Variations in the NRAMP1 Gene and Susceptibility to Tuberculosis in West Africans
Richard Bellamy, M.R.C.P., Cyril Ruwende, D.Phil., Tumani Corrah, Ph.D., Keith P.W.J. McAdam, F.R.C.P., Hilton C. Whittle, F.R.C.P., and Adrian V.S. Hill, D.Phil., D.M.
Background Genetic factors may affect the susceptibility totuberculosis, but no specific genes governing susceptibilityhave been identified. In mice, natural resistance to infectionwith some mycobacteria is influenced by the gene for natural-resistanceassociatedmacrophage protein 1 (Nramp1 ), but the role of the human homologueof this gene, NRAMP1, in tuberculosis is unknown. We typed polymorphismsin NRAMP1 in a casecontrol study of tuberculosis in theGambia, West Africa.
Methods Sequence-specific oligonucleotide hybridization andmicrosatellite analysis were used to type NRAMP1 polymorphismsin 410 adults (mean age, 34.7 years) with smear-positive pulmonarytuberculosis and 417 ethnically matched, healthy controls. Patientswith human immunodeficiency virus infection were excluded.
Results Four NRAMP1 polymorphisms were each significantly associatedwith tuberculosis. Subjects who were heterozygous for two NRAMP1polymorphisms in intron 4 and the 3' untranslated region ofthe gene were particularly overrepresented among those withtuberculosis, as compared with those with the most common NRAMP1genotype (odds ratio, 4.07; 95 percent confidence interval,1.86 to 9.12; chi-square = 14.58; P<0.001).
Conclusions Genetic variation in NRAMP1 affects susceptibilityto tuberculosis in West Africans.
Among inbred strains of mice, natural resistance to infectionwith several intracellular pathogens is controlled by a singledominant gene, designated Bcg (also known as Lsh/Ity).1,2,3Two distinct phenotypes, Bcg s and Bcg r,are associated withsusceptibility and resistance, respectively, to the early stageof infection with Mycobacterium bovis (bacille CalmetteGuérin),3M. avium complex,4M. lepraemurium,5Leishmania donovani,2,6and Salmonella typhimurium.1 A candidate gene was isolated bypositional cloning and designated the natural-resistanceassociatedmacrophage protein 1 gene (Nramp1 ).7Nramp1 is expressed onlyin reticuloendothelial cells.7 A single nonconservative aminoacid substitution of aspartic acid for glycine at position 169is correlated with the susceptibility phenotype (Bcg s) in 27inbred mouse strains.7,8 That Nramp1 and Bcg are identical hasbeen proved by the production of an Nramp1 knockout mouse thatis phenotypically identical to the homozygous Nramp1D169 mouse9and by the restoration of the resistance phenotype in transgenicmice in which the Nramp1G169 allele was transferred onto thebackground of the Nramp1D169 genotype.10 These findings conclusivelydemonstrated that Nramp1 has an important role in determiningresistance to mycobacteria and other intracellular pathogensin mice.
In the majority of humans, an effective immune response developsafter infection with M. tuberculosis and restricts the spreadof the pathogen. Less than 10 percent of infected persons everhave clinical disease, and only a minority of such persons havean identifiable risk factor, such as diabetes, advanced age,alcohol abuse, human immunodeficiency virus (HIV) infection,or use of corticosteroids. In the remainder, a complex interactionof genetic and environmental factors probably causes the developmentof disease. Racial variation in the susceptibility to tuberculosis11,12and studies in twins13,14 strongly suggest that genetic factorsare important in the susceptibility to tuberculosis.
The human homologue of the Nramp1 gene, designated NRAMP1, isa strong candidate gene for human tuberculosis. NRAMP1 has beencloned and mapped to human chromosome 2q35.15,16 Several polymorphismshave been described in the NRAMP1 gene, and it has been suggestedthat they may influence the gene's function.16,17,18,19 To determinewhether NRAMP1 polymorphisms are associated with susceptibilityto tuberculosis, we performed a casecontrol study comparingthe frequency of several polymorphisms in the NRAMP1 gene inWest Africans with tuberculosis and ethnically matched healthycontrols.
Methods
Patients and Controls
Patients over 16 years old with smear-positive pulmonary tuberculosiswere identified at three tuberculosisleprosy clinicsin the western region of the Gambia, in and around the capital,Banjul. Patients were included only after examination of sputumspecimens by experienced microscopists had confirmed the presenceof acid-fast bacilli. In the Gambia, the majority of personsin whom tuberculosis is diagnosed are adults who present withadvanced, smear-positive pulmonary disease. The patients inthis study had more severe disease than that generally seenin developed countries. A total of 410 patients (more than 90percent of those who were eligible) provided oral informed consent.Their mean (±SD) age was 34.7±13.2 years, and67.4 percent were male.
Sequential unrelated blood donors from the Royal Victoria Hospital,Banjul, were recruited as controls. The transfusion center servesthe geographic area from which the patients were recruited.A total of 417 blood donors (95 percent of those recruited)agreed to participate. All were male, and their mean age was30.3±7.5 years. The controls were retrospectively matchedwith the patients according to ethnic group, as far as the numbersallowed. The study was approved by the joint ethics committeeof the Gambian government and the Medical Research Council.
The following ethnic groups were represented: Mandinka (accountingfor 38.5 percent of the patients with tuberculosis and 37.4percent of the controls), Wolof (19.1 and 18.4 percent), Jola(17.9 and 16.9 percent), Fula (12.0 and 12.2 percent), Manjago(2.5 and 3.3 percent), Serrahule (2.7 and 3.8 percent), andother, less common groups such as Aku and Serere (7.3 and 8.0percent). These ethnic groups have previously been shown tobe closely related genetically.20 Persons known to have comefrom regions outside the Gambia were not included.
Patients known to be infected with HIV were not recruited, and95 percent of the patients who agreed to participate were screenedfor HIV antibodies. HIV-positive patients were excluded. Allcontrols were HIV-negative. The combined prevalence of HIV types1 and 2 in the Gambia is relatively low, around 1.5 percentin the general population and less than 10 percent among patientswith tuberculosis (unpublished data).
NRAMP1 Genotyping
The NRAMP1 polymorphisms typed were a (CA)n microsatellite inthe immediate 5' region of the gene,17 denoted here 5'(CA)n;a single nucleotide change in intron 4 (469+14G/C),18 denotedhere INT4; a nonconservative single-base substitution at codon543 that changes aspartic acid to asparagine (D543N)18; anda TGTG deletion in the 3' untranslated region (1729+55del4),18denoted here 3'UTR. DNA was extracted from whole venous bloodwith the use of Nucleon II kits (Scotlab).
