Molecular Analysis of the Progression from Helicobacter pyloriAssociated Chronic Gastritis to Mucosa-Associated Lymphoid-Tissue Lymphoma of the Stomach
Emanuele Zucca, M.D., Francesco Bertoni, M.D., Enrico Roggero, M.D., Giovanna Bosshard, Giovanni Cazzaniga, B.Sc., Ennio Pedrinis, M.D., Andrea Biondi, M.D., and Franco Cavalli, M.D.
Several lines of evidence suggest a link between chronic gastritisdue to Helicobacter pylori and mucosa-associated lymphoid-tissue(MALT) lymphoma of the stomach.1,2 A close epidemiologic associationhas been reported.3,4,5 The microorganism can be found in thegastric mucosa in nearly all cases, and regression of low-gradegastric MALT lymphoma has been demonstrated after the eradicationof H. pylori.6,7
The suggested progression from H. pyloriassociated chronicgastritis to overt MALT lymphoma8 has not been formally demonstrated,although if it exists, such a mechanism may have important implicationsfor the treatment of H. pyloriassociated gastritis. EachB cell contains immunoglobulin heavy-chain genes in a novelconfiguration that provides a marker for small populations ofmonoclonal B cells, which can be identified in pathologicalspecimens by the polymerase chain reaction (PCR).9,10 We describetwo patients with histories of chronic H. pyloriassociatedgastritis and subsequent gastric MALT lymphoma in whom gastric-biopsysamples obtained several years before the onset of lymphomawere molecularly analyzed with a patient-specific PCR approach.We were able to show that the lymphomas arose from a B-cellclone at the site of chronic gastritis.
Case Reports
Patient 1
Patient 1 was a 36-year-old man with a six-month history ofepigastric pain for which he underwent upper gastrointestinalendoscopy, with random biopsy specimens obtained, in 1981 (Table 1).Benign gastric peptic ulcer with chronic gastritis of theantrum and the body was diagnosed. The patient was treated withantacids and remained well until 1985, when the gastric symptomsrecurred. Further endoscopic gastric biopsy confirmed the diagnosisof chronic gastritis associated with H. pylori infection. Treatmentwith ranitidine was given, with good relief of symptoms. Follow-upendoscopy in March 1990 revealed lymphoepithelial lesions andplasma-cell infiltrates in both the gastric body and the duodenum.A histologic diagnosis of low-grade MALT lymphoma was made.Routine staging procedures12 revealed stage I disease (lymphomaconfined to the gastric mucosa). The symptoms resolved withthe resumption of ranitidine treatment, and the patient declinedto undergo gastrectomy. His condition was monitored with regularendoscopy and gastric biopsy, which showed no changes in histologicfindings. In September 1993, he received a 10-day course ofamoxicillin (750 mg three times daily), metronidazole (500 mgthree times daily), and omeprazole (40 mg daily) to eradicateH. pylori. Repeated gastric biopsies from 1994 to 1996 documentedthe eradication of H. pylori but the persistence of multifocallesions of low-grade MALT lymphoma.
Table 1. Clinical Characteristics of Patient 1 and Results of Molecular Analyses.
In October 1996 endoscopy revealed a clear progression of thelow-grade lymphoma in the stomach, with diffuse and deep infiltrationof the gastric wall and duodenal invasion with stenosis of theduodenal bulb. A computed tomographic scan showed abdominaladenopathy; the results of a bone marrow biopsy were normal.He was treated with six cycles of a regimen consisting of doxorubicin,cyclophosphamide, vincristine, prednisone, and methotrexate.Complete remission was documented in June 1997. The patientwas still in remission at the most recent follow-up visit inDecember 1997.
