Background There is general agreement that lymphocytic and histiocytic(L&H) cells, the variants of ReedSternberg cellsin nodular lymphocyte-predominant Hodgkin's disease, belongto the B-cell lineage. However, the clonality of L&H cellsremains controversial.
Methods We used complementarity-determining region 3 (CDR3)of the immunoglobulin heavy-chain gene as a clonal marker tostudy individual L&H cells isolated by micromanipulationfrom tissue sections of five patients with nodular lymphocyte-predominantHodgkin's disease. The heavy-chain CDR3 of each cell was amplifiedby the polymerase chain reaction. The products were analyzedby gel electrophoresis, and representative amplification productsfrom each patient were sequenced.
Results L&H cells whose heavy-chain CDR3 was related, indicatingthe presence of a clonal population, were detected in all fivepatients and were the dominant population in three. In fourof the five patients, members of the clone were found in differentnodules in the tissue section, different tissue blocks fromthe same tumor, or different lymph nodes from the same patient.The CDR3 sequences in each clone frequently contained nucleotidesubstitutions indicative of intraclonal mutation.
Conclusions Clonal populations of L&H cells occur in nodularlymphocyte-predominant Hodgkin's disease. Intraclonal variationin nucleotide sequences suggests that hypermutation of the heavy-chainCDR3 continues to occur among the clonal progeny.
Nodular lymphocyte-predominant Hodgkin's disease, a subtypeof Hodgkin's disease, is an indolent disorder in which tumorscontain a variant of ReedSternberg cells known as lymphocyticand histiocytic (L&H) cells, which are admixed with smalllymphocytes and histiocytes in nodular aggregates.1,2,3,4 Immunohistochemicalstudies have provided strong evidence that these L&H cellsoriginate from B cells,5,6,7,8,9 but whether they representmonoclonal or polyclonal populations remains unclear.
Studies of immunoglobulin-gene rearrangement as a clonal markerin nodular lymphocyte-predominant Hodgkin's disease have yieldedconflicting results.10,11,12,13,14,15,16,17,18 To resolve thecontroversy, investigators have isolated single L&H cellsand studied them by the polymerase chain reaction (PCR) forrearrangements of the genes for the immunoglobulin heavy chain,the light chain, or both.19,20 Küppers et al.19 reporteda clonal population of L&H cells in a patient with nodularlymphocyte-predominant Hodgkin's disease, whereas Delabie etal.20 did not detect such populations in two patients they studied.It is unclear whether case selection or technical factors, suchas sampling bias, account for these discordant findings. Weperformed single-cell analysis of five patients with nodularlymphocyte-predominant Hodgkin's disease; different nodulesin the tumor and, when available, different tissue blocks andlymph nodes were sampled. We found a clonal population in eachof the five patients, and in four the population appeared tobe present throughout the tumor.
Methods
Case Selection
We studied seven formalin-fixed, paraffin-embedded specimensof tissue from five patients with nodular lymphocyte-predominantHodgkin's disease who were selected from the data base of thelymphoma registry at the University of Nebraska Medical Center.All the specimens had the characteristic histopathological featuresand immunophenotype of the disease. The specimens from Patients1, 2, 3, and 4 had moderately abundant L&H cells and relativelyfew small B lymphocytes in the nodules; in the specimen fromPatient 5 the nodules contained few L&H cells and numeroussmall B lymphocytes.
Immunohistochemical Analysis
Tissue sections 4 to 6 µm thick were stained with anti-CD20or anti-CD3 (Dako, Carpinteria, Calif.) by a three-step immunoperoxidasemethod.21 Before the staining with anti-CD20, the sections wereheated in citrate buffer (pH 6.0) for five minutes in a microwaveoven; before the staining with anti-CD3, the sections were digestedwith pepsin.
Isolation of Single Cells from Tissue Sections
With the use of an inverted microscope (Nikon, New York), theL&H cells stained with anti-CD20 were isolated with a microknifeand a micropipette that were fixed to hydraulic micromanipulators(Narishige, New York) and expelled into a tube containing PCRbuffer as described by d'Amore et al.22 In addition to the L&Hcells, CD20+ small B cells and CD3+ small T cells were isolatedby micromanipulation for use as positive and negative controls.The phosphate-buffered saline overlying the section was sampledperiodically to serve as the negative control for the supernatant.