A region of approximately 200 bp surrounding the (CA)n microsatellitewas amplified by means of the polymerase chain reaction (PCR)with the use of the primers 5'ACTCGCATTAGGCCAACGAG3' and fluorescein-labeled5'TTCTGTGCCTCCCA-AGTTAGC3' (developed by John Todd and coworkers,Oxford, United Kingdom). PCR products were genotyped by electrophoresison 6 percent polyacrylamide gels, with the use of an ABI 373sequencer and the computer software Genescan and Genotyper (PerkinElmer).21The PCR primers for the INT4 polymorphism were 5'CTCTGGCTGAAGGCTCTCC3'and 5'TGTGCTATCAGTTGAGCCTC3'; the primers for D543N and 3'UTRwere 5'GCATCTCCCCAATTCATGGT3' and 5'AACTGTCCCACTCTATCCTG3'.18The single-base substitutions and 4-bp deletion were detectedby slot blotting PCR product to a nylon membrane, hybridizationwith digoxigenin-labeled sequence-specific oligonucleotides,and signal detection with an antidigoxigenin-antibody chemiluminescencesystem (Boehringer Mannheim). The sequence-specific oligonucleotidesused were 5'TTGGGGGGCCTGGAC3' and 5'TTGGGGGCCCTGGAC3' for INT4variants, 5'TTGAAGAGAACCAGAA3' and 5'TTGAAGAGGACCAGAA3' forD543N, and 5'CTGGATGTGGAGGGG3' and 5'TGCTGGAGAGGGGGC3' for 3'UTR.15
Statistical Analysis
Statistical analysis was performed in a stepwise manner. Overallgenotype frequencies were compared initially with the use ofa three-by-two chi-square test with 2 df. If there was a significantoverall difference between cases and controls (P<0.05), individualgenotypes were compared with the use of a two-by-two chi-squaretest with 1 df. To allow for any potential confounding effectof ethnic group, chi-square analysis was also performed withthe use of the MantelHaenszel test and stratificationaccording to ethnic group. The influence of linked variationon genotypic associations was assessed by logistic regression.
Results
The NRAMP1 allelic frequencies for the INT4, D543N, and 3'UTRvariants differed significantly among the ethnic groups (Table 1).This finding highlights the importance of recording accuratedata on ethnic origin when carrying out genetic casecontrolstudies. The Gambian population is well suited to genetic studiesbecause persons can be classified precisely with respect tomembership in relatively closely related ethnic groups, whichis rarely possible with Western populations. MantelHaenszelchi-square tests were performed after stratification accordingto ethnic group in order to correct for this potential confoundingfactor (Table 2).
Table 2. Relation between NRAMP1 Polymorphisms and Tuberculosis in the Gambia.
The four polymorphisms, 5'(CA)n, INT4, D543N, and 3'UTR, wereeach significantly associated with tuberculosis (P = 0.03, P=0.009, P =0.008, and P< 0.001, respectively). The 5'(CA)nmicrosatellite and INT4 variant were in significant linkagedisequilibrium, with the 5'(CA)n 201-bp allele strongly associatedwith the INT4 C allele (P<0.001), and these results are thereforenot independent. In addition, the D543N A allele was alwaysassociated with the 3'UTR del allele (P<0.001), and theseresults are therefore also not independent of each other. The3'UTR del/D543N G haplotype was found in this population, whereasit is absent in Europeans and Asians18 (and unpublished data).The INT4 and 3'UTR alleles were not significantly associatedwith each other (chi-square = 0.83, P = 0.93), and both wereindependently and significantly associated with tuberculosis(on logistic-regression analysis, P = 0.006 for INT4 and P =0.004 for 3'UTR; after stratification for the presence or absenceof INT4, MantelHaenszel chi-square = 7.73 with 1 df for3'UTR, P = 0.005; and after stratification for the presenceor absence of 3'UTR, MantelHaenszel chi-square = 7.708with 1 df for INT4, P = 0.006). There were small differencesin the total number of persons in whom typing was performedfor each polymorphism, since very limited quantities of DNAwere available from a few persons.
Two additional polymorphisms in the NRAMP1 gene were typed:a C-to-T single-base transition at a position 236 bp beforethe transcription starting site19 and a 9-bp coding deletionwithin exon 2.17 The 9-bp deletion was very uncommon (allelicfrequency, <1 percent), and the -236C/T polymorphism wasnot associated with tuberculosis (chi-square = 2.82, P = 0.25;data not shown).
Combined analysis of the INT4 and 3'UTR polymorphisms showeda strong association with tuberculosis (chi-square =26.41 with3 df, P<0.001) (Table 3). As compared with GG/++ homozygotes,heterozygotes for the INT4 C allele or the 3'UTR del allelewere overrepresented among the patients with tuberculosis (oddsratio for INT4 C, 1.79; 95 percent confidence interval, 1.07to 3.00; odds ratio for 3'UTR, 1.85; 95 percent confidence interval,1.30 to 2.62). This finding was consistent among all the ethnicgroups studied (six of the seven ethnic groups had high numbersof INT4 heterozygotes and all seven had high numbers of 3'UTRheterozygotes among the patients with tuberculosis). Heterozygosityfor both these variants was associated with the highest riskof tuberculosis (odds ratio, 4.07; 95 percent confidence interval,1.86 to 9.12).
Table 3. Combined Analysis of NRAMP1 INT4 and 39UTR Variants.
Discussion
A mutation in Nramp1 results in susceptibility to several mycobacterialspecies among inbred mouse strains.7,8,9,10 Our study showedthat variation in the human homologue NRAMP1 is associated withaltered susceptibility to smear-positive tuberculosis. It islikely that the NRAMP1 gene governs susceptibility to tuberculosis.Although it is possible that the association described hereis due to linkage disequilibrium between variation in NRAMP1and another nearby susceptibility gene, this explanation isunlikely, because NRAMP1 is a strong candidate gene for tuberculosison the basis of studies of its murine homologue.
The study design we used does not distinguish between susceptibilityto infection with M. tuberculosis and susceptibility to diseaseprogression. However, most healthy Gambians in the age rangewe studied have been infected with M. tuberculosis. Since onlyapproximately 1 in 10 persons infected with M. tuberculosiswill ever have clinical disease,22 patients with tuberculosishave greater susceptibility to this pathogen than the generalpopulation. Human NRAMP1 is therefore probably important inthe development of overt disease, in contrast to murine Nramp1,which determines the ability to control bacille CalmetteGuérinin the early stages of infection. There may be differences betweenspecies in the functional consequences of Nramp1 variation,because human and murine macrophages exhibit marked differencesin their ability to inhibit the growth of virulent mycobacteriaand in the mechanisms they use.23 It is unclear whether theINT4 and 3'UTR variants affect NRAMP1 function or whether theyare in linkage disequilibrium with another functional polymorphismthat has not yet been described. However, allelic variationin the 5'(CA)n repeat may be of functional importance.24
The 3'UTR variant allele associated with susceptibility to tuberculosisis very uncommon in Europeans18 but was present in about a quarterof this West African population. These findings may in partexplain why American blacks have greater susceptibility to tuberculosisthan whites.11,12NRAMP1 polymorphism will need to be assessedin large casecontrol studies of whites and Asians todetermine whether the gene also governs susceptibility to tuberculosisin other racial groups.