Patient 2
Patient 2 underwent selective proximal vagotomy in 1976, atthe age of 40, followed eight years later by partial gastrectomywith a Billroth II anastomosis (Table 2). She had had severepeptic ulcer disease since the early 1970s. Pathological examinationof the stomach specimens obtained at resection showed diffusegastritis and peptic ulcer, without neoplastic tissue. In June1988 a diffuse, mixed, predominantly large cell lymphoma (groupF, according to the working formulation for the classificationof lymphoma) in the gastric stump was diagnosed by endoscopicbiopsy, and the patient was referred for staging and treatment.She reported increasing dysphagia, back pain, regurgitation,fever, night sweats, and a substantial weight loss in the precedingsix months. Her H. pylori status was not known. Abdominal ultrasonographyand computed tomographic scanning showed a large mass in theremnant gastric wall; multiple paragastric, mesenteric, andretroperitoneal lymphadenopathies; a focal liver lesion; andsplenomegaly. Radiographs and computed tomographic scans ofthe chest showed no abnormalities. Analysis of a bone marrowaspirate and trephine biopsy showed infiltration from a large-celllymphoma.
Table 2. Clinical Characteristics of Patient 2 and Results of Molecular Analyses.
The patient was treated with six courses of a regimen consistingof doxorubicin, cyclophosphamide, vincristine, prednisone, andhigh-dose methotrexate with leucovorin rescue, alternating every22 days with etoposide, bleomycin, procarbazine, and cytarabine.13She had a complete remission, but she had a relapse identifiedin bone marrow in January 1990 (the results of a gastric-stumpbiopsy were suggestive of relapse but not conclusive). She hada second complete remission after two cycles of salvage treatment14with a regimen consisting of etoposide, methylprednisolone,high-dose cytarabine, and cisplatin and subsequently underwentautologous bone marrow transplantation in September 1990. Atthe most recent follow-up visit in December 1997, she had noevidence of lymphoma.
Methods
Histologic Analysis
All slides were reviewed according to the criteria of Isaacsonand Norton15 and graded according to the histologic scoringsystem proposed by Wotherspoon et al.11 In this system a scoreof 0 indicates normal gastric mucosa; a score of 1, chronicactive gastritis with small clusters of lymphocytes in the laminapropria, without lymphoid follicles or lymphoepithelial lesions;a score of 2, chronic active gastritis with prominent lymphoidfollicles and surrounding mantle-zone and plasma cells withoutlymphoepithelial lesions; a score of 3, a probable reactivelymphoid infiltrate, with lymphoid follicles surrounded by smalllymphocytes that diffusely infiltrate the lamina propria andoccasionally the epithelium; a score of 4, a probable neoplasticlymphoid infiltrate composed of lymphoid follicles surroundedby centrocyte-like cells that diffusely penetrate the laminapropria and epithelium in small groups; and a score of 5, low-gradeMALT lymphoma with dense infiltration of centrocyte-like cellsin the lamina propria and prominent lymphoepithelial lesions.A modified Giemsa stain was used to identify H. pylori.16 Theslides were reviewed by one pathologist before and after thecompletion of the molecular analysis. For the second reviewthe pathologist was unaware of the results of the molecularanalysis. The histologic diagnoses were confirmed by a secondpathologist.
Consensus-Sequence PCR
DNA was extracted from paraffin-embedded tissue sections thatwere 10 µm thick, as previously described.17 A 268-bpsegment of the -globin gene was amplified by PCR with the PCO4(5'CAACTTCATCCACGTTCACC3') and GH20 (5'GAAGAGCCAAGGACAGGTAC3')primers (Perkin-Elmer, Norwalk, Conn.). We amplified the complementarity-determiningregion 3 (CDR3), which is the most variable region of the immunoglobulinheavy-chain gene,9 using semi-nested PCR with the FR3A primer(5'ACACGGCC[TC]GTGTATTACTGT3') for the conserved-framework-3segment of the variable region and the LJH (5'TGAGGAGACGGTGACC3')and VLJH (5'GTGACCAGGGTNCCTTGGCCCCAG3') primers for the joiningregion. PCR reactions