Background Atopic diseases are very common, and atopy has astrong genetic predisposition.
Methods Using single-strand conformation polymorphism analysisand DNA sequencing, we searched for mutations in the subunitof the interleukin-4 receptor that would predispose personsto atopy. We examined the prevalence of the alleles among patientswith allergic inflammatory disorders and among 50 prospectivelyrecruited adults. Subjects with atopy were identified on thebasis of an elevated serum lgE level (>95 IU per milliliter)or a positive radioimmunosorbent test in response to standardinhalant allergens. The signaling function of mutant interleukin-4receptor was examined by flow cytometry, binding assays, andimmunoblotting.
Results A novel interleukin-4 receptor allele was identifiedin which guanine was substituted for adenine at nucleotide 1902,causing a change from glutamine to arginine at position 576(R576) in the cytoplasmic domain of the interleukin-4 receptor protein. The R576 allele was common among patients with allergicinflammatory disorders (found in 3 of 3 patients with the hyper-IgEsyndrome and 4 of 7 patients with severe atopic dermatitis)and among the 50 prospectively recruited adults (found in 13of 20 subjects with atopy and 5 of 30 without atopy; P = 0.001;relative risk of atopy among those with a mutant allele, 9.3).The R576 allele was associated with higher levels of expressionof CD23 by interleukin-4 than the wild-type allele. This enhancedsignaling was associated with a change in the binding specificityof the adjacent tyrosine residue at position 575 to signal-transducingmolecules.
Conclusions The R576 allele of interleukin-4 receptor is stronglyassociated with atopy. This mutation may predispose personsto allergic diseases by altering the signaling function of thereceptor.
Atopy is characterized by the formation of IgE antibody in personswith a genetic predisposition, who respond with immediate hypersensitivityon exposure to specific allergens. Atopy is common, affectingup to 40 percent of populations of Western societies,1,2,3 andit underlies the development of allergic diseases in susceptiblepersons. Although environmental factors such as exposure toantigens have an important role in the development of allergicdiseases,4,5,6 there is a strong genetic predisposition.7,8Recently, a number of atopy susceptibility genes have been identified.Some of these, such as those for interleukin-49,10,11 and severalHLA class II molecules,8,12,13 regulate the production of IgE,whereas others, such as FcRI,14 mediate IgE effector functions.
The production of IgE is initiated by the interaction of antigen-presentingB cells with antigen-specific type 2 T helper cells.15 Cytokinessecreted by type 2 T helper cells, including interleukin-4 andinterleukin-13, act at their respective receptors to activategerm-line transcription from the epsilon heavy-chain gene locusand, together with signals delivered by the B-cellsurfacemolecule CD40, induce isotype switching from mu to epsilon.16The interleukin-4 receptor is composed of two subunits: a 140-kd subunit, which binds interleukin-4 and transduces its growth-promotingand transcription-activating functions,17,18 and a c subunit,common to several cytokine receptors, which amplifies signalingof interleukin-4 receptor .19,20,21 There is evidence to suggestthat interleukin-4 receptor is also a component of the interleukin-13receptor.22
The central part played by interleukin-4 receptor in regulatingthe production of IgE prompted us to investigate whether itis targeted by gain-of-function mutations or deletions thatwould enhance receptor signaling and hence precipitate atopy.
Methods
Study Subjects
The hyper-IgE syndrome and severe atopic dermatitis were diagnosedin three and seven patients, respectively, according to standardcriteria.23,24,25 Patients with severe atopic dermatitis hadchronic inflammation affecting 20 percent or more of their skinarea and recurrent superficial infections. Fifty healthy, unrelatedadults were prospectively recruited among employees of medicalcenters affiliated with Washington University School of Medicine.The single exclusion criterion was a history of immunotherapy,which may influence the results of tests used to identify subjectswith atopy. Subjects were designated as having atopy on thebasis of in vitro correlates of immediate hypersensitivity:an elevated serum IgE level (>95 IU per milliliter) or apositive radioimmunosorbent test (score, >3+) in responseto one or more of the following inhalant allergens: the commonmold Alternaria alternata, the house-dust mite Dermatophagoidespteronyssinus, and cat dander.26 The IgE assays and radioimmunosorbenttest were performed with kits purchased from Pharmacia Diagnostics(Columbus, Ohio). Informed consent was obtained from all adultparticipants in these studies and, in the case of children,from parents or legal guardians.
Cell Lines
Isolation of peripheral-blood mononuclear cells and derivationof B-cell lines transformed by EpsteinBarr virus (EBV)were carried out according to standard methods. The EBV-negativeBurkitt's lymphoma cell line BJAB was a kind gift of Dr. ElliottKieff (Harvard Medical School, Boston). Cells were culturedin RPMI medium supplemented with 10 percent fetal bovine serumand maintained at 37°C in an atmosphere of 5 percent carbondioxide.
Single-Strand Conformation Polymorphism Analysis and Sequencing
Complementary DNA (cDNA) was derived from EBV-transformed celllines or peripheral-blood mononuclear cells and analyzed bysingle-strand conformation polymorphism (SSCP) as previouslydescribed27 with synthetic primers (Integrated DNA Technologies,Coralville, Iowa). A nested polymerase chain reaction (PCR)was used to amplify nucleotides 1840 to 2125 of interleukin-4receptor cDNA, with 5'GCCCACACTGGAAGAATTGTCTTAC'3 (sense) and5'TTTTGGGGGTCTGGCTTGAG3' (antisense) as the outer primer pairand 5'CCGAAATGTCCTCCAGCATG3' (sense) and 5'CCAGTCCAAAGGTGAACAAGGGG(antisense) as the inner primer pair. Direct PCR sequencingwas done with the fmol sequencing system from Promega (Madison,Wis.).
Peptide Conjugation, Binding Assays, and Immunoblotting
The following synthetic peptides corresponding to the sequencesflanking amino acids Y575 and Y603 of interleukin-4 receptor were used: wild-type unphosphorylated Y575 (NH2-SAPTSGYQEFVHAVE-COOH),wild-type phosphorylated Y575 (NH2-SAPTSG(pY)QEFVHAVE-COOH),mutant phosphorylated Y575 (NH2-SAPTSG(pY)REFVHAVE-COOH), andphosphorylated Y603 (high-affinity Stat-6 site; NH2-SSGEEG(pY)-KPFQDLIP-COOH)(all from Quality Controlled Biochemicals, Hopkinton, Mass.).The peptides were coupled to Affigel 10 beads (BioRad Laboratories,Hercules, Calif.) at a ratio of 3 mg of peptide per milliliterof beads.
To assess the binding of cellular proteins to synthetic interleukin-4receptor peptides, 20 µl of peptide-conjugated beadswas incubated with BJAB-cell lysates (2x107 cells) and thenanalyzed for the presence of peptide-associated Stat-6 or SHP-1by immunoblotting with specific antiserum.28 Rabbit antihumanStat-6 antiserum was purchased from Santa Cruz Biotechnology(Santa Cruz, Calif.); the rabbit antiSHP-1 antiserumhas been described previously.29 To assess the binding of recombinantSHP-1 protein fragment (positions 1 to 219)29 to interleukin-4receptor peptides, 100 ng of this fragment was incubated withthe indicated peptide-conjugated beads, and bound protein wasdetected by immunoblotting.