The functions of Nramp1 in mice and NRAMP1 in humans remainunknown. Mice homozygous for the Nramp1 susceptibility allelehave increased susceptibility to several antigenically unrelatedintracellular pathogens in vivo, and macrophages from such micehave an impaired capacity to restrict the growth of mycobacteria,2,25,26salmonella,27 and leishmania28 in vitro. Thus, studies of theNRAMP1 susceptibility genotype identified here will be of interestin determining susceptibility to leprosy, typhoid fever, andleishmaniasis. Nramp1 protein is localized to the late endocyticcompartment of resting macrophages and, after phagocytosis,is recruited to the membrane of the phagosome.29 These findingssuggest that Nramp1 may restrict the replication of intracellularpathogens by altering the phagolysosomal environment.30 Therelated but unlinked gene Nramp2 has been shown to encode aniron transporter.31,32 The yeast Nramp1 homologue SMF1 is importantfor the regulation of manganese-ion uptake, and it has beensuggested that Nramp1 may therefore function as a regulatorof intraphagosomal manganese,30 iron, or other divalent cations.29
In the Gambia, heterozygotes for the INT4 and 3'UTR variantsare at increased risk for tuberculosis, whereas among mice,only homozygotes for the Nramp1D169 variant are susceptibleto intracellular pathogens. The small number of homozygotesin our study precludes a definitive analysis of their susceptibilityto tuberculosis, but they do not appear to be more susceptiblethan heterozygotes. These findings suggest that with the humanNRAMP1 variants, the tuberculosis-susceptibility allele is dominant,whereas with the murine Nramp1D169 variant, the resistance alleleis dominant. However, it is possible that incomplete linkagedisequilibrium between the typed polymorphisms and an unknownmutation affecting function has obscured the true dominancepattern of the resistance and susceptibility genotypes. Alternatively,the heterozygous genotype of NRAMP1 may lead to a divalent cationconcentration in the human phagolysosome, which is more conduciveto mycobacterial growth than either of the homozygous genotypes.Finally, it is also possible that NRAMP1-variant homozygoteswho are infected with M. tuberculosis in childhood succumb tothe disease rapidly and are therefore not overrepresented amongadults with tuberculosis.
The association of NRAMP1 variation with a major infectiousdisease provides support for the strategy of mapping and identifyinggenes for resistance to infectious disease in mice and thentesting their homologues as candidate genes for susceptibilityto related infections in humans. Further analysis of the mechanismof action of NRAMP1 and its genetic variants may lead to newapproaches to controlling tuberculosis, which kills more peoplethan any other disease caused by an infectious pathogen.33
Supported by a grant from the Wellcome Trust (044418/Z/95/Z/139).Dr. Bellamy is a Wellcome Trust Training Fellow in TropicalMedicine, and Dr. Hill is a Wellcome Trust Principal ResearchFellow.
We are indebted to all the subjects who agreed to participatein this study; to Gambian National Tuberculosis Control ProgrammeDirectors Drs. V. Bouchier and K. Manneh and their staff, especiallyM. Saidykhan, K. Bayang, E. Mendy, M. Jallow, M. Sanyang, andS. Gassama, for their assistance; and to field workers Y. Soweand M. Jawo and other Medical Research Council staff, especiallyS. Sabally, S. Obarro, K. Joof, E. Harding, V. Thomas, P. Langfield,and P. Njie, for their assistance.
Source Information
From the Wellcome Trust Centre for Human Genetics, Oxford University, Oxford, United Kingdom (R.B., C.R., A.V.S.H.), and the Medical Research Council Laboratories, Fajara, the Gambia (T.C., K.P.W.J.M., H.C.W.).
Address reprint requests to Professor Hill at the Wellcome Trust Centre for Human Genetics, Windmill Rd., Oxford OX3 7BN, United Kingdom.
References
Plant JE, Glynn A. Genetics of resistance to infection with Salmonella typhimurium in mice. J Infect Dis 1976;133:72-78. [Medline]
Bradley DJ. Regulation of Leishmania populations within the host. II. Genetic control of acute susceptibility of mice to Leishmania donovani infection. Clin Exp Immunol 1977;30:130-140. [Medline]
Gros P, Skamene E, Forget A. Genetic control of natural resistance to Mycobacterium bovis BCG in mice. J Immunol 1981;127:417-421. [Abstract]
Goto Y, Buschman E, Skamene E. Regulation of host resistance to Mycobacterium intracellulare in vivo and in vitro by the Bcg gene. Immunogenetics 1989;30:218-221. [CrossRef][Medline]
Skamene E, Gros P, Forget A, Patel PJ, Nesbitt MN. Regulation of resistance to leprosy by chromosome 1 locus in the mouse. Immunogenetics 1984;19:117-124. [CrossRef][Medline]
Skamene E, Gros P, Forget A, Kongshavn PAL, St Charles C, Taylor BA. Genetic regulation of resistance to intracellular pathogens. Nature 1982;297:506-509. [CrossRef][Medline]
Vidal SM, Malo D, Vogan K, Skamene E, Gros P. Natural resistance to infection with intracellular parasites: isolation of a candidate for Bcg. Cell 1993;73:469-485. [CrossRef][Medline]
Malo D, Vogan K, Vidal S, et al. Haplotype mapping and sequence analysis of the mouse Nramp gene predict susceptibility to infection with intracellular parasites. Genomics 1994;23:51-61. [CrossRef][Medline]
Vidal S, Tremblay ML, Govoni G, et al. The Ity/Lsh/Bcg locus: natural resistance to infection with intracellular parasites is abrogated by disruption of the Nramp1 gene. J Exp Med 1995;182:655-666. [Free Full Text]
Govoni G, Vidal S, Gauthier S, Skamene E, Malo D, Gros P. The Bcg/Ity/Lsh locus: genetic transfer of resistance to infections in C57BL/6J mice transgenic for the Nramp1Gly169 allele. Infect Immun 1996;64:2923-2929. [Abstract]
Stead WW, Senner JW, Reddick WT, Lofgren JP. Racial differences in susceptibility to infection by Mycobacterium tuberculosis. N Engl J Med 1990;322:422-427. [Abstract]
Stead WW. Genetics and resistance to tuberculosis: could resistance be enhanced by genetic engineering? Ann Intern Med 1992;116:937-941.
Kallmann FJ, Reisner D. Twin studies on the significance of genetic factors in tuberculosis. Am Rev Tuberc 1942;47:549-74.