PCR Amplification of Single Cells
The heavy-chain CDR3 of each single cell was amplified afterdigestion with proteinase K by a seminested PCR using consensusVH and JH primers under hot-start conditions.20,23 The detailsof this procedure and of its use with formalin-fixed archivaltissue have been described previously.22 The amplified productswere subjected to electrophoresis on 8 percent polyacrylamidegels and visualized with ultraviolet light after staining withethidium bromide.
DNA Sequencing
For each patient, representative heavy-chain CDR3 PCR productsfrom cells that could be amplified were sequenced to determinetheir clonal relation. For this purpose, the original CDR3 PCRproduct was reamplified in a volume of 50 µl with VH andJH nested primers with M13 sequences attached to their 5' ends(sequences, M13+VH, TGTAAAACGACGGCCAGTCTGTCGACACGGCCGTGTATTACTG;M13R+JH, GGAAACAGCTATGACCATGACCAGGGTCCCTTGGCCCCA). The productswere gel-purified and directly sequenced with primers to M13in forward orientation and M13R in reverse orientation and acycle-sequencing procedure that used fluorescent dideoxynucleotidechain terminators (Applied Biosystems, Foster City, Calif.).24The sequences were analyzed with a model 373A sequencer (AppliedBiosystems).
Results
PCR was performed to amplify the CDR3 of the rearranged heavy-chaingenes of the cells isolated from tissues affected by nodularlymphocyte-predominant Hodgkin's disease. The procedure yieldedproducts for 5 to 38 percent of the L&H cells, 25 to 44percent of the small B cells, and none of 80 T cells (Table 1).
Table 1. Results of PCR Amplification of Single Cells for Heavy-Chain CDR3.
The results of the analyses of the single cells from each patientare shown in Table 2 and Table 3. For Patient 1, CDR3 PCR productswere obtained from 17 of 100 L&H cells in the first tissueblock and 13 of 40 L&H cells in the second tissue block(Table 2). PCR products of identical lengths were found in 22cells from different nodules in the two tissue blocks. Sevenof these 22 products, from nodules 1, 2, 3, 5, and 6, were sequencedand found to be identical, indicating that clonal L&H cellswere present in different nodules in both tissue blocks fromthe same tumor. The second tissue block from this patient wasstudied again after a 12-month interval (Table 2). The sameclonal population was again identified, and sequence analysisshowed that the sequences were identical to those determinedpreviously.
Table 3. Nucleotide Sequences of the Heavy-Chain CDR3 of Single L&H Cells.
For Patient 2, CDR3 PCR products were obtained from 21 of 90L&H cells. Two sets of products, each with identical lengths,were detected (Figure 1): 2 cells from nodule 2 (lanes 3 and4) and 13 cells from nodules 1, 2, and 4. Sequence analysisof the two products (lanes 3 and 4, Figure 1) from nodule 2showed that they were unrelated. Eight of the 13 products fromnodules 1, 2, and 4 were sequenced, and all were found to berelated; 4 had identical nucleotides, and 4 contained nucleotidesubstitutions (Table 3). These findings indicated that therewas a clonal population of L&H cells with intraclonal mutationsin three nodules from the same tumor.
Figure 1. Results of Polyacrylamide-Gel Electrophoresis of the Heavy-Chain CDR3 PCR Products from Each of the Single L&H Cells from Patient 2.
Products with sizes identical to that in lane 1 were found in three nodules, and all the amplification products sequenced were identical or related. In addition, the products in lanes 3 and 4 (from nodule 2) appeared to be identical to each other, but sequencing showed them to be unrelated. M denotes a molecular-size ladder.
For Patient 3, in whom two inguinal lymph nodes were studied,CDR3 PCR products were obtained from 6 of 40 L&H cells fromthe first lymph node and from 2 of 39 L&H cells from thesecond. PCR products of identical lengths were found in twocells, one from each lymph node. Sequence analysis showed thatthe two cells were related, but there were multiple nucleotidesubstitutions, indicating that a clonal population of L&Hcells with intraclonal mutations was present in the two inguinallymph nodes.