Flow-Cytometric Analysis of the Expression of CD23
Peripheral-blood mononuclear cells were cultured for 48 hoursin the presence of 33 ng of recombinant human interleukin-4per milliliter (R & D Systems, Minneapolis) and in its absence,and the cells were then stained with fluorescein isothiocyanateconjugatedmurine antihuman CD23 monoclonal antibody (Coulter Immunology,Hialeah, Fla.). Monocytic cells present in the respective samplesof peripheral-blood mononuclear cells were identified by flowcytometry on the basis of forward-scatter and side-scatter characteristicsand analyzed for the expression of CD23.
Statistical Analysis
The data were analyzed by the two-tailed version of Fisher'sexact test with Primer of Biostatistics software for Apple Macintosh.30
Results
Identification of an Interleukin-4 Receptor Allele That Segregates with Atopy
There are phenotypic similarities between patients with thehyper-IgE syndrome and interleukin-4 transgenic mice, includingvery high IgE levels, allergic inflammation, and osteoporosis.31,32,33However, the patients have normal or decreased production ofinterleukin-4 in vitro,34,35 suggesting the presence of mutationsthat affect the function of interleukin-4 receptor .
We screened the full-length interleukin-4 receptor cDNA ofthree patients with the hyper-IgE syndrome for mutations bySSCP analysis of sequential cDNA segments spanning about 300bp each. All three patients had an identical alteration (ascompared with controls) in the SSCP profile of one cDNA segment,spanning nucleotides 1840 to 2125 (Figure 1A). This SSCP profileis consistent with a heterozygous configuration and predictsthe presence of a point mutation or a small deletion in theaffected allele. The affected cDNA segment was amplified byPCR and subjected to direct PCR sequencing, a method that allowsthe sequences of both alleles to be visualized simultaneously.The results of sequence analysis of cDNA of one patient withthe hyper-IgE syndrome and one control subject are shown inFigure 1B: the patient has a missense mutation in which guanineis substituted for adenine at nucleotide 1902 (according tothe interleukin-4 receptor nucleotide sequence of Idzerda etal.17), causing a change from glutamine to arginine residueat position 576 (R576) of the protein (including the signalpeptide).17,18 The sequence from the patient had both wild-typeand mutant nucleotides, confirming the presence of heterozygosity.The same substitution was also found in the two other patientswith hyper-IgE syndrome (data not shown). Analysis of the parentsof these patients revealed that the R576 allele was inheritedin a classic mendelian fashion (data not shown).
Figure 1. Identification of a Mutant Interleukin-4 Receptor Allele.
Panel A shows the results of SSCP analysis of a fragment of interleukin-4 receptor cDNA spanning nucleotides 1840 to 2125 in three patients with hyper-IgE syndrome (lanes 1, 3, and 5) and three controls (lanes 2, 4, and 6). The mutant allele manifests as an extra band in the samples from the patients (arrow). Panel B shows a missense mutation identified at position 1902 of the interleukin-4 receptor cDNA sequence. Direct PCR sequencing of cDNA of one patient with the hyper-IgE syndrome reveals both adenine and guanine at nucleotide 1902 (arrow), a finding consistent with the presence of one wild-type and one mutant allele. Only adenine is present at the equivalent position in a cDNA sequence from a control subject (arrow).
The phenotype of the hyper-IgE syndrome overlaps that of severeatopic dermatitis, in that both are characterized by allergicinflammatory skin disease and high IgE levels. We thereforeexamined seven patients with severe atopic dermatitis for thepresence of the mutant interleukin-4 receptor allele. Threewere found to be heterozygous and one was homozygous for theR576 allele, indicating that this allele is not restricted topatients with the hyper-IgE syndrome but may also involve patientswith different allergic inflammatory conditions (Table 1).
Table 1. Frequency of Interleukin-4 Receptor a Alleles in Subjects with Atopy and Those without Atopy.
To establish the relation of the R576 allele with atopy, westudied their cosegregation in a prospectively chosen sampleof 50 unrelated adults (100 chromosomes). Subjects with atopywere identified on the basis of the presence of an elevatedserum IgE level or evidence of a specific IgE antibody responseto one or more of the following allergens: A. alternata, D.pteronyssinus, and cat dander. Twenty subjects were identifiedas atopic, representing a percentage of the study group 40 percent that is in agreement with published reportsof the prevalence of atopy in large populations.1,2,3 Amongthe 20 subjects with atopy, 13 had the R576 allele, as comparedwith only 5 of the 30 subjects without atopy (P = 0.001) (Table 1).The presence of the R576 allele carried a calculated relativerisk of atopy of 9.3. The overall allelic frequency of R576in the population of 100 chromosomes was 20 percent (35 percentin the group with atopy and 10 percent in the group withoutatopy, P = 0.004). Overall, these results suggested a strongassociation of the R576 allele with atopy.
Association of the R576 Allele with Enhanced Responsiveness to Interleukin-4
We investigated the molecular basis of the association of theQ576R substitution with atopy by examining the signaling functionsof the wild-type and mutant interleukin-4 receptor alleles.Binding of interleukin-4 to its receptor induces the expressionof the low-affinity IgE receptor (CD23) on B cells, monocytes,and macrophages.36 We therefore used flow cytometry to assessthe capacities of wild-type and mutant alleles to mediate theinduction by interleukin-4 of the expression of CD23 in peripheral-bloodmononuclear cells. Interleukin-4 induced higher levels of CD23expression (by a mean [±SE] factor of 2.17±0.14)in peripheral-blood mononuclear cells from R576 heterozygotesthan from wild-type homozygotes (six subjects) (Figure 2). Thelevel of expression of CD23 was also higher in peripheral-bloodmononuclear cells from R576 homozygotes (by a mean factor of3.07±0.62) than from wild-type homozygotes (two subjects).Enhanced expression of CD23 was noted in R576-positive cellsfrom both subjects with atopy and those without atopy, and itwas not due to the presence of higher levels of the mutant allele,as determined by flow cytometry (data not shown). These resultssuggest that the signaling function of the R576 allele is greaterthan that of the wild-type allele.
Figure 2. Effect of the R576 Allele on the Expression of CD23.
Peripheral-blood mononuclear cells homozygous for the wild-type Q576 allele (dotted line), heterozygous for R576 (thin line), or homozygous for R576 (thick line) were incubated in the absence and in the presence of interleukin-4 and then examined for the expression of CD23 with flow cytometry.
Association of SHP-1 with Interleukin-4 Receptor Alleles
Position 575 is occupied by a tyrosine residue (Y575) that onphosphorylation recruits phosphotyrosine-binding effector molecules.37This suggested that the substitution of R for Q at position576 may influence the interaction of phosphorylated Y575 withsignaling intermediates.
