitamin D receptor promoter change protein-DNA complex formation and are associated with height and vitamin D status in adolescent girls. Hum Mol Genet
14: 3539-3548
[Abstract][Full Text]
Yahata, T., Quan, J., Tamura, N., Nagata, H., Kurabayashi, T., Tanaka, K.
(2005). Association between single nucleotide polymorphisms of estrogen receptor {alpha} gene and efficacy of HRT on bone mineral density in post-menopausal Japanese women. Hum Reprod
20: 1860-1866
[Abstract][Full Text]
Rocha, J. C. C., Cheng, C., Liu, W., Kishi, S., Das, S., Cook, E. H., Sandlund, J. T., Rubnitz, J., Ribeiro, R., Campana, D., Pui, C.-H., Evans, W. E., Relling, M. V.
(2005). Pharmacogenetics of outcome in children with acute lymphoblastic leukemia. Blood
105: 4752-4758
[Abstract][Full Text]
Davies, J H, Evans, B A J, Gregory, J W
(2005). Bone mass acquisition in healthy children. Arch. Dis. Child.
90: 373-378
[Abstract][Full Text]
Raby, B. A., Lazarus, R., Silverman, E. K., Lake, S., Lange, C., Wjst, M., Weiss, S. T.
(2004). Association of Vitamin D Receptor Gene Polymorphisms with Childhood and Adult Asthma. Am. J. Respir. Crit. Care Med.
170: 1057-1065
[Abstract][Full Text]
Poon, A. H., Laprise, C., Lemire, M., Montpetit, A., Sinnett, D., Schurr, E., Hudson, T. J.
(2004). Association of Vitamin D Receptor Genetic Variants with Susceptibility to Asthma and Atopy. Am. J. Respir. Crit. Care Med.
170: 967-973
[Abstract][Full Text]
Specker, B.
(2004). Nutrition Influences Bone Development from Infancy through Toddler Years. J. Nutr.
134: 691S-695
[Abstract][Full Text]
Matsushita, H., Kurabayashi, T., Tomita, M., Tanaka, K.
(2004). Effects of vitamin D and estrogen receptor gene polymorphisms on the changes in lumbar bone mineral density with multiple pregnancies in Japanese women. Hum Reprod
19: 59-64
[Abstract][Full Text]
Gong, M. N., Wei, Z., Xu, L.-L., Miller, D. P., Thompson, B. T., Christiani, D. C.
(2004). Polymorphism in the Surfactant Protein-B Gene, Gender, and the Risk of Direct Pulmonary Injury and ARDS. Chest
125: 203-211
[Abstract][Full Text]
Seeman, E.
(2003). Invited Review: Pathogenesis of osteoporosis. J. Appl. Physiol.
95: 2142-2151
[Abstract][Full Text]
Palomba, S., Numis, F. G., Mossetti, G., Rendina, D., Vuotto, P., Russo, T., Zullo, F., Nappi, C., Nunziata, V.
(2003). Raloxifene administration in post-menopausal women with osteoporosis: effect of different BsmI vitamin D receptor genotypes. Hum Reprod
18: 192-198
[Abstract][Full Text]
Tortolani, P. J., McCarthy, E. F., Sponseller, P. D.
(2002). Bone Mineral Density Deficiency in Children. J Am Acad Orthop Surg
10: 57-66
[Abstract][Full Text]
Eisman, J. A.
(2001). Pharmacogenetics of the Vitamin D Receptor and Osteoporosis. Drug Metab. Dispos.
29: 505-512
[Abstract][Full Text]
Soyka, L. A., Fairfield, W. P., Klibanski, A.
(2000). Hormonal Determinants and Disorders of Peak Bone Mass in Children. J. Clin. Endocrinol. Metab.
85: 3951-3963
[Full Text]
Luiza Loro, M., Sayre, J., Roe, T. F., Goran, M. I., Kaufman, F. R., Gilsanz, V.
(2000). Early Identification of Children Predisposed to Low Peak Bone Mass and Osteoporosis Later in Life. J. Clin. Endocrinol. Metab.
85: 3908-3918
[Abstract][Full Text]
Mattano, L. A. Jr, Sather, H. N., Trigg, M. E., Nachman, J. B.
(2000). Osteonecrosis as a Complication of Treating Acute Lymphoblastic Leukemia in Children: A Report From the Children's Cancer Group. JCO
18: 3262-3272
[Abstract][Full Text]
Becherini, L., Gennari, L., Masi, L., Mansani, R., Massart, F., Morelli, A., Falchetti, A., Gonnelli, S., Fiorelli, G., Tanini, A., Brandi, M. L.
(2000). Evidence of a linkage disequilibrium between polymorphisms in the human estrogen receptor {alpha} gene and their relationship to bone mass variation in postmenopausal Italian women. Hum Mol Genet
9: 2043-2050
[Abstract][Full Text]
Nelson, D A, Vande Vord, P J, Wooley, P H
(2000). Polymorphism in the vitamin D receptor gene and bone mass in African-American and white mothers and children: a preliminary report. Ann Rheum Dis
59: 626-630
[Abstract][Full Text]
Lorentzon, M., Lorentzon, R., Nordström, P.
(2000). Vitamin D Receptor Gene Polymorphism Is Associated with Birth Height, Growth to Adolescence, and Adult Stature in Healthy Caucasian Men: A Cross-Sectional and Longitudinal Study. J. Clin. Endocrinol. Metab.
85: 1666-1671
[Abstract][Full Text]
Habuchi, T., Suzuki, T., Sasaki, R., Wang, L., Sato, K., Satoh, S., Akao, T., Tsuchiya, N., Shimoda, N., Wada, Y., Koizumi, A., Chihara, J., Ogawa, O., Kato, T.
(2000). Association of Vitamin D Receptor Gene Polymorphism with Prostate Cancer and Benign Prostatic Hyperplasia in a Japanese Population. Cancer Res.
60: 305-308
[Abstract][Full Text]
Eisman, J. A.
(1999). Genetics of Osteoporosis. Endocr. Rev.
20: 788-804
[Abstract][Full Text]
(1999). The Effects of Anorexia Nervosa on Bone Metabolism in Female Adolescents. J. Clin. Endocrinol. Metab.
84: 4489-4496
[Abstract][Full Text]
(1999). Vitamin D Supplementation during Infancy Is Associated with Higher Bone Mineral Mass in Prepubertal Girls. J. Clin. Endocrinol. Metab.
84: 4541-4544
[Abstract][Full Text]
Guardiola, J., Xiol, X., Sallie, R., Nolla, J. M., Roig-Escofet, D., Jaurrieta, E., Casais, L.
(1999). Influence of the Vitamin D Receptor Gene Polymorphism on Bone Loss in Men after Liver Transplantation. ANN INTERN MED
131: 752-755
[Abstract][Full Text]
Miller, K. K., Klibanski, A.
(1999). Amenorrheic Bone Loss. J. Clin. Endocrinol. Metab.
84: 1775-1783
[Full Text]
Ferrari, S., Manen, D., Bonjour, J.-P., Slosman, D., Rizzoli, R.
(1999). Bone Mineral Mass and Calcium and Phosphate Metabolism in Young Men: Relationships with Vitamin D Receptor Allelic Polymorphisms. J. Clin. Endocrinol. Metab.
84: 2043-2048
[Abstract][Full Text]
Sainz, J., Van Tornout, J. M., Sayre, J., Kaufman, F., Gilsanz, V.
(1999). Association of Collagen Type 1 {alpha}1 Gene Polymorphism with Bone Density in Early Childhood. J. Clin. Endocrinol. Metab.
84: 853-855
[Abstract][Full Text]
Abrams, S. A., Copeland, K. C., Gunn, S. K., Stuff, J. E., Clarke, L. L., Ellis, K. J.
(1999). Calcium Absorption and Kinetics Are Similar in 7- and 8-Year-Old Mexican-American and Caucasian Girls Despite Hormonal Differences. J. Nutr.
129: 666-671
[Abstract][Full Text]
Tao, C., Yu, T., Garnett, S., Briody, J., Knight, J., Woodhead, H., Cowell;, C. T, MUGHAL, Z.
(1998). Vitamin D receptor alleles predict growth and bone density in girls • Commentary. Arch. Dis. Child.
79: 488-494
[Abstract][Full Text]
Suarez, F., Rossignol, C., Garabédian, M.
(1998). Interactive Effect of Estradiol and Vitamin D Receptor Gene Polymorphisms as a Possible Determinant of Growth in Male and Female Infants. J. Clin. Endocrinol. Metab.
83: 3563-3568
[Abstract][Full Text]
Riggs, B. L.
(1997). Vitamin D-Receptor Genotypes and Bone Density. NEJM
337: 125-126
[Full Text]