Comstock GW. Tuberculosis in twins: a re-analysis of the Prophit survey. Am Rev Respir Dis 1978;117:621-624. [Medline]
Cellier M, Govoni G, Vidal S, et al. Human natural resistance-associated macrophage protein: cDNA cloning, chromosomal mapping, genomic organization, and tissue-specific expression. J Exp Med 1994;180:1741-1752. [Free Full Text]
Blackwell JM, Barton CH, White JK, et al. Genomic organization and sequence of the human NRAMP gene: identification and mapping of a promoter region polymorphism. Mol Med 1995;1:194-205. [Medline]
White JK, Shaw M-A, Barton CH, et al. Genetic and physical mapping of 2q35 in the region of the NRAMP and IL8R genes: identification ofa polymorphic repeat in exon 2 of NRAMP. Genomics 1994;24:295-302. [CrossRef][Medline]
Liu J, Fujiwara TM, Buu NT, et al. Identification of polymorphisms and sequence variants in the human homologue of the mouse natural resistance-associated macrophage protein gene. Am J Hum Genet 1995;56:845-853. [Medline]
Lewis L-A, Victor TC, Helden EGH, et al. Identification of C to T mutation at position -236 bp in the human NRAMP1 gene promoter. Immunogenetics 1996;44:309-311. [Medline]
Allsopp CEM, Harding RM, Taylor C, et al. Interethnic genetic differentiation in Africa: HLA class I antigens in the Gambia. Am J Hum Genet 1992;50:411-421. [Medline]
Ziegle JS, Su Y, Corcoran KP, et al. Application of automated DNA sizing technology for genotyping microsatellite loci. Genomics 1992;14:1026-1031. [CrossRef][Medline]
Rook GAW. Role of activated macrophages in the immunopathology of tuberculosis. Br Med Bull 1988;44:611-623. [Free Full Text]
Murray CJL, Styblo K, Rouillon A. Tuberculosis in developing countries: burden, intervention and cost. Bull Int Union Tuberc Lung Dis 1990;65:6-24. [Medline]
Blackwell JM. Structure and function of the natural-resistance-associated macrophage protein (Nramp1), a candidate protein for infectious and autoimmune disease susceptibility. Mol Med Today 1996;2:205-211. [CrossRef][Medline]
Stach JL, Gros P, Forget A, Skamene E. Phenotypic expression of genetically-controlled natural resistance to Mycobacterium bovis (BCG). J Immunol 1984;132:888-892. [Abstract]
Denis M, Forget A, Pelletier M, Gervais F, Skamene E. Killing of Mycobacterium smegmatis by macrophages from genetically susceptible and resistant mice. J Leukoc Biol 1990;47:25-30. [Abstract]
Lissner CR, Swanson RN, O'Brien AD. Genetic control of the innate resistance of mice to Salmonella typhimurium: expression of the Ity gene in peritoneal and splenic macrophages isolated in vitro. J Immunol 1983;131:3006-3013. [Abstract]
Crocker PR, Blackwell JM, Bradley DJ. Expression of the natural resistance gene Lsh in resident liver macrophages. Infect Immun 1984;43:1033-1040. [Free Full Text]
Gruenheid S, Pinner E, Desjardins M, Gros P. Natural resistance to infection with intracellular pathogens: the Nramp 1 protein is recruited to the membrane of the phagosome. J Exp Med 1997;185:717-730. [Free Full Text]
Supek F, Supekova L, Nelson H, Nelson N. A yeast manganese transporter related to the macrophage protein involved in conferring resistance to mycobacteria. Proc Natl Acad Sci U S A 1996;93:5105-5110. [Free Full Text]
Gunshin H, Mackenzie B, Berger UV, et al. Cloning and characterization of a mammalian proton-coupled metal-ion transporter. Nature 1997;388:482-488. [CrossRef][Medline]
Fleming MD, Trenor CC III, Su MA, et al. Microcytic anaemia mice have a mutation in Nramp2, a candidate iron transporter gene. Nat Genet 1997;16:383-386. [CrossRef][Medline]
Murray CJ, Lopez AD. Mortality by cause for eight regions of the world: Global Burden of Disease Study. Lancet 1997;349:1269-1276. [CrossRef][Medline]
Cooke, G. S., Campbell, S. J., Bennett, S., Lienhardt, C., McAdam, K. P. W. J., Sirugo, G., Sow, O., Gustafson, P., Mwangulu, F., van Helden, P., Fine, P., Hoal, E. G., Hill, A. V. S.
(2008). Mapping of a Novel Susceptibility Locus Suggests a Role for MC3R and CTSZ in Human Tuberculosis. Am. J. Respir. Crit. Care Med.
178: 203-207
[Abstract][Full Text]
van der Eijk, E. A., van de Vosse, E., Vandenbroucke, J. P., van Dissel, J. T.
(2007). Heredity versus Environment in Tuberculosis in Twins: The 1950s United Kingdom Prophit Survey Simonds and Comstock Revisited. Am. J. Respir. Crit. Care Med.
176: 1281-1288
[Abstract][Full Text]
Tanaka, G., Shojima, J., Matsushita, I., Nagai, H., Kurashima, A., Nakata, K., Toyota, E., Kobayashi, N., Kudo, K., Keicho, N.
(2007). Pulmonary Mycobacterium avium complex infection: association with NRAMP1 polymorphisms. Eur Respir J
30: 90-96
[Abstract][Full Text]
Kao, R.R, Gravenor, M.B, Charleston, B, Hope, J.C, Martin, M, Howard, C.J
(2007). Mycobacterium bovis shedding patterns from experimentally infected calves and the effect of concurrent infection with bovine viral diarrhoea virus. J R Soc Interface
4: 545-551
[Abstract][Full Text]
Milburn, H.
(2007). Key issues in the diagnosis and management of tuberculosis. JRSM
100: 134-141
[Full Text]
Fernando, S. L., Saunders, B. M., Sluyter, R., Skarratt, K. K., Goldberg, H., Marks, G. B., Wiley, J. S., Britton, W. J.
(2007). A Polymorphism in the P2X7 Gene Increases Susceptibility to Extrapulmonary Tuberculosis. Am. J. Respir. Crit. Care Med.
175: 360-366
[Abstract][Full Text]
Markel, T. A., Crisostomo, P. R., Wang, M., Herring, C. M., Meldrum, K. K., Lillemoe, K. D., Meldrum, D. R.
(2007). The struggle for iron: gastrointestinal microbes modulate the host immune response during infection. J. Leukoc. Biol.
81: 393-400
[Abstract][Full Text]
Olakanmi, O., Schlesinger, L. S., Britigan, B. E.
(2007). Hereditary hemochromatosis results in decreased iron acquisition and growth by Mycobacterium tuberculosis within human macrophages. J. Leukoc. Biol.
81: 195-204
[Abstract][Full Text]
Lam-Yuk-Tseung, S., Picard, V., Gros, P.
(2006). Identification of a Tyrosine-based Motif (YGSI) in the Amino Terminus of Nramp1 (Slc11a1) That Is Important for Lysosomal Targeting. J. Biol. Chem.
281: 31677-31688
[Abstract][Full Text]
Cooke, G. S., Campbell, S. J., Sillah, J., Gustafson, P., Bah, B., Sirugo, G., Bennett, S., McAdam, K. P. W. J., Sow, O., Lienhardt, C., Hill, A. V. S.
(2006). Polymorphism within the Interferon-{gamma}/Receptor Complex Is Associated with Pulmonary Tuberculosis. Am. J. Respir. Crit. Care Med.