For Patient 4, CDR3 PCR products were obtained from 27 of 72single L&H cells. PCR products of identical lengths werefound in 23 cells from four different nodules. Sequence analysisof eight of the products (two from each nodule) (Figure 2) confirmedthe presence of a clonal population with frequent intraclonalmutations in all the nodules. One additional, smaller clonewas found in nodule 3 (Figure 2). The sequence of this minorclone (lanes 5 and 6, Figure 2) was related to that of the majorclone (typified by cell 8, Table 3). Two additional PCR productsfrom nodule 3 were also identical in size (Table 2), but thesequences were unrelated to each other and to the two relatedclones found in the same specimen.
Figure 2. Results of Polyacrylamide-Gel Electrophoresis of the Heavy-Chain CDR3 PCR Products from the Single L&H Cells from Patient 4 That Had Related Sequences.
Products of identical size (less than 100 bp) were identified in all four nodules. In addition, two larger amplification products of identical size and related sequence (lanes 5 and 6) were seen in nodule 3. M denotes a molecular-size ladder.
For Patient 5, CDR3 PCR products were obtained from 20 of 100L&H cells. Fourteen of the PCR products were classifiedinto three groups in which the products had almost identicallengths (Figure 3), and all 14 products were sequenced. Only2 of the 14 PCR products (lanes 1 and 4, Figure 3) had identicalsequences (Table 3). All the other sequences appeared unrelated.This patient differed from Patients 1 through 4 in having fewerL&H cells and more abundant small B lymphocytes.
Figure 3. Results of Polyacrylamide-Gel Electrophoresis of the Heavy-Chain CDR3 PCR Products from 14 Single L&H Cells from Patient 5.
These products were classified into three groups, each of which contained amplification products almost identical in size, but only two products (lanes 1 and 4) had identical sequences. M denotes a molecular-size ladder.
Discussion
The detection of B-cell antigens, such as the J-chain, CD19,CD20, and CD79a, was the first indication of the B-cell originof L&H cells.5,6,7,8,9 However, whether nodular lymphocyte-predominantHodgkin's disease is a monoclonal or a polyclonal B-cell disorderhas been controversial. Southern blot and PCR analyses for immunoglobulin-generearrangements have detected only occasional cases of monoclonalimmunoglobulin-gene rearrangements in all studies,10,11,12,13,14,15,17,18with a single exception.16 These studies are difficult to interpretbecause of the admixture of numerous reactive cells in additionto the L&H cells. Some investigations using in situ hybridizationhave found messenger RNA with a single light-chain isotype ina predominance of L&H cells, as is consistent with a clonalpopulation.25,26 The detection of clonality by the analysisof single L&H cells in one patient with nodular lymphocyte-predominantHodgkin's disease has been reported recently.19 In a previousstudy, we did not find clonal heavy-chaingene rearrangementsin L&H cells from two patients with nodular lymphocyte-predominantHodgkin's disease.20 In that study, single L&H cells wereobtained from cell suspensions and a relatively small numberof cells were analyzed, which may have hampered the detectionof a clonal population of L&H cells. In this study, however,using PCR analysis of single cells obtained by micromanipulation,we have demonstrated clonal populations of L&H cells inall five patients with nodular lymphocyte-predominant Hodgkin'sdisease. These populations appeared to be present throughoutthe tumor in four of the five patients, since L&H cellswith identical or related heavy-chain CDR3 sequences were foundin different nodules in the same tissue section, in differenttissue blocks from the same tumor, and in two separate lymphnodes in one patient. Patient 1 was unusual in that all theCDR3 sequences from the clonal population were identical. Thesample from this patient was studied again after a 12-monthinterval. The presence of the initial clonal population of L&Hcells was confirmed, and the sequences were identical to thoseobtained previously.