We focused on the effect of the Q576R mutation on the bindingto phosphorylated Y575 of two molecules implicated in interleukin-4receptor signaling: Stat-6,38 a transcription factor that mediatesgene induction by interleukin-4, and SHP-1,39 a phosphotyrosinephosphatase involved in signal termination by means of cytokinereceptors, including interleukin-4 receptor.40,41,42,43,44,45Binding assays were performed in which synthetic peptides spanningphosphorylated Y575 and harboring either the wild-type or mutant576 residue were incubated with lysates of BJAB, a Burkitt'slymphoma B-cell line, which contain both Stat-6 and SHP-1. Awild-type peptide with an unphosphorylated Y575 residue wasused as a negative control, and a phosphotyrosyl peptide spanningthe interleukin-4 receptor high-affinity Stat-6bindingsite at position Y603 was used as a positive control.38 Bindingof Stat-6 was similar with the wild-type and mutant phosphorylatedY575 peptides (Figure 3A, lanes 2 and 3, respectively). Thephosphorylated Y603 peptide (lane 4 in Figure 3A) precipitatedlevels of Stat-6 that were twice as high as those precipitatedby the wild-type and mutant phosphorylated Y575 peptides, inagreement with the fact that Stat-6 has a higher affinity forphosphorylated Y603 than phosphorylated Y575.38 In contrast,virtually no Stat-6 was precipitated by the unphosphorylatedwild-type Y575 peptide (lane 1 in Figure 3A), which is consistentwith the requirement for phosphotyrosine residues for Stat-6binding.
Figure 3. Association of SHP-1 with Allelic Y575 Phosphopeptides.
In Panel A, lysates of BJAB cells were incubated with the following agarose-coupled synthetic peptides: wild-type unphosphorylated Y575 (lane 1), wild-type phosphorylated Y575 (lane 2), mutant phosphorylated Y575 (lane 3), and phosphorylated Y603 (lane 4). Bound proteins were detected by immunoblotting with antibodies to Stat-6 or SHP-1. Panel B shows the results of densitometric analysis of SHP-1 binding in four independent experiments. Values are means +SE relative to wild-type unphosphorylated Y575, which was assigned an arbitrary value of 1.
In contrast to Stat-6, SHP-1 bound much better to the wild-typephosphorylated Y575 peptide than to the mutant peptide (Figure 3A,lanes 2 and 3, respectively). Densitometric analysis revealedthat wild-type phosphorylated Y575 peptide bound approximatelytwice as much SHP-1 as the mutant phosphorylated peptide (Figure 3Aand Figure 3B). Wild-type unphosphorylated Y575 and phosphorylatedY603 peptides were ineffective binders (Figure 3A, lanes 1 and4, respectively), which is consistent with the specificity ofSHP-1 for phosphorylated Y575.
To determine whether SHP-1 associates with phosphorylated Y575directly, we used a purified recombinant protein fragment ofSHP-1, which corresponds to amino acids 1 to 219 of the nativeprotein and contains the two SH2 domains of SHP-1. As shownin Figure 4, the recombinant protein fragment selectively boundto the wild-type phosphorylated Y575 peptide (lane 3), a findingconsistent with the occurrence of direct binding, but it boundonly minimally to the mutant phosphorylated Y575 (lane 4), wild-typeunphosphorylated Y575 (lane 2), and phosphorylated Y603 peptides(lane 5).
Figure 4. Binding of a Recombinant SHP-1 Fragment to Allelic Y575 Phosphopeptides.
In this experiment, 100 ng of recombinant SHP-1 protein fragment was incubated with the following agarose-coupled synthetic peptides: wild-type unphosphorylated Y575 (lane 2), wild-type phosphorylated Y575 (lane 3), mutant phosphorylated Y575 (lane 4), and phosphorylated Y603 (lane 5). The bound protein was visualized by immunoblotting with antibodies to SHP-1. In lane 1, 100 ng of recombinant SHP-1 was used as a positive control.
Discussion
We found that an allele for the subunit of the interleukin-4receptor segregates with atopy. The interleukin-4 receptor allele that we identified contains an arginine in lieu of aglutamine at position 576. This allele was common in patientswith the hyper-IgE syndrome and severe atopic dermatitis aswell as in prospectively recruited adults with atopy. It isinherited in a classic mendelian fashion and appears to be widespread,suggesting that it may contribute to the pathogenesis of a varietyof allergic diseases.
A majority of subjects identified as carrying a single copyof the mutant allele were found to have atopy, suggesting adominant effect. However, the finding that some carriers ofthe R576 allele, including one who was homozygous, were notatopic indicates that the penetrance of this allele may be modifiedby other factors. These may include distinct genetic loci thatimpart susceptibility to or protection from atopy and environmentalfactors such as the level and duration of exposure to allergens.4,5,6
The Q576R mutation is associated with enhanced signaling ofinterleukin-4 receptor, an effect that may underlie the predispositionof this allele to atopy. The substitution of arginine for glutamineat position 576 alters the binding profile of the adjacent phosphorylatedtyrosine residue, as is evidenced by the decreased binding ofthe phosphotyrosine phosphatase SHP-1 in the presence of themutation. SHP-1 dephosphorylates regulatory phosphotyrosineresidues and has been implicated in termination of signalingby means of cytokine receptors.40,41,42,43,46 In the case ofthe interleukin-4 receptor signaling pathway, candidate intermediatemolecules that may be regulated by SHP-1 include Stat-6, Janusprotein kinases (Jak), and phosphatidylinositol 3-kinase.44
Decreased binding of SHP-1 to phosphorylated Y575 may be causallyrelated to the altered signaling function of the mutant allele.A precedent for a disease resulting from the failure of receptorregulation by SHP-1 is familial erythrocytosis. Patients withthis disorder have deletions in the carboxy-terminal segmentof the cytoplasmic domain of the erythropoietin receptor.47,48The deleted sequence contains binding sites for SHP-1, and theresultant lack of SHP-1 regulation results in exaggerated receptorsignaling.41
It should be emphasized that although decreased binding of SHP-1to phosphorylated Y575 may provide an explanation for the associationof the R576 allele with atopy, other mechanisms may be involved.These include alteration in the binding to phosphorylated Y575of other, as yet unidentified, signaling intermediates, leadingto exaggerated signaling. We also cannot rule out the presencein the interleukin-4 receptor gene of additional mutations,not detected by our screening, that predispose persons to atopyeither independently of or in synergy with the Q576R mutation.Lastly, the R576 allele may segregate with a mutation in anothermolecule, such as a signaling intermediate, which fosters atopy.Discrimination between these alternative mechanisms will requirefurther investigation.
Supported in part by a grant from the MonsantoSearle/WashingtonUniversity Biomedical Program (to Dr. Chatila) and a grant fromthe Howard Hughes Medical Institute through the UndergraduateBiological Sciences Education Program (to Ms. Friedrich). Dr.Hershey is the recipient of an Allergy Training Award from GlaxoWellcome. Dr. Esswein is the recipient of a Fellowship Awardfrom the Immune Deficiency Foundation.
We are indebted to Harvey Colten, Jonathan Gitlin, Helen Donis-Keller,and Emil Unanue for discussions; to Susan Mallory for referralof patients; and to Nga Ho, Sharon Bader, and Praveen Chandfor assistance.
Source Information
From the Departments of Pediatrics (G.K.K.H., M.F.F., L.A.E., T.A.C.) and Pathology (M.L.T., T.A.C.), Howard Hughes Medical Institute (M.L.T.), and the Center for Immunology (M.L.T., T.A.C.), Washington University School of Medicine, St. Louis.
Address reprint requests to Dr. Chatila at the Division of ImmunologyRheumatology, Department of Pediatrics, Washington University School of Medicine, 1 Children's Pl., St. Louis, MO 63110.