174: 339-343
[Abstract][Full Text]
Baghdadi, J. E., Orlova, M., Alter, A., Ranque, B., Chentoufi, M., Lazrak, F., Archane, M. I., Casanova, J.-L., Benslimane, A., Schurr, E., Abel, L.
(2006). An autosomal dominant major gene confers predisposition to pulmonary tuberculosis in adults. JEM
203: 1679-1684
[Abstract][Full Text]
Tosh, K., Campbell, S. J., Fielding, K., Sillah, J., Bah, B., Gustafson, P., Manneh, K., Lisse, I., Sirugo, G., Bennett, S., Aaby, P., McAdam, K. P. W. J., Bah-Sow, O., Lienhardt, C., Kramnik, I., Hill, A. V. S.
(2006). Variants in the SP110 gene are associated with genetic susceptibility to tuberculosis in West Africa. Proc. Natl. Acad. Sci. USA
103: 10364-10368
[Abstract][Full Text]
Borriello, G., Capparelli, R., Bianco, M., Fenizia, D., Alfano, F., Capuano, F., Ercolini, D., Parisi, A., Roperto, S., Iannelli, D.
(2006). Genetic Resistance to Brucella abortus in the Water Buffalo (Bubalus bubalis). Infect. Immun.
74: 2115-2120
[Abstract][Full Text]
Filliol, I., Motiwala, A. S., Cavatore, M., Qi, W., Hazbon, M. H., Bobadilla del Valle, M., Fyfe, J., Garcia-Garcia, L., Rastogi, N., Sola, C., Zozio, T., Guerrero, M. I., Leon, C. I., Crabtree, J., Angiuoli, S., Eisenach, K. D., Durmaz, R., Joloba, M. L., Rendon, A., Sifuentes-Osornio, J., Ponce de Leon, A., Cave, M. D., Fleischmann, R., Whittam, T. S., Alland, D.
(2006). Global Phylogeny of Mycobacterium tuberculosis Based on Single Nucleotide Polymorphism (SNP) Analysis: Insights into Tuberculosis Evolution, Phylogenetic Accuracy of Other DNA Fingerprinting Systems, and Recommendations for a Minimal Standard SNP Set. J. Bacteriol.
188: 759-772
[Abstract][Full Text]
Delgado, J. C., Baena, A., Thim, S., Goldfeld, A. E.
(2006). Aspartic Acid Homozygosity at Codon 57 of HLA-DQ {beta} Is Associated with Susceptibility to Pulmonary Tuberculosis in Cambodia. J. Immunol.
176: 1090-1097
[Abstract][Full Text]
Flores-Villanueva, P. O., Ruiz-Morales, J. A., Song, C.-H., Flores, L. M., Jo, E.-K., Montano, M., Barnes, P. F., Selman, M., Granados, J.
(2005). A functional promoter polymorphism in monocyte chemoattractant protein-1 is associated with increased susceptibility to pulmonary tuberculosis. JEM
202: 1649-1658
[Abstract][Full Text]
Smith, I., Nathan, C., Peavy, H. H.
(2005). Progress and New Directions in Genetics of Tuberculosis: An NHLBI Working Group Report. Am. J. Respir. Crit. Care Med.
172: 1491-1496
[Abstract][Full Text]
Majorov, K. B., Eruslanov, E. B., Rubakova, E. I., Kondratieva, T. K., Apt, A. S.
(2005). Analysis of Cellular Phenotypes That Mediate Genetic Resistance to Tuberculosis Using a Radiation Bone Marrow Chimera Approach. Infect. Immun.
73: 6174-6178
[Abstract][Full Text]
Malik, S., Abel, L., Tooker, H., Poon, A., Simkin, L., Girard, M., Adams, G. J., Starke, J. R., Smith, K. C., Graviss, E. A., Musser, J. M., Schurr, E.
(2005). Alleles of the NRAMP1 gene are risk factors for pediatric tuberculosis disease. Proc. Natl. Acad. Sci. USA
102: 12183-12188
[Abstract][Full Text]
Koh, W.-J., Kwon, O. J., Kim, E. J., Lee, K. S., Ki, C.-S., Kim, J. W.
(2005). NRAMP1 Gene Polymorphism and Susceptibility to Nontuberculous Mycobacterial Lung Diseases. Chest
128: 94-101
[Abstract][Full Text]
Schluger, N. W.
(2005). The Pathogenesis of Tuberculosis: The First One Hundred (and Twenty-Three) Years. Am. J. Respir. Cell Mol. Bio.
32: 251-256
[Full Text]
Wagner, D., Maser, J., Moric, I., Boechat, N., Vogt, S., Gicquel, B., Lai, B., Reyrat, J.-M., Bermudez, L.
(2005). Changes of the phagosomal elemental concentrations by Mycobacterium tuberculosis Mramp. Microbiology
151: 323-332
[Abstract][Full Text]
Boyartchuk, V., Rojas, M., Yan, B.-S., Jobe, O., Hurt, N., Dorfman, D. M., Higgins, D. E., Dietrich, W. F., Kramnik, I.
(2004). The Host Resistance Locus sst1 Controls Innate Immunity to Listeria monocytogenes Infection in Immunodeficient Mice. J. Immunol.
173: 5112-5120
[Abstract][Full Text]
FITNESS, J., FLOYD, S., WARNDORFF, D. K., SICHALI, L., MWAUNGULU, L., CRAMPIN, A. C., FINE, P. E. M., HILL, A. V. S.
(2004). LARGE-SCALE CANDIDATE GENE STUDY OF LEPROSY SUSCEPTIBILITY IN THE KARONGA DISTRICT OF NORTHERN MALAWI. Am J Trop Med Hyg
71: 330-340
[Abstract][Full Text]
FITNESS, J., FLOYD, S., WARNDORFF, D. K., SICHALI, L., MALEMA, S., CRAMPIN, A. C., FINE, P. E. M., HILL, A. V. S.
(2004). LARGE-SCALE CANDIDATE GENE STUDY OF TUBERCULOSIS SUSCEPTIBILITY IN THE KARONGA DISTRICT OF NORTHERN MALAWI. Am J Trop Med Hyg
71: 341-349
[Abstract][Full Text]
Dorman, S. E., Hatem, C. L., Tyagi, S., Aird, K., Lopez-Molina, J., Pitt, M. L. M., Zook, B. C., Dannenberg, A. M. Jr., Bishai, W. R., Manabe, Y. C.
(2004). Susceptibility to Tuberculosis: Clues from Studies with Inbred and Outbred New Zealand White Rabbits. Infect. Immun.
72: 1700-1705
[Abstract][Full Text]
Ogus, A.C., Yoldas, B., Ozdemir, T., Uguz, A., Olcen, S., Keser, I., Coskun, M., Cilli, A., Yegin, O.