It has been proposed that L&H cells originate from B cellsin germinal centers, because of the presence of follicular dendriticcells and CD57+ T-helper cells in the tumor nodules.27,28,29The clonal sequences in three of the specimens we studied andin the case reported by Küppers et al.19 showed nucleotidesubstitutions in individual cells belonging to the clone, indicatingintraclonal mutation. In Patient 4, an apparent second clonalpopulation was detected, but sequence analysis (Table 3) suggestedthat one of the clones was derived from the other, either bydeletion or by the insertion of the central portion of the sequence.The frequent mutation of heavy-chain genes we found in L&Hcells is also characteristic of normal B cells in the germinalcenter30,31,32 and suggests that the L&H cells are alteredcentroblasts in which hypermutation of heavy-chain genes takesplace in a germinal-centerlike environment.
In each of the five patients we also found L&H cells withheavy-chaingene rearrangements that were unrelated tothe clonal population we identified. This may indicate the concurrentpresence of polyclonal L&H cells, but the possibility thatthe polyclonal heavy-chaingene rearrangements were dueto contamination by normal B cells should also be considered.No heavy-chain CDR3 products were amplified in any of the Tcells or supernatant controls we studied, but this does notrule out an occasional contamination by B cells or the misidentificationof L&H cells. The specimens from Patients 1, 2, 3, and 4were selected because there were moderately abundant L&Hcells and relatively few small B lymphocytes in the nodules,which would minimize contamination of the L&H cells by normalB lymphocytes, but the selection criteria may have led to theinclusion of specimens in which a dominant clonal populationwas more likely. The specimen from Patient 5, on the other endof the spectrum, had few L&H cells and numerous small Blymphocytes. Only a small clonal population was detected inthis patient, a fact that seems to support the existence ofan early polyclonal phase of the disease. This hypothesis wouldbe much strengthened if multiple unrelated clones were detected.33
Supported by a grant (LB595) from the Department of Health,State of Nebraska, and by a grant (RO1 CA61453) from the NationalInstitutes of Health.
We are indebted to K. Hansen for secretarial assistance andto D. Daley and M. Lambert for technical assistance.
Source Information
Presented in abstract form at the Annual Meeting of the American Society of Hematology, Orlando, Fla., December 610, 1996.
From the Department of Pathology and Microbiology, University of Nebraska Medical Center, 600 S. 42nd St., P.O. Box 983135, Omaha, NE 68198-3135, where reprint requests should be addressed to Dr. Chan.
References
Lukes RJ, Butler JJ. The pathology and nomenclature of Hodgkin's disease. Cancer Res 1966;26:1063-1081. [Free Full Text]
Lukes RJ, Carver LF, Hall TC, Rappaport H, Ruben P. Report of the Nomenclature Committee. Cancer Res 1966;26:1311-1311.
Regula DP Jr, Hoppe RT, Weiss LM. Nodular and diffuse types of lymphocyte predominance Hodgkin's disease. N Engl J Med 1988;318:214-219. [Abstract]
Borg-Grech A, Radford JA, Crowther D, Swindell R, Harris M. A comparative study of the nodular and diffuse variants of lymphocyte-predominant Hodgkin's disease. J Clin Oncol 1989;7:1303-1309. [Abstract]
Poppema S. The diversity of the immunohistological staining pattern of Sternberg-Reed cells. J Histochem Cytochem 1980;28:788-791. [Abstract]
Stein H, Hansmann ML, Lennert K, Brandtzaeg P, Gatter KC, Mason DY. Reed-Sternberg and Hodgkin cells in lymphocyte-predominant Hodgkin's disease of nodular subtype contain J chain. Am J Clin Pathol 1986;86:292-297. [Medline]
Angel CA, Warford A, Campbell AC, Pringle JH, Lauder I. The immunohistology of Hodgkin's disease -- Reed-Sternberg cells and their variants. J Pathol 1987;153:21-30. [CrossRef][Medline]
Pinkus GS, Said JW. Hodgkin's disease, lymphocyte predominance type, nodular -- further evidence for a B cell derivation: L & H variants of Reed-Sternberg cells express L26, a pan B cell marker. Am J Pathol 1988;133:211-217. [Abstract]
Kuzu I, Delsol G, Jones M, Gatter KC, Mason DY. Expression of the Ig-associated heterodimer (mb-1 and B29) in Hodgkin's disease. Histopathology 1993;22:141-144. [Medline]
Knowles DM II, Neri A, Pelicci PG, et al. Immunoglobulin and T-cell receptor -chain gene rearrangement analysis of Hodgkin's disease: implications for lineage determination and differential diagnosis. Proc Natl Acad Sci U S A 1986;83:7942-7946. [Free Full Text]
Angel CA, Pringle JH, Naylor J, West KP, Lauder I. Analysis of antigen receptor genes in Hodgkin's disease. J Clin Pathol 1993;46:337-340. [Free Full Text]
Linden MD, Fishleder AJ, Katzin WE, Tubbs RR. Absence of B-cell or T-cell clonal expansion in nodular, lymphocyte predominant Hodgkin's disease. Hum Pathol 1988;19:591-594. [CrossRef][Medline]
Said JW, Sassoon AF, Shintaku IP, Kurtin PJ, Pinkus GS. Absence ofbcl-2 major breakpoint region and JH gene rearrangement in lymphocyte predominance Hodgkin's disease: results of Southern blot analysis and polymerase chain reaction. Am J Pathol 1991;138:261-264. [Abstract]
Angel CA, Pringle JH, Primrose L, Lauder I. Detection of immunoglobulin heavy chain gene rearrangements in Hodgkin's disease using PCR. J Clin Pathol 1993;46:940-942. [Free Full Text]
Manzanal A, Santon A, Oliva H, Bellas C. Evaluation of clonal immunoglobulin heavy chain rearrangements in Hodgkin's disease using the polymerase chain reaction (PCR). Histopathology 1995;27:21-25. [Medline]
Tamaru J, Hummel M, Zemlin M, Kalvelage B, Stein H. Hodgkin's disease with a B-cell phenotype often shows a VDJ rearrangement and somatic mutations in the VH genes. Blood 1994;84:708-715. [Free Full Text]
Pan LX, Diss TC, Peng HZ, Norton AJ, Isaacson PG. Nodular lymphocyte predominance Hodgkin's disease: a monoclonal or polyclonal B-cell disorder? Blood 1996;87:2428-2434. [Free Full Text]
Greiner TC, Gascoyne RD, Anderson ME, et al. Nodular lymphocyte-predominant Hodgkin's disease associated with large-cell lymphoma: analysis of Ig gene rearrangements by V-J polymerase chain reaction. Blood 1996;88:657-666. [Free Full Text]
Küppers R, Rajewsky K, Zhao M, et al. Hodgkin disease: Hodgkin and Reed-Sternberg cells picked from histological sections show clonal immunoglobulin gene rearrangements and appear to be derived from B cells at various stages of development. Proc Natl Acad Sci U S A 1994;91:10962-10966. [Free Full Text]
Delabie J, Tierens A, Wu G, Weisenburger DD, Chan WC. Lymphocyte predominance Hodgkin's disease: lineage and clonality determination using a single-cell assay. Blood 1994;84:3291-3298. [Free Full Text]
Hsu SM, Raine L, Fanger H. Use of avidin-biotin-peroxidase complex (ABC) in immunoperoxidase techniques: a comparison between ABC and unlabeled antibody (PAP) procedures. J Histochem Cytochem 1981;29:577-580. [Abstract]
d'Amore F, Stribley JA, Ohno T, et al. Molecular studies on single cells harvested by micromanipulation from archival tissue sections previously stained by immunohistochemistry or nonisotopic in situ hybridization. Lab Invest 1997;76:219-224. [Medline]
Yamada M, Hudson S, Tournay O, et al. Detection of minimal disease in hematopoietic malignancies of the B-cell lineage by using third-complementarity-determining region (CDR-III)-specific probes. Proc Natl Acad Sci U S A 1989;86:5123-5127. [Free Full Text]
Wu G, Greiner TC, Chan WC. Obtaining clone-specific primer and probe for the immunoglobulin heavy chain gene from paraffin-embedded tissue of B-cell lymphoma: technical considerations. Diagn Mol Pathol (in press).
Hell K, Pringle JH, Hansmann ML, et al. Demonstration of light chain mRNA in Hodgkin's disease. J Pathol 1993;171:137-143. [CrossRef][Medline]
Stoler MH, Nichols GE, Symbula M, Weiss LM. Lymphocyte predominance Hodgkin's disease: evidence for a light chain-restricted monotypic B-cell neoplasm. Am J Pathol 1995;146:812-818. [Abstract]
Alavaikko MJ, Hansmann ML, Nebendahl C, Parwaresch MR, Lennert K. Follicular dendritic cells in Hodgkin's disease. Am J Clin Pathol 1991;95:194-200. [Medline]
Poppema S. The nature of the lymphocytes surrounding Reed-Sternberg cells in nodular lymphocyte predominance and in other types of Hodgkin's disease. Am J Pathol 1989;135:351-357. [Abstract]
Timens W, Visser L, Poppema S. Nodular lymphocyte predominance type of Hodgkin's disease is a germinal center lymphoma. Lab Invest 1986;54:457-461. [Medline]
Berek C. The development of B cells and the B-cell repertoire in the microenvironment of the germinal center. Immunol Rev 1992;126:5-19. [CrossRef][Medline]
Küppers R, Zhao M, Hansmann ML, Rajewsky K. Tracing B cell development in human germinal centres by molecular analysis of single cells picked from histological sections. EMBO J 1993;12:4955-4967. [Medline]
Chang B, Casali P. The CDR1 sequences of a major proportion of human germline Ig VH genes are inherently susceptible to amino acid replacement. Immunol Today 1994;15:367-373. [CrossRef][Medline]
Wickert RS, Weisenburger DD, Tierens A, Greiner TC, Chan WC. Clonal relationship between lymphocytic predominance Hodgkin's disease and concurrent or subsequent large-cell lymphoma of B lineage. Blood 1995;86:2312-2320. [Free Full Text]
Lee, A. I., LaCasce, A. S.
(2009). Nodular Lymphocyte Predominant Hodgkin Lymphoma. The Oncologist
14: 739-751
[Abstract][Full Text]
Re, D., Kuppers, R., Diehl, V.
(2005). Molecular Pathogenesis of Hodgkin's Lymphoma. JCO
23: 6379-6386
[Abstract][Full Text]
Renne, C., Martin-Subero, J. I., Hansmann, M.-L., Siebert, R.
(2005). Molecular Cytogenetic Analyses of Immunoglobulin Loci in Nodular Lymphocyte Predominant Hodgkin's Lymphoma Reveal a Recurrent IGH-BCL6 Juxtaposition. J. Mol. Diagn.
7: 352-356
[Abstract][Full Text]
Brauninger, A., Wacker, H.-H., Rajewsky, K., Kuppers, R., Hansmann, M.-L.
(2003). Typing the Histogenetic Origin of the Tumor Cells of Lymphocyte-rich Classical Hodgkin's Lymphoma in Relation to Tumor Cells of Classical and Lymphocyte-predominance Hodgkin's Lymphoma. Cancer Res.
63: 1644-1651
[Abstract][Full Text]
Rassidakis, G. Z., Medeiros, L. J., Vassilakopoulos, T. P., Viviani, S., Bonfante, V., Nadali, G., Herling, M., Angelopoulou, M. K., Giardini, R., Chilosi, M., Kittas, C., McDonnell, T. J., Bonadonna, G., Gianni, A. M., Pizzolo, G., Pangalis, G. A., Cabanillas, F., Sarris, A. H.
(2002). BCL-2 expression in Hodgkin and Reed-Sternberg cells of classical Hodgkin disease predicts a poorer prognosis in patients treated with ABVD or equivalent regimens. Blood
100: 3935-3941
[Abstract][Full Text]
Franke, S., Wlodarska, I., Maes, B., Vandenberghe, P., Achten, R., Hagemeijer, A., De Wolf-Peeters, C.
(2002). Comparative Genomic Hybridization Pattern Distinguishes T-Cell/Histiocyte-Rich B-Cell Lymphoma from Nodular Lymphocyte Predominance Hodgkin's Lymphoma. Am. J. Pathol.
161: 1861-1867
[Abstract][Full Text]
Rassidakis, G. Z., Medeiros, L. J., Viviani, S., Bonfante, V., Nadali, G.-P., Vassilakopoulos, T. P., Mesina, O., Herling, M., Angelopoulou, M. K., Giardini, R., Chilosi, M., Kittas, C., McLaughlin, P., Rodriguez, M. A., Romaguera, J., Bonadonna, G., Gianni, A. M., Pizzolo, G., Pangalis, G. A., Cabanillas, F., Sarris, A. H.
(2002). CD20 Expression in Hodgkin and Reed-Sternberg Cells of Classical Hodgkin's Disease: Associations With Presenting Features and Clinical Outcome. JCO
20: 1278-1287
[Abstract][Full Text]
Rassidakis, G. Z., Medeiros, L. J., McDonnell, T. J., Viviani, S., Bonfante, V., Nadali, G., Vassilakopoulos, T. P., Giardini, R., Chilosi, M., Kittas, C., Gianni, A. M., Bonadonna, G., Pizzolo, G., Pangalis, G. A., Cabanillas, F., Sarris, A. H.
(2002). BAX Expression in Hodgkin and Reed-Sternberg Cells of Hodgkin's Disease: Correlation with Clinical Outcome. Clin. Cancer Res.
8: 488-493
[Abstract][Full Text]
Torlakovic, E., Tierens, A., Dang, H. D., Delabie, J.
(2001). The Transcription Factor PU.1, Necessary for B-Cell Development Is Expressed in Lymphocyte Predominance, But Not Classical Hodgkin's Disease. Am. J. Pathol.
159: 1807-1814
[Abstract][Full Text]
Langerak, A W, van Krieken, J H J M, Wolvers-Tettero, I L M, Kerkhof, E, Mulder, A H, Vrints, L W M A, Coebergh, J W, Schuuring, E, Kluin, P. M, van Dongen, J J M
(2001). The role of molecular analysis of immunoglobulin and T cell receptor gene rearrangements in the diagnosis of lymphoproliferative disorders. J. Clin. Pathol.
54: 565-567
[Abstract][Full Text]
Franke, S., Wlodarska, I., Maes, B., Vandenberghe, P., Delabie, J., Hagemeijer, A., De Wolf-Peeters, C.
(2001). Lymphocyte predominance Hodgkin disease is characterized by recurrent genomic imbalances. Blood
97: 1845-1853
[Abstract][Full Text]
Brauninger, A., Yang, W., Wacker, H.-H., Rajewsky, K., Kuppers, R., Hansmann, M.-L.
(2001). B-cell development in progressively transformed germinal centers: similarities and differences compared with classical germinal centers and lymphocyte-predominant Hodgkin disease. Blood
97: 714-719
[Abstract][Full Text]
Stein, H., Marafioti, T., Foss, H.-D., Laumen, H., Hummel, M., Anagnostopoulos, I., Wirth, T., Demel, G., Falini, B.
(2001). Down-regulation of BOB.1/OBF.1 and Oct2 in classical Hodgkin disease but not in lymphocyte predominant Hodgkin disease correlates with immunoglobulin transcription. Blood
97: 496-501
[Abstract][Full Text]
Marafioti, T., Hummel, M., Foss, H.-D., Laumen, H., Korbjuhn, P., Anagnostopoulos, I., Lammert, H., Demel, G., Theil, J., Wirth, T., Stein, H.
(2000). Hodgkin and Reed-Sternberg cells represent an expansion of a single clone originating from a germinal center B-cell with functional immunoglobulin gene rearrangements but defective immunoglobulin transcription. Blood
95: 1443-1450
[Abstract][Full Text]
Staudt, L. M.
(2000). The Molecular and Cellular Origins of Hodgkin's Disease. JEM
191: 207-212
[Full Text]
Kuppers, R., Klein, U., Hansmann, M.-L., Rajewsky, K.
(1999). Cellular Origin of Human B-Cell Lymphomas. NEJM
341: 1520-1529
[Full Text]
Hasse, U., Tinguely, M., Leibundgut, E. O., Cajot, J.-F., Garvin, A. M., Tobler, A., Borisch, B., Fey, M. F.
(1999). Clonal Loss of Heterozygosity in Microdissected Hodgkin and Reed-Sternberg Cells. JNCI J Natl Cancer Inst
91: 1581-1583
[Full Text]
van den Berg, A., Visser, L., Poppema, S.
(1999). High Expression of the CC Chemokine TARC in Reed-Sternberg Cells : A Possible Explanation for the Characteristic T-Cell Infiltratein Hodgkin's Lymphoma. Am. J. Pathol.
154: 1685-1691
[Abstract][Full Text]
Manis, J. P
(1999). Precursors of Hodgkin's Disease and B-Cell Lymphomas. NEJM
340: 1280-1282
[Full Text]
Brauninger, A., Kuppers, R., Spieker, T., Siebert, R., Strickler, J. G., Schlegelberger, B., Rajewsky, K., Hansmann, M.-L.
(1999). Molecular Analysis of Single B Cells From T-Cell-Rich B-Cell Lymphoma Shows the Derivation of the Tumor Cells From Mutating Germinal Center B Cells and Exemplifies Means by Which Immunoglobulin Genes Are Modified in Germinal Center B Cells. Blood
93: 2679-2687
[Abstract][Full Text]
Carbone, A., Gloghini, A., Larocca, L. M., Antinori, A., Falini, B., Tirelli, U., Dalla-Favera, R., Gaidano, G.
(1999). Human Immunodeficiency Virus-Associated Hodgkin's Disease Derives From Post-Germinal Center B Cells. Blood
93: 2319-2326
[Abstract][Full Text]
Aster, J. C.
(1999). Lymphocyte-Predominant Hodgkin's Disease: How Little Therapy Is Enough?. JCO
17: 744-744
[Full Text]
Diehl, V., Sextro, M., Franklin, J., Hansmann, M.-L., Harris, N., Jaffe, E., Poppema, S., Harris, M., Franssila, K., van Krieken, J., Marafioti, T., Anagnostopoulos, I., Stein, H.
(1999). Clinical Presentation, Course, and Prognostic Factors in Lymphocyte-Predominant Hodgkin's Disease and Lymphocyte-Rich Classical Hodgkin's Disease: Report From the European Task Force on Lymphoma Project on Lymphocyte-Predominant Hodgkin's Disease. JCO
17: 776-776
[Abstract][Full Text]
Vockerodt, M., Soares, M., Kanzler, H., Kuppers, R., Kube, D., Hansmann, M.-L., Diehl, V., Tesch, H.
(1998). Detection of Clonal Hodgkin and Reed-Sternberg Cells With Identical Somatically Mutated and Rearranged VH Genes in Different Biopsies in Relapsed Hodgkin's Disease. Blood
92: 2899-2907
[Abstract][Full Text]
Carbone, A., Gloghini, A., Gaidano, G., Franceschi, S., Capello, D., Drexler, H. G., Falini, B., Dalla-Favera, R.
(1998). Expression Status of BCL-6 and Syndecan-1 Identifies Distinct Histogenetic Subtypes of Hodgkin's Disease. Blood
92: 2220-2228
[Abstract][Full Text]
Irsch, J., Nitsch, S., Hansmann, M.-L., Rajewsky, K., Tesch, H., Diehl, V., Jox, A., Kuppers, R., Radbruch, A.
(1998). Isolation of viable Hodgkin and Reed-Sternberg cells from Hodgkin disease tissues. Proc. Natl. Acad. Sci. USA
95: 10117-10122
[Abstract][Full Text]
Ohno, T., Smir, B. N., Weisenburger, D. D., Gascoyne, R. D., Hinrichs, S. D., Chan, W. C.
(1998). Origin of the Hodgkin/Reed-Sternberg Cells in Chronic Lymphocytic Leukemia With "Hodgkin's Transformation". Blood
91: 1757-1761
[Abstract][Full Text]
Schwartz, R. S.
(1997). Hodgkin's Disease -- Time for a Change. NEJM
337: 494-496
[Full Text]