References
Holford-Strevens V, Warren P, Wong C, Manfreda J. Serum total immunoglobulin E levels in Canadian adults. J Allergy Clin Immunol 1984;73:516-522. [CrossRef][Medline]
Peat JK, Britton WJ, Salome CM, Woolcock AJ. Bronchial hyperresponsiveness in two populations of Australian schoolchildren. III. Effect of exposure to environmental allergens. Clin Allergy 1987;17:291-300. [CrossRef][Medline]
Cline MG, Burrows B. Distribution of allergy in a population sample residing in Tucson, Arizona. Thorax 1989;44:425-431. [Free Full Text]
Sporik R, Holgate ST, Platts-Mills TAE, Cogswell JJ. Exposure to house-dust mite allergen (Der p I) and the development of asthma in childhood: a prospective study. N Engl J Med 1990;323:502-507. [Abstract]
Young RP, Hart BJ, Merrett TG, Read AF, Hopkin JM. House dust mite sensitivity: interaction of genetics and allergen dosage. Clin Exp Allergy 1992;22:205-211. [CrossRef][Medline]
Peat JK, Tovey E, Toelle BG, et al. House dust mite allergens: a major risk factor for childhood asthma in Australia. Am J Respir Crit Care Med 1996;153:141-146. [Abstract]
Zeiger RS. Development and prevention of allergic disease in childhood. In: Middleton E Jr, Reed CE, Ellis EF, Adkinson NF Jr, Yunginger JW, Busse WW, eds. Allergy: principles and practice. 4th ed. Vol. 2. St. Louis: MosbyYear Book, 1993:1137-71.
Huang SK, Marsh DG. Genetics of allergy. Ann Allergy 1993;70:347-358. [Medline]
Meyers DA, Postma DS, Panhuysen CIM, et al. Evidence for a locus regulating total serum IgE levels mapping to chromosome 5. Genomics 1994;23:464-470. [CrossRef][Medline]
Marsh DG, Neely JD, Breazeale DR, et al. Linkage analysis of IL4 and chromosome 5q31.1 markers and total serum immunoglobulin E concentrations. Science 1994;264:1152-1156. [Free Full Text]
Postma DS, Bleecker ER, Amelung PJ, et al. Genetic susceptibility to asthma -- bronchial hyperresponsiveness coinherited with a major gene for atopy. N Engl J Med 1995;333:894-900. [Free Full Text]
Marsh DG, Hsu SH, Roebber M, et al. HLA-Dw2: a genetic marker for human immune response to short ragweed pollen allergen Ra5. I. Response resulting primarily from natural antigenic exposure. J Exp Med 1982;155:1439-1451. [Free Full Text]
Young RP, Dekker JW, Wordsworth BP, et al. HLA-DR and HLA-DP genotypes and immunoglobulin E responses to common major allergens. Clin Exp Allergy 1994;24:431-439. [CrossRef][Medline]
Shirakawa T, Li A, Dubowitz M, et al. Association between atopy and variants of the beta subunit of the high-affinity immunoglobulin E receptor. Nat Genet 1994;7:125-129. [CrossRef][Medline]
Bonnefoy JY, Gauchat JF, Lecoanet-Henchoz S, Graber P, Aubry JP. Regulation of human IgE synthesis. Ann N Y Acad Sci 1996;796:59-71. [CrossRef][Medline]
Stavnezer J. Antibody class switching. Adv Immunol 1996;61:79-146. [Medline]
Idzerda RL, March CJ, Mosley B, et al. Human interleukin 4 receptor confers biological responsiveness and defines a novel receptor superfamily. J Exp Med 1990;171:861-873. [Free Full Text]
Galizzi JP, Zuber CE, Harada N, et al. Molecular cloning of a cDNA encoding the human interleukin 4 receptor. Int Immunol 1990;2:669-675. [Free Full Text]
Kondo M, Takeshita T, Ishii N, et al. Sharing of the interleukin-2 (IL-2) receptor gamma chain between receptors for IL-2 and IL-4. Science 1993;262:1874-1877. [Free Full Text]
Russell SM, Keegan AD, Harada N, et al. Interleukin-2 receptor gamma chain: a functional component of the interleukin-4 receptor. Science 1993;262:1880-1883. [Free Full Text]
Oakes SA, Candotti F, Johnston JA, et al. Signaling via IL-2 and IL-4 in JAK3-deficient severe combined immunodeficiency lymphocytes: JAK3-dependent and independent pathways. Immunity 1996;5:605-615. [CrossRef][Medline]
Aman MJ, Tayebi N, Obiri NI, Puri RK, Modi WS, Leonard WJ. cDNA cloning and characterization of the human interleukin 13 receptor alpha chain. J Biol Chem 1996;271:29265-29270. [Free Full Text]
Buckley RH. Disorders of the IgE system. In: Stiehm ER, ed. Immunologic disorders in infants & children. 4th ed. Philadelphia: W.B. Saunders, 1996:409-22.
Hanifin JM, Rajka G. Diagnostic features of atopic dermatitis. Acta Derm Venereol Suppl 1980;92:44-7.
Cookson WOCM, Hopkin JM. Dominant inheritance of atopic immunoglobulin-E responsiveness. Lancet 1988;1:86-88. [Medline]
Donis-Keller H, Dou S, Chi D, et al. Mutations in the RET proto-oncogene are associated with MEN 2A and FMTC. Hum Mol Genet 1993;2:851-856. [Free Full Text]
Migone TS, Lin JX, Cereseto A, et al. Constitutively activated Jak-STAT pathway in T cells transformed with HTLV-I. Science 1995;269:79-81. [Free Full Text]
Plas DR, Johnson R, Pingel JT, et al. Direct regulation of ZAP-70 by SHP-1 in T cell antigen receptor signaling. Science 1996;272:1173-1176. [Abstract]
Glantz SA. Primer of biostatistics. 4th ed. New York: McGraw-Hill, 1997.
Kirchner SG, Sivit CJ, Wright PF. Hyperimmunoglobulinemia E syndrome: association with osteoporosis and recurrent fractures. Radiology 1985;156:362-362. [Free Full Text]
Tepper RI, Levinson DA, Stanger BZ, Campos-Torres J, Abbas AK, Leder P. IL-4 induces allergic-like inflammatory disease and alters T cell development in transgenic mice. Cell 1990;62:457-467. [CrossRef][Medline]
Lewis DB, Liggitt HD, Effmann EL, et al. Osteoporosis induced in mice by overproduction of interleukin 4. Proc Natl Acad Sci U S A 1993;90:11618-11622. [Free Full Text]
Vercelli D, Jabara HH, Cunningham-Rundles C, et al. Regulation of immunoglobulin (Ig)E synthesis in the hyper-IgE syndrome. J Clin Invest 1990;85:1666-1671.
Ishizaka A, Joh K, Shibata R, et al. Regulation of IgE and IgG4 synthesis in patients with hyper IgE syndrome. Immunology 1990;70:414-416. [Medline]
Defrance T, Aubry JP, Rousset F, et al. Human recombinant interleukin 4 induces Fc epsilon receptors (CD23) on normal human B lymphocytes. J Exp Med 1987;165:1459-1467. [Free Full Text]
Ryan JJ, McReynolds LJ, Keegan A, et al. Growth and gene expression are predominantly controlled by distinct regions of the human IL-4 receptor. Immunity 1996;4:123-132. [CrossRef][Medline]
Hou J, Schindler U, Henzel WJ, Ho TC, Brasseur M, McKnight SL. An interleukin-4-induced transcription factor: IL-4 Stat. Science 1994;265:1701-1706. [Free Full Text]
Matthews RJ, Bowne DB, Flores E, Thomas ML. Characterization of hematopoietic intracellular protein tyrosine phosphatases: description of a phosphatase containing an SH2 domain and another enriched in proline-, glutamic acid-, serine-, and threonine-rich sequences. Mol Cell Biol 1992;12:2396-2405. [Free Full Text]
Yi T, Mui AL, Krystal G, Ihle JN. Hematopoietic cell phosphatase associates with the interleukin-3 (IL-3) receptor beta chain and down-regulates IL-3-induced tyrosine phosphorylation and mitogenesis. Mol Cell Biol 1993;13:7577-7586. [Free Full Text]
Klingmuller U, Lorenz U, Cantley LC, Neel BG, Lodish HF. Specific recruitment of SH-PTP1 to the erythropoietin receptor causes inactivation of JAK2 and termination of proliferative signals. Cell 1995;80:729-738. [CrossRef][Medline]
Chen HE, Chang S, Trub T, Neel BG. Regulation of colony-stimulating factor 1 receptor signaling by the SH2 domain-containing tyrosine phosphatase SHPTP1. Mol Cell Biol 1996;16:3685-3697. [Abstract]
Paulson RF, Vesely S, Siminovitch KA, Bernstein A. Signalling by the W/Kit receptor tyrosine kinase is negatively regulated in vivo by the protein tyrosine phosphatase Shp1. Nat Genet 1996;13:309-315. [CrossRef][Medline]
Imani F, Rager KJ, Catipovic B, Marsh DG. Interleukin-4 (IL-4) induces phosphatidylinositol 3-kinase (p85) dephosphorylation: implications for the role of SHP-1 in the IL-4-induced signals in human B cells. J Biol Chem 1997;272:7927-7931. [Free Full Text]
Yetter A, Uddin S, Krolewski JJ, Jiao H, Yi T, Platanias LC. Association of the interferon-dependent tyrosine kinase Tyk-2 with the hematopoietic cell phosphatase. J Biol Chem 1995;270:18179-18182. [Free Full Text]
Gelderloos JA, Anderson SM. Over-expression of protein tyrosine phosphatase 1 (PTP1) alters IL-3-dependent growth and tyrosine phosphorylation. Oncogene 1996;13:2367-2378. [Medline]
de la Chapelle A, Traskelin AL, Juvonen E. Truncated erythropoietin receptor causes dominantly inherited benign human erythrocytosis. Proc Natl Acad Sci U S A 1993;90:4495-4499. [Free Full Text]
Sokol L, Luhovy M, Guan Y, Prchal JF, Semenza GL, Prchal JT. Primary familial polycythemia: a frameshift mutation in the erythropoietin receptor gene and increased sensitivity of erythroid progenitors to erythropoietin. Blood 1995;86:15-22. [Free Full Text]
AcidBase Disorders
Marik P., Varon J., Rao R. B., Hoffman R. S., Skorecki K., Bistrian B. R., McCowen K. C., Driscoll D., Adrogué H. J., Madias N. E.
Extract |
Full Text
N Engl J Med 1998;
338:1626-1629, May 28, 1998.
Correspondence
Tachdjian, R., Mathias, C., Al Khatib, S., Bryce, P. J., Kim, H. S., Blaeser, F., O'Connor, B. D., Rzymkiewicz, D., Chen, A., Holtzman, M. J., Hershey, G. K., Garn, H., Harb, H., Renz, H., Oettgen, H. C., Chatila, T. A.
(2009). Pathogenicity of a disease-associated human IL-4 receptor allele in experimental asthma. JEM
206: 2191-2204
[Abstract][Full Text]
Ford, A. Q., Heller, N. M., Stephenson, L., Boothby, M. R., Keegan, A. D.
(2009). An Atopy-Associated Polymorphism in the Ectodomain of the IL-4R{alpha} Chain (V50) Regulates the Persistence of STAT6 Phosphorylation. J. Immunol.
183: 1607-1616
[Abstract][Full Text]
Pillemer, B. B. L., Qi, Z., Melgert, B., Oriss, T. B., Ray, P., Ray, A.
(2009). STAT6 Activation Confers upon T Helper Cells Resistance to Suppression by Regulatory T Cells. J. Immunol.
183: 155-163
[Abstract][Full Text]
Speiran, K., Bailey, D. P., Fernando, J., Macey, M., Barnstein, B., Kolawole, M., Curley, D., Watowich, S. S., Murray, P. J., Oskeritzian, C., Ryan, J. J.
(2009). Endogenous suppression of mast cell development and survival by IL-4 and IL-10. J. Leukoc. Biol.
85: 826-836
[Abstract][Full Text]
Oh, S. Y., Zheng, T., Kim, Y.-K., Cohn, L., Homer, R. J., McKenzie, A. N. J., Zhu, Z.
(2009). A Critical Role of SHP-1 in Regulation of Type 2 Inflammation in the Lung. Am. J. Respir. Cell Mol. Bio.
40: 568-574
[Abstract][Full Text]
Wills-Karp, M., Finkelman, F. D.
(2008). Untangling the Complex Web of IL-4- and IL-13-Mediated Signaling Pathways. Sci Signal
1: pe55-pe55
[Abstract][Full Text]
Zhu, J., Paul, W. E.
(2008). CD4 T cells: fates, functions, and faults. Blood
112: 1557-1569
[Abstract][Full Text]
Ueta, M., Sotozono, C., Inatomi, T., Kojima, K., Hamuro, J., Kinoshita, S.
(2008). Association of Combined IL-13/IL-4R Signaling Pathway Gene Polymorphism with Stevens-Johnson Syndrome Accompanied by Ocular Surface Complications. IOVS
49: 1809-1813
[Abstract][Full Text]
Yang, H., Gu, J., Lin, X., Grossman, H. B., Ye, Y., Dinney, C. P., Wu, X.
(2008). Profiling of Genetic Variations in Inflammation Pathway Genes in Relation to Bladder Cancer Predisposition. Clin. Cancer Res.
14: 2236-2244
[Abstract][Full Text]
Scirica, C. V., Celedon, J. C.
(2007). Genetics of Asthma: Potential Implications for Reducing Asthma Disparities. Chest
132: 770S-781S
[Abstract][Full Text]
Wenzel, S. E., Balzar, S., Ampleford, E., Hawkins, G. A., Busse, W. W., Calhoun, W. J., Castro, M., Chung, K. F., Erzurum, S., Gaston, B., Israel, E., Teague, W. G., Curran-Everett, D., Meyers, D. A., Bleecker, E. R.
(2007). IL4R{alpha} Mutations Are Associated with Asthma Exacerbations and Mast Cell/IgE Expression. Am. J. Respir. Crit. Care Med.
175: 570-576
[Abstract][Full Text]
Park, H.-W., Shin, E.-S., Lee, J.-E., Kwon, H.-S., Chun, E., Kim, S.-S., Chang, Y.-S., Kim, Y.-K., Min, K.-U., Kim, Y.-Y., Cho, S.-H.
(2007). Multilocus analysis of atopy in Korean children using multifactor-dimensionality reduction. Thorax
62: 265-269
[Abstract][Full Text]
Shiroiwa, W., Tsukamoto, K., Ohtsuji, M., Lin, Q., Ida, A., Kodera, S., Ohtsuji, N., Nakamura, K., Tsurui, H., Kinoshita, K., Nishimura, H., Shirai, T., Hirose, S.
(2007). IL-4R{alpha} polymorphism in regulation of IL-4 synthesis by T cells: implication in susceptibility to a subset of murine lupus. Int Immunol
19: 175-183
[Abstract][Full Text]
Webb, D. C., Cai, Y., Matthaei, K. I., Foster, P. S.
(2007). Comparative Roles of IL-4, IL-13, and IL-4R{alpha} in Dendritic Cell Maturation and CD4+ Th2 Cell Function. J. Immunol.
178: 219-227
[Abstract][Full Text]
Bailey, D. P., Kashyap, M., Bouton, L. A., Murray, P. J., Ryan, J. J.
(2006). Interleukin-10 induces apoptosis in developing mast cells and macrophages. J. Leukoc. Biol.
80: 581-589
[Abstract][Full Text]
Truyen, E, Coteur, L, Dilissen, E, Overbergh, L, Dupont, L J, Ceuppens, J L, Bullens, D M A
(2006). Evaluation of airway inflammation by quantitative Th1/Th2 cytokine mRNA measurement in sputum of asthma patients. Thorax
61: 202-208
[Abstract][Full Text]
Georas, S. N., Guo, J., De Fanis, U., Casolaro, V.
(2005). T-helper cell type-2 regulation in allergic disease. Eur Respir J
26: 1119-1137
[Abstract][Full Text]
Stephenson, L. M., Park, D.-S., Mora, A. L., Goenka, S., Boothby, M.
(2005). Sequence Motifs in IL-4R{alpha} Mediating Cell-Cycle Progression of Primary Lymphocytes. J. Immunol.
175: 5178-5185
[Abstract][Full Text]
Steck, A. K., Bugawan, T. L., Valdes, A. M., Emery, L. M., Blair, A., Norris, J. M., Redondo, M. J., Babu, S. R., Erlich, H. A., Eisenbarth, G. S., Rewers, M. J.
(2005). Association of Non-HLA Genes With Type 1 Diabetes Autoimmunity. Diabetes
54: 2482-2486
[Abstract][Full Text]
Stephenson, L., Johns, M. H., Woodward, E., Mora, A. L., Boothby, M.
(2004). An IL-4R{alpha} Allelic Variant, I50, Acts as a Gain-of-Function Variant Relative to V50 for Stat6, But Not Th2 Differentiation. J. Immunol.
173: 4523-4528
[Abstract][Full Text]
Lim, M. S., Elenitoba-Johnson, K. S.J.
(2004). The Molecular Pathology of Primary Immunodeficiencies. J. Mol. Diagn.
6: 59-83
[Full Text]
Gillespie, S. R., DeMartino, R. R., Zhu, J., Chong, H. J., Ramirez, C., Shelburne, C. P., Bouton, L. A., Bailey, D. P., Gharse, A., Mirmonsef, P., Odom, S., Gomez, G., Rivera, J., Fischer-Stenger, K., Ryan, J. J.
(2004). IL-10 Inhibits Fc{epsilon}RI Expression in Mouse Mast Cells. J. Immunol.
172: 3181-3188
[Abstract][Full Text]
Webb, D. C., Matthaei, K. I., Cai, Y., McKenzie, A. N. J., Foster, P. S.
(2004). Polymorphisms in IL-4R{alpha} Correlate with Airways Hyperreactivity, Eosinophilia, and Ym Protein Expression in Allergic IL-13-/- Mice. J. Immunol.
172: 1092-1098
[Abstract][Full Text]
Faffe, D. S., Whitehead, T., Moore, P. E., Baraldo, S., Flynt, L., Bourgeois, K., Panettieri, R. A., Shore, S. A.
(2003). IL-13 and IL-4 promote TARC release in human airway smooth muscle cells: role of IL-4 receptor genotype. Am. J. Physiol. Lung Cell. Mol. Physiol.
285: L907-L914
[Abstract][Full Text]
Bruns, H. A., Schindler, U., Kaplan, M. H.
(2003). Expression of a Constitutively Active Stat6 In Vivo Alters Lymphocyte Homeostasis with Distinct Effects in T and B Cells. J. Immunol.
170: 3478-3487
[Abstract][Full Text]
He, J.-Q., Connett, J. E., Anthonisen, N. R., Sandford, A. J.
(2003). Polymorphisms in the IL13, IL13RA1, and IL4RA Genes and Rate of Decline in Lung Function in Smokers. Am. J. Respir. Cell Mol. Bio.
28: 379-385
[Abstract][Full Text]
Szefler, S. J.
(2003). Pediatric Asthma: An Approach to Pharmacogenetics Analysis. Chest
123
: 434S-438S
[Full Text]
Hanson, E. M., Dickensheets, H., Qu, C.-K., Donnelly, R. P., Keegan, A. D.
(2003). Regulation of the Dephosphorylation of Stat6. PARTICIPATION OF TYR-713 IN THE INTERLEUKIN-4 RECEPTOR alpha , THE TYROSINE PHOSPHATASE SHP-1, AND THE PROTEASOME. J. Biol. Chem.
278: 3903-3911
[Abstract][Full Text]
Wong, G. W., Foster, P. S., Yasuda, S., Qi, J. C., Mahalingam, S., Mellor, E. A., Katsoulotos, G., Li, L., Boyce, J. A., Krilis, S. A., Stevens, R. L.
(2002). Biochemical and Functional Characterization of Human Transmembrane Tryptase (TMT)/Tryptase gamma . TMT IS AN EXOCYTOSED MAST CELL PROTEASE THAT INDUCES AIRWAY HYPERRESPONSIVENESS IN VIVO VIA AN INTERLEUKIN-13/INTERLEUKIN-4 RECEPTOR alpha /SIGNAL TRANSDUCER AND ACTIVATOR OF TRANSCRIPTION (STAT) 6-DEPENDENT PATHWAY. J. Biol. Chem.
277: 41906-41915
[Abstract][Full Text]
Calhoun, E. S., McGovern, R. M., Janney, C. A., Cerhan, J. R., Iturria, S. J., Smith, D. I., Gostout, B. S., Persing, D. H.
(2002). Host Genetic Polymorphism Analysis in Cervical Cancer. Clin. Chem.
48: 1218-1224
[Abstract][Full Text]
Nakamura, E., Megumi, Y., Kobayashi, T., Kamoto, T., Ishitoya, S., Terachi, T., Tachibana, M., Matsushiro, H., Habuchi, T., Kakehi, Y., Ogawa, O.
(2002). Genetic Polymorphisms of the Interleukin-4 Receptor{alpha} Gene Are Associated with an Increasing Risk and a Poor Prognosis of Sporadic Renal Cell Carcinoma in a Japanese Population. Clin. Cancer Res.
8: 2620-2625
[Abstract][Full Text]
Risma, K. A., Wang, N., Andrews, R. P., Cunningham, C. M., Ericksen, M. B., Bernstein, J. A., Chakraborty, R., Hershey, G. K. K.
(2002). V75R576 IL-4 Receptor {alpha} Is Associated with Allergic Asthma and Enhanced IL-4 Receptor Function. J. Immunol.
169: 1604-1610
[Abstract][Full Text]
Lordan, J. L., Bucchieri, F., Richter, A., Konstantinidis, A., Holloway, J. W., Thornber, M., Puddicombe, S. M., Buchanan, D., Wilson, S. J., Djukanovic, R., Holgate, S. T., Davies, D. E.
(2002). Cooperative Effects of Th2 Cytokines and Allergen on Normal and Asthmatic Bronchial Epithelial Cells. J. Immunol.
169: 407-414
[Abstract][Full Text]
Perez-G., M., Melo, M., Keegan, A. D., Zamorano, J.
(2002). Aspirin and Salicylates Inhibit the IL-4- and IL-13-Induced Activation of STAT6. J. Immunol.
168: 1428-1434
[Abstract][Full Text]
Reich, K., Heine, A., Hugo, S., Blaschke, V., Middel, P., Kaser, A., Tilg, H., Blaschke, S., Gutgesell, C., Neumann, C.
(2001). Engagement of the Fc{epsilon}RI Stimulates the Production of IL-16 in Langerhans Cell-Like Dendritic Cells. J. Immunol.
167: 6321-6329
[Abstract][Full Text]
Howard, T. D., Whittaker, P. A., Zaiman, A. L., Koppelman, G. H., Xu, J., Hanley, M. T., Meyers, D. A., Postma, D. S., Bleecker, E. R.
(2001). Identification and Association of Polymorphisms in the Interleukin-13 Gene with Asthma and Atopy in a Dutch Population. Am. J. Respir. Cell Mol. Bio.
25: 377-384
[Abstract][Full Text]
Komiya, I., Yamada, T., Sato, A., Kouki, T., Nishimori, T., Takasu, N.
(2001). Remission and Recurrence of Hyperthyroid Graves' Disease during and after Methimazole Treatment When Assessed by IgE and Interleukin 13. J. Clin. Endocrinol. Metab.
86: 3540-3544
[Abstract][Full Text]
Daley, T., Metcalfe, D. D., Akin, C.
(2001). Association of the Q576R polymorphism in the interleukin-4 receptor {alpha} chain with indolent mastocytosis limited to the skin. Blood
98: 880-882
[Abstract][Full Text]
White, E. D., Andrews, R. P., Hershey, G. K. K.
(2001). Sulfhydryl-2 domain-containing protein tyrosine phosphatase-1 is not a negative regulator of interleukin-4 signaling in murine mast cells. J. Leukoc. Biol.
69: 825-830
[Abstract][Full Text]
Sakai, T., Matsuoka, M., Aoki, M., Nosaka, K., Mitsuya, H.
(2001). Missense mutation of the interleukin-12 receptor {beta}1 chain-encoding gene is associated with impaired immunity against Mycobacterium avium complex infection. Blood
97: 2688-2694
[Abstract][Full Text]
Donnadieu, E., Cookson, W. O., Jouvin, M.-H., Kinet, J.-P.
(2000). Allergy-Associated Polymorphisms of the Fc{epsilon}RI{beta} Subunit Do Not Impact Its Two Amplification Functions. J. Immunol.
165: 3917-3922
[Abstract][Full Text]
Buchs, N., Silvestri, T., di Giovine, F. S., Chabaud, M., Vannier, E., Duff, G. W., Miossec, P.
(2000). IL-4 VNTR gene polymorphism in chronic polyarthritis. The rare allele is associated with protection against destruction. Rheumatology (Oxford)
39: 1126-1131
[Abstract][Full Text]
Palmer, L. J., Cookson, W. O.C.M.
(2000). Genomic Approaches to Understanding Asthma. Genome Res
10: 1280-1287
[Abstract][Full Text]
SAVELKOUL, H. F. J.
(2000). Immune Parameters in High-risk Atopic Individuals during Early Childhood. Am. J. Respir. Crit. Care Med.
162: S100-104
[Full Text]
POSTMA, D. S., KOPPELMAN, G. H., MEYERS, D. A.
(2000). The Genetics of Atopy and Airway Hyperresponsiveness. Am. J. Respir. Crit. Care Med.
162: S118-123
[Full Text]
Hilliquin, P., Allanore, Y., Coste, J., Renoux, M., Kahan, A., Menkes, C. J.
(2000). Reduced incidence and prevalence of atopy in rheumatoid arthritis. Results of a case-control study. Rheumatology (Oxford)
39: 1020-1026
[Abstract][Full Text]
Dupre, D., Audrezet, M.-P., Ferec, C., Chatila, T.
(2000). Atopy and a Mutation in the Interleukin-4 Receptor Gene. NEJM
343: 69-70
[Full Text]
Nakayama, E. E., Hoshino, Y., Xin, X., Liu, H., Goto, M., Watanabe, N., Taguchi, H., Hitani, A., Kawana-Tachikawa, A., Fukushima, M., Yamada, K., Sugiura, W., Oka, S.-I., Ajisawa, A., Sato, H., Takebe, Y., Nakamura, T., Nagai, Y., Iwamoto, A., Shioda, T.
(2000). Polymorphism in the Interleukin-4 Promoter Affects Acquisition of Human Immunodeficiency Virus Type 1 Syncytium-Inducing Phenotype. J. Virol.
74: 5452-5459
[Abstract][Full Text]
Hunt, P. J., Marshall, S. E., Weetman, A. P., Bell, J. I., Wass, J. A. H., Welsh, K. I.
(2000). Cytokine Gene Polymorphisms in Autoimmune Thyroid Disease. J. Clin. Endocrinol. Metab.
85: 1984-1988
[Abstract][Full Text]
PATUZZO, C., TRABETTI, E., MALERBA, G., MARTINATI, L. C., BONER, A. L, PESCOLLDERUNGG, L., ZANONI, G., PIGNATTI, P. F.
(2000). No linkage or association of the IL-4Ralpha gene Q576R mutation with atopic asthma in Italian families. J. Med. Genet.
37: 382-384
[Full Text]
Hadeiba, H., Corry, D. B., Locksley, R. M.
(2000). Baseline Airway Hyperreactivity in A/J Mice Is not Mediated by Cells of the Adaptive Immune System. J. Immunol.
164: 4933-4940
[Abstract][Full Text]
GAO, P-S, MAO, X-Q, ROBERTS, M H, ARINOBU, Y, AKAIWA, M, ENOMOTO, T, DAKE, Y, KAWAI, M, SASAKI, S, HAMASAKI, N, IZUHARA, K, SHIRAKAWA, T, HOPKIN, J M
(2000). Variants of STAT6 (signal transducer and activator of transcription 6) in atopic asthma. J. Med. Genet.
37: 380a-382
[Full Text]
Fujio, K., Nosaka, T., Kojima, T., Kawashima, T., Yahata, T., Copeland, N. G., Gilbert, D. J., Jenkins, N. A., Yamamoto, K., Nishimura, T., Kitamura, T.
(2000). Molecular cloning of a novel type 1 cytokine receptor similar to the common gamma chain. Blood
95: 2204-2210
[Abstract][Full Text]
Mein, C. A., Barratt, B. J., Dunn, M. G., Siegmund, T., Smith, A. N., Esposito, L., Nutland, S., Stevens, H. E., Wilson, A. J., Phillips, M. S., Jarvis, N., Law, S., de Arruda, M., Todd, J. A.
(2000). Evaluation of Single Nucleotide Polymorphism Typing with Invader on PCR Amplicons and Its Automation. Genome Res
10: 330-343
[Abstract][Full Text]
SANDFORD, A. J., PARE, P. D.
(2000). The Genetics of Asthma . The Important Questions. Am. J. Respir. Crit. Care Med.
161: S202-206
[Full Text]
Huang, H., Paul, W. E.
(2000). Protein Tyrosine Phosphatase Activity Is Required for IL-4 Induction of IL-4 Receptor {alpha}-Chain. J. Immunol.
164: 1211-1215
[Abstract][Full Text]
Kruse, S., Forster, J., Kuehr, J., Deichmann, K. A.
(1999). Characterization of the membrane-bound and a soluble form of human IL-4 receptor {alpha} produced by alternative splicing. Int Immunol
11: 1965-1970
[Abstract][Full Text]
Janas, M. L., Hodgkin, P., Hibbs, M., Tarlinton, D.
(1999). Genetic Evidence for Lyn as a Negative Regulator of IL-4 Signaling. J. Immunol.
163: 4192-4198
[Abstract][Full Text]
Chung, K F, Barnes, P J
(1999). Cytokines in asthma. Thorax
54: 825-857
[Full Text]
Srikiatkhachorn, A., Chang, W., Braciale, T. J.
(1999). Induction of Th-1 and Th-2 Responses by Respiratory Syncytial Virus Attachment Glycoprotein Is Epitope and Major Histocompatibility Complex Independent. J. Virol.
73: 6590-6597
[Abstract][Full Text]
NOGUCHI, E., SHIBASAKI, M., ARINAMI, T., TAKEDA, K., YOKOUCHI, Y., KOBAYASHI, K., IMOTO, N., NAKAHARA, S., MATSUI, A., HAMAGUCHI, H.
(1999). No Association between Atopy/Asthma and the Ile50val Polymorphism of IL-4 Receptor. Am. J. Respir. Crit. Care Med.
160: 342-345
[Abstract][Full Text]
Wang, H. Y., Shelburne, C. P., Zamorano, J., Kelly, A. E., Ryan, J. J., Keegan, A. D.
(1999). Cutting Edge: Effects of an Allergy-Associated Mutation in the Human IL-4R{alpha} (Q576R) on Human IL-4-Induced Signal Transduction. J. Immunol.
162: 4385-4389
[Abstract][Full Text]
Grimbacher, B., Holland, S. M., Gallin, J. I., Greenberg, F., Hill, S. C., Malech, H. L., Miller, J. A., O'Connell, A. C., Puck, J. M.
(1999). Hyper-IgE Syndrome with Recurrent Infections -- An Autosomal Dominant Multisystem Disorder. NEJM
340: 692-702
[Abstract][Full Text]
Wierenga, E. A., Walchner, M., Kick, G., Kapsenberg, M. L., Weiss, E. H., Messer, G.
(1999). Evidence for suppressed activity of the transcription factor NFAT1 at its proximal binding element P0 in the IL-4 promoter associated with enhanced IL-4 gene transcription in T cells of atopic patients. Int Immunol
11: 297-306
[Abstract][Full Text]
Mitsuyasu, H., Yanagihara, Y., Mao, X.-Q., Gao, P.-S., Arinobu, Y., Ihara, K., Takabayashi, A., Hara, T., Enomoto, T., Sasaki, S., Kawai, M., Hamasaki, N., Shirakawa, T., Hopkin, J. M., Izuhara, K.
(1999). Cutting Edge: Dominant Effect of Ile50Val Variant of the Human IL-4 Receptor {alpha}-Chain in IgE Synthesis. J. Immunol.
162: 1227-1231
[Abstract][Full Text]
Matsumoto, M., Ra, C., Kawamoto, K., Sato, H., Itakura, A., Sawada, J., Ushio, H., Suto, H., Mitsuishi, K., Hikasa, Y., Matsuda, H.
(1999). IgE Hyperproduction Through Enhanced Tyrosine Phosphorylation of Janus Kinase 3 in NC/Nga Mice, a Model for Human Atopic Dermatitis. J. Immunol.
162: 1056-1063
[Abstract][Full Text]
Hall, I P
(1999). Genetics and pulmonary medicine bullet 8: Genetics and pulmonary medicine: asthma. Thorax
54: 65-69
[Full Text]
Haque, S. J., Harbor, P., Tabrizi, M., Yi, T., Williams, B. R. G.
(1998). Protein-tyrosine Phosphatase Shp-1 Is a Negative Regulator of IL-4- and IL-13-dependent Signal Transduction. J. Biol. Chem.
273: 33893-33896
[Abstract][Full Text]
Grünig, G., Warnock, M., Wakil, A. E., Venkayya, R., Brombacher, F., Rennick, D. M., Sheppard, D., Mohrs, M., Donaldson, D. D., Locksley, R. M., Corry, D. B.
(1998). Requirement for IL-13 Independently of IL-4 in Experimental Asthma. Science
282: 2261-2263
[Abstract][Full Text]
Ryan, J. J., DeSimone, S., Klisch, G., Shelburne, C., McReynolds, L. J., Han, K., Kovacs, R., Mirmonsef, P., Huff, T. F.
(1998). IL-4 Inhibits Mouse Mast Cell Fc{epsilon}RI Expression Through a STAT6-Dependent Mechanism. J. Immunol.
161: 6915-6923
[Abstract][Full Text]
Barnes, P. J., Chung, K. F., Page, C. P.
(1998). Inflammatory Mediators of Asthma: An Update. Pharmacol. Rev.
50: 515-596
[Abstract][Full Text]
Youn, J., Chen, J., Goenka, S., Aronica, M. A., Mora, A. L., Correa, V., Sheller, J. R., Boothby, M.
(1998). In Vivo Function of an Interleukin 2 Receptor {beta} Chain (IL-2R{beta})/IL-4R{alpha} Cytokine Receptor Chimera Potentiates Allergic Airway Disease. JEM
188: 1803-1816
[Abstract][Full Text]
Ryan, J. J., McReynolds, L. J., Huang, H., Nelms, K., Paul, W. E.
(1998). Characterization of a Mobile Stat6 Activation Motif in the Human IL-4 Receptor. J. Immunol.
161: 1811-1821
[Abstract][Full Text]
Altshuler, D., Kruglyak, L., Lander, E.
(1998). Genetic Polymorphisms and Disease. NEJM
338: 1626-1626
[Full Text]
GASTON, J S H
(1998). Will the increasing prevalence of atopy have a favourable impact on rheumatoid arthritis?. Ann Rheum Dis
57: 265-267
[Full Text]
Grimbacher, B., Holland, S. M., Puck, J. M., Hershey, G. K. K., Chatila, T. A.
(1998). The Interleukin-4 Receptor Variant Q576R in Hyper-IgE Syndrome. NEJM
338: 1073-1074
[Full Text]
Rosenwasser, L. J.
(1997). Interleukin-4 and the Genetics of Atopy. NEJM
337: 1766-1767
[Full Text]
Daniel, C., Salvekar, A., Schindler, U.
(2000). A Gain-of-function Mutation in STAT6. J. Biol. Chem.
275: 14255-14259
[Abstract][Full Text]