(2004). The Arg753Gln polymorphism of the human Toll-like receptor 2 gene in tuberculosis disease. Eur Respir J
23: 219-223
[Abstract][Full Text]
Saunders, B. M., Fernando, S. L., Sluyter, R., Britton, W. J., Wiley, J. S.
(2003). A Loss-of-Function Polymorphism in the Human P2X7 Receptor Abolishes ATP-Mediated Killing of Mycobacteria. J. Immunol.
171: 5442-5446
[Abstract][Full Text]
Turner, O. C., Keefe, R. G., Sugawara, I., Yamada, H., Orme, I. M.
(2003). SWR Mice Are Highly Susceptible to Pulmonary Infection with Mycobacterium tuberculosis. Infect. Immun.
71: 5266-5272
[Abstract][Full Text]
Sato, K., Tomioka, H., Sano, C., Shimizu, T., Sano, K., Ogasawara, K., Cai, S., Kamei, T.
(2003). Comparative antimicrobial activities of gatifloxacin, sitafloxacin and levofloxacin against Mycobacterium tuberculosis replicating within Mono Mac 6 human macrophage and A-549 type II alveolar cell lines. J Antimicrob Chemother
52: 199-203
[Abstract][Full Text]
Mitsos, L.-M., Cardon, L. R., Ryan, L., LaCourse, R., North, R. J., Gros, P.
(2003). Susceptibility to tuberculosis: A locus on mouse chromosome 19 (Trl-4) regulates Mycobacterium tuberculosis replication in the lungs. Proc. Natl. Acad. Sci. USA
100: 6610-6615
[Abstract][Full Text]
Bellamy, R.
(2003). Interferon-{gamma} and Host Susceptibility to Tuberculosis. Am. J. Respir. Crit. Care Med.
167: 946-947
[Full Text]
Lopez-Maderuelo, D., Arnalich, F., Serantes, R., Gonzalez, A., Codoceo, R., Madero, R., Vazquez, J. J., Montiel, C.
(2003). Interferon-{gamma} and Interleukin-10 Gene Polymorphisms in Pulmonary Tuberculosis. Am. J. Respir. Crit. Care Med.
167: 970-975
[Abstract][Full Text]
Majorov, K. B., Lyadova, I. V., Kondratieva, T. K., Eruslanov, E. B., Rubakova, E. I., Orlova, M. O., Mischenko, V. V., Apt, A. S.
(2003). Different Innate Ability of I/St and A/Sn Mice To Combat Virulent Mycobacterium tuberculosis: Phenotypes Expressed in Lung and Extrapulmonary Macrophages. Infect. Immun.
71: 697-707
[Abstract][Full Text]
Sanchez, F., Radaeva, T. V., Nikonenko, B. V., Persson, A.-S., Sengul, S., Schalling, M., Schurr, E., Apt, A. S., Lavebratt, C.
(2003). Multigenic Control of Disease Severity after Virulent Mycobacterium tuberculosis Infection in Mice. Infect. Immun.
71: 126-131
[Abstract][Full Text]
VI, J. G. T., Tang, D. C., Savage, S. A., Leitman, S. F., Heller, S. I., Serjeant, G. R., Rodgers, G. P., Chanock, S. J.
(2002). Variants in the VCAM1 gene and risk for symptomatic stroke in sickle cell disease. Blood
100: 4303-4309
[Abstract][Full Text]
Cooke, G. S., Segal, S., Hill, A. V.S., the Tuberculosis, Genetics, and Environment (TBGEN, , Beutler, B., Beutler, E., Kiechl, S., Willeit, J., Schwartz, D. A.
(2002). Toll-like Receptor 4 Polymorphisms and Atherogenesis. NEJM
347: 1978-1980
[Full Text]
Karplus, T. M., Jeronimo, S. M. B., Chang, H., Helms, B. K., Burns, T. L., Murray, J. C., Mitchell, A. A., Pugh, E. W., Braz, R. F. S., Bezerra, F. L., Wilson, M. E.
(2002). Association between the Tumor Necrosis Factor Locus and the Clinical Outcome of Leishmania chagasi Infection. Infect. Immun.
70: 6919-6925
[Abstract][Full Text]
Gooding, T. M., Johnson, P. D. R., Smith, M., Kemp, A. S., Robins-Browne, R. M.
(2002). Cytokine Profiles of Patients Infected with Mycobacterium ulcerans and Unaffected Household Contacts. Infect. Immun.
70: 5562-5567
[Abstract][Full Text]
Gruppo, V., Turner, O. C., Orme, I. M., Turner, J.
(2002). Reduced up-regulation of memory and adhesion/integrin molecules in susceptible mice and poor expression of immunity to pulmonary tuberculosis. Microbiology
148: 2959-2966
[Abstract][Full Text]
Sharma, S. K., Balamurugan, A., Saha, P. K., Pandey, R. M., Mehra, N. K.
(2002). Evaluation of Clinical and Immunogenetic Risk Factors for the Development of Hepatotoxicity during Antituberculosis Treatment. Am. J. Respir. Crit. Care Med.
166: 916-919
[Abstract][Full Text]
Hernandez-Garduno, E., Kunimoto, D., Wang, L., Rodrigues, M., Elwood, R. K., Black, W., Mak, S., FitzGerald, J. M.
(2002). Predictors of clustering of tuberculosis in Greater Vancouver: a molecular epidemiologic study. CMAJ
167: 349-352
[Abstract][Full Text]
Calhoun, E. S., McGovern, R. M., Janney, C. A., Cerhan, J. R., Iturria, S. J., Smith, D. I., Gostout, B. S., Persing, D. H.
(2002). Host Genetic Polymorphism Analysis in Cervical Cancer. Clin. Chem.
48: 1218-1224
[Abstract][Full Text]
Lipsitch, M., Sousa, A. O.
(2002). Historical Intensity of Natural Selection for Resistance to Tuberculosis. Genetics
161: 1599-1607
[Abstract][Full Text]
Cervino, A. C. L., Lakiss, S., Sow, O., Bellamy, R., Beyers, N., Hoal-van Helden, E., van Helden, P., McAdam, K. P. W. J., Hill, A. V. S.
(2002). Fine mapping of a putative tuberculosis-susceptibility locus on chromosome 15q11-13 in African families. Hum Mol Genet
11: 1599-1603
[Abstract][Full Text]
Canonne-Hergaux, F., Calafat, J., Richer, E., Cellier, M., Grinstein, S., Borregaard, N., Gros, P.
(2002). Expression and subcellular localization of NRAMP1 in human neutrophil granules. Blood
100: 268-275
[Abstract][Full Text]
Lienhardt, C., Bennett, S., Del Prete, G., Bah-Sow, O., Newport, M., Gustafson, P., Manneh, K., Gomes, V., Hill, A., McAdam, K.
(2002). Investigation of Environmental and Host-related Risk Factors for Tuberculosis in Africa. I. Methodological Aspects of a Combined Design. Am J Epidemiol
155: 1066-1073
[Abstract][Full Text]
Bennett, S., Lienhardt, C., Bah-Sow, O., Gustafson, P., Manneh, K., Del Prete, G., Gomes, V., Newport, M., McAdam, K., Hill, A.
(2002). Investigation of Environmental and Host-related Risk Factors for Tuberculosis in Africa. II. Investigation of Host Genetic Factors. Am J Epidemiol
155: 1074-1079
[Abstract][Full Text]
Roig, E. A., Richer, E., Canonne-Hergaux, F., Gros, P., Cellier, M. F. M.
(2002). Regulation of NRAMP1 gene expression by 1{alpha},25-dihydroxy-vitamin D3 in HL-60 phagocytes. J. Leukoc. Biol.
71: 890-904
[Abstract][Full Text]
van Crevel, R., Ottenhoff, T. H. M., van der Meer, J. W. M.
(2002). Innate Immunity to Mycobacterium tuberculosis. Clin. Microbiol. Rev.
15: 294-309
[Abstract][Full Text]
Subramanian, G., Adams, M. D., Venter, J. C., Broder, S.
(2001). Implications of the Human Genome for Understanding Human Biology and Medicine. JAMA
286: 2296-2307
[Abstract][Full Text]
Estrada-Chavez, C., Pereira-Suarez, A. L., Meraz, M. A., Arriaga, C., Garcia-Carranca, A., Sanchez-Rodriguez, C., Mancilla, R.
(2001). High-Level Expression of NRAMP1 in Peripheral Blood Cells and Tuberculous Granulomas from Mycobacterium bovis-Infected Bovines. Infect. Immun.
69: 7165-7168
[Abstract][Full Text]
Fairbairn, I. P., Stober, C. B., Kumararatne, D. S., Lammas, D. A.
(2001). ATP-Mediated Killing of Intracellular Mycobacteria by Macrophages Is a P2X7-Dependent Process Inducing Bacterial Death by Phagosome-Lysosome Fusion. J. Immunol.
167: 3300-3307
[Abstract][Full Text]
Fortin, A., Cardon, L. R., Tam, M., Skamene, E., Stevenson, M. M., Gros, P.
(2001). Identification of a malaria new susceptibility locus (Char4) in recombinant congenic strains of mice. Proc. Natl. Acad. Sci. USA
10.1073/pnas.191288998v1
[Abstract][Full Text]
Dheenadhayalan, V., Shanmugalakshmi, S., Vani, S., Muthuveeralakshmi, P., Arivarignan, G., Nageswari, A. D., Pitchappan, R M.
(2001). Association of Interleukin-10 Cytokine Expression Status with HLA Non-DRB1*02 and Mycobacterium bovis BCG Scar-Negative Status in South Indian Pulmonary Tuberculosis Patients. Infect. Immun.
69: 5635-5642
[Abstract][Full Text]
SCHURMANN, M., REICHEL, P., MULLER-MYHSOK, B., SCHLAAK, M., MULLER-QUERNHEIM, J., SCHWINGER, E.
(2001). Results from a Genome-wide Search for Predisposing Genes in Sarcoidosis. Am. J. Respir. Crit. Care Med.
164: 840-846
[Abstract][Full Text]
Davies, P D O, Grange, J M
(2001). Factors affecting susceptibility and resistance to tuberculosis. Thorax
56: ii23-29
[Full Text]
Jepson, A., Fowler, A., Banya, W., Singh, M., Bennett, S., Whittle, H., Hill, A. V. S.
(2001). Genetic Regulation of Acquired Immune Responses to Antigens of Mycobacterium tuberculosis: a Study of Twins in West Africa. Infect. Immun.
69: 3989-3994
[Abstract][Full Text]
Schwartz, R. S.
(2001). Racial Profiling in Medical Research. NEJM
344: 1392-1393
[Full Text]
Buschman, E., Skamene, E.
(2001). From Bcg/Lsh/Ity to Nramp1: Three Decades of Search and Research. Drug Metab. Dispos.
29: 471-473
[Full Text]
Marquet, S., Schurr, E.
(2001). Genetics of Susceptibility to Infectious Diseases: Tuberculosis and Leprosy as Examples. Drug Metab. Dispos.
29: 479-483
[Full Text]
Chackerian, A. A., Perera, T. V., Behar, S. M.
(2001). Gamma Interferon-Producing CD4+ T Lymphocytes in the Lung Correlate with Resistance to Infection with Mycobacterium tuberculosis. Infect. Immun.
69: 2666-2674
[Abstract][Full Text]
Dietrich, W. F.
(2001). Using Mouse Genetics to Understand Infectious Disease Pathogenesis. Genome Res
11: 325-331
[Full Text]
Kempainen, R., Nelson, K., Williams, D. N., Hedemark, L.
(2001). Mycobacterium tuberculosis Disease in Somali Immigrants in Minnesota. Chest
119: 176-180
[Abstract][Full Text]
Jabado, N., Jankowski, A., Dougaparsad, S., Picard, V., Grinstein, S., Gros, P.
(2000). Natural resistance to intracellular infections: natural resistance-associated macrophage protein 1 (NRAMP1) functions as a pH-dependent manganese transporter at the phagosomal membrane. JEM
192: 1237-1248
[Abstract][Full Text]
Kwiatkowski, D.
(2000). Science, medicine, and the future: Susceptibility to infection. BMJ
321: 1061-1065
[Full Text]
Roberts, L. J, Handman, E., Foote, S. J
(2000). Science, medicine, and the future: Leishmaniasis. BMJ
321: 801-804
[Full Text]
Pal, S., Peterson, E. M., de la Maza, L. M.
(2000). Role of Nramp1 Deletion in Chlamydia Infection in Mice. Infect. Immun.
68: 4831-4833
[Abstract][Full Text]
MOSS, A. R., HAHN, J. A., TULSKY, J. P., DALEY, C. L., SMALL, P. M., HOPEWELL, P. C.
(2000). Tuberculosis in the Homeless . A Prospective Study. Am. J. Respir. Crit. Care Med.
162: 460-464
[Abstract][Full Text]
Chin, D. P., Crane, C. M., Diul, M. Y., Sun, S. J., Agraz, R., Taylor, S., Desmond, E., Wise, F.
(2000). Spread of Mycobacterium tuberculosis in a Community Implementing Recommended Elements of Tuberculosis Control. JAMA
283: 2968-2974
[Abstract][Full Text]
Maliarik, M. J., Chen, K. M., Sheffer, R. G., Rybicki, B. A., Major, M. L., Popovich, J. Jr., Iannuzzi, M. C.
(2000). The Natural Resistance-Associated Macrophage Protein Gene in African Americans with Sarcoidosis. Am. J. Respir. Cell Mol. Bio.
22: 672-675
[Abstract][Full Text]
Musser, J. M., Amin, A., Ramaswamy, S.
(2000). Negligible Genetic Diversity of Mycobacterium tuberculosis Host Immune System Protein Targets: Evidence of Limited Selective Pressure. Genetics
155: 7-16
[Abstract][Full Text]
TANAKA, E., KIMOTO, T., MATSUMOTO, H., TSUYUGUCHI, K., SUZUKI, K., NAGAI, S., SHIMADZU, M., ISHIBATAKE, H., MURAYAMA, T., AMITANI, R.
(2000). Familial Pulmonary Mycobacterium avium Complex Disease. Am. J. Respir. Crit. Care Med.
161: 1643-1647
[Abstract][Full Text]
nbecher, T. L., Foster, C. B., Zhu, S., Venzon, D., Steinberg, S. M., Wyvill, K., Metcalf, J. A., Cohen, S. S., Kovacs, J., Yarchoan, R., Blauvelt, A., Chanock, S. J.
(2000). Variant genotypes of Fcgamma RIIIA influence the development of Kaposi's sarcoma in HIV-infected men. Blood
95: 2386-2390
[Abstract][Full Text]
GRAHAM, A M, DOLLINGER, M M, HOWIE, S E M, HARRISON, D J
(2000). Identification of novel alleles at a polymorphic microsatellite repeat region in the human NRAMP1 gene promoter: analysis of allele frequencies in primary biliary cirrhosis. J. Med. Genet.
37: 150-152
[Full Text]
North, R. J., LaCourse, R., Ryan, L., Gros, P.
(1999). Consequence of Nramp1 Deletion to Mycobacterium tuberculosis Infection in Mice. Infect. Immun.
67: 5811-5814
[Abstract][Full Text]
Agranoff, D., Monahan, I. M., Mangan, J. A., Butcher, P. D., Krishna, S.
(1999). Mycobacterium tuberculosis Expresses a Novel pH-dependent Divalent Cation Transporter Belonging to the Nramp Family. JEM
190: 717-724
[Abstract][Full Text]
Rolfs, A., Hediger, M. A
(1999). Metal ion transporters in mammals: structure, function and pathological implications. J. Physiol.
518: 1-12
[Abstract][Full Text]
Wilkinson, R. J., Patel, P., Llewelyn, M., Hirsch, C. S., Pasvol, G., Snounou, G., Davidson, R. N., Toossi, Z.
(1999). Influence of Polymorphism in the Genes for the Interleukin (IL)-1 Receptor Antagonist and IL-1beta on Tuberculosis. JEM
189: 1863-1874
[Abstract][Full Text]
Canonne-Hergaux, F., Gruenheid, S., Ponka, P., Gros, P.
(1999). Cellular and Subcellular Localization of the Nramp2 Iron Transporter in the Intestinal Brush Border and Regulation by Dietary Iron. Blood
93: 4406-4417
[Abstract][Full Text]
Rhee, J. T., Piatek, A. S., Small, P. M., Harris, L. M., Chaparro, S. V., Kramer, F. R., Alland, D.
(1999). Molecular Epidemiologic Evaluation of Transmissibility and Virulence of Mycobacterium tuberculosis. J. Clin. Microbiol.
37: 1764-1770
[Abstract][Full Text]
Govoni, G., Canonne-Hergaux, F., Pfeifer, C. G., Marcus, S. L., Mills, S. D., Hackam, D. J., Grinstein, S., Malo, D., Finlay, B. B., Gros, P.
(1999). Functional Expression of Nramp1 In Vitro in the Murine Macrophage Line RAW264.7. Infect. Immun.
67: 2225-2232
[Abstract][Full Text]
Huang, J. H., Kao, P. N., Adi, V., Ruoss, S. J.
(1999). Mycobacterium avium-intracellulare Pulmonary Infection in HIV-Negative Patients Without Preexisting Lung Disease: Diagnostic and Management Limitations. Chest
115: 1033-1040
[Abstract][Full Text]
Searle, S., Blackwell, J. M
(1999). Evidence for a functional repeat polymorphism in the promoter of the human NRAMP1 gene that correlates with autoimmune versus infectious disease susceptibility. J. Med. Genet.
36: 295-299
[Abstract][Full Text]
Gruenheid, S., Canonne-Hergaux, F., Gauthier, S., Hackam, D. J., Grinstein, S., Gros, P.
(1999). The Iron Transport Protein NRAMP2 Is an Integral Membrane Glycoprotein That Colocalizes with Transferrin in Recycling Endosomes. JEM
189: 831-841
[Abstract][Full Text]
Teran-Escandon, D., Teran-Ortiz, L., Camarena-Olvera, A., Gonzalez-Avila, G., Vaca-Marin, M. A., Granados, J., Selman, M.
(1999). Human Leukocyte Antigen-Associated Susceptibility to Pulmonary Tuberculosis: Molecular Analysis of Class II Alleles by DNA Amplification and Oligonucleotide Hybridization in Mexican Patients. Chest
115: 428-433
[Abstract][Full Text]
D'Souza, J, Cheah, P., Gros, P, Chia, W, Rodrigues, V
(1999). Functional complementation of the malvolio mutation in the taste pathway of Drosophila melanogaster by the human natural resistance-associated macrophage protein 1 (Nramp-1). J. Exp. Biol.
202: 1909-1915
[Abstract]
Borgdorff, M. W., Miles, T. P., McBride, D., Bellamy, R., Hill, A. V.S., Bloom, B. R., Small, P. M.
(1998). The NRAMP1 Gene and Susceptibility to Tuberculosis. NEJM
339: 199-201
[Full Text]
Bloom, B. R., Small, P. M.
(1998). The Evolving Relation between Humans and Mycobacterium tuberculosis. NEJM
338: 677-678
[Full Text]
Manca, C., Tsenova, L., Bergtold, A., Freeman, S., Tovey, M., Musser, J. M., Barry, C. E. III, Freedman, V. H., Kaplan, G.
(2001). Virulence of a Mycobacterium tuberculosis clinical isolate in mice is determined by failure to induce Th1 type immunity and is associated with induction of IFN-alpha /beta. Proc. Natl. Acad. Sci. USA
98: 5752-5757
[Abstract][Full Text]
Bellamy, R., Beyers, N., McAdam, K. P. W. J., Ruwende, C., Gie, R., Samaai, P., Bester, D., Meyer, M., Corrah, T., Collin, M., Camidge, D. R., Wilkinson, D., Hoal-van Helden, E., Whittle, H. C., Amos, W., van Helden, P., Hill, A. V. S.
(2000). Genetic susceptibility to tuberculosis in Africans: A genome-wide scan. Proc. Natl. Acad. Sci. USA
97: 8005-8009
[Abstract][Full Text]
Kramnik, I., Dietrich, W. F., Demant, P., Bloom, B. R.
(2000). Genetic control of resistance to experimental infection with virulent Mycobacterium tuberculosis. Proc. Natl. Acad. Sci. USA
97: 8560-8565
[Abstract][Full Text]
Fortin, A., Cardon, L. R., Tam, M., Skamene, E., Stevenson, M. M., Gros, P.
(2001). Identification of a new malaria susceptibility locus (Char4) in recombinant congenic strains of mice. Proc. Natl. Acad. Sci. USA
98: 10793-10798
[Abstract][Full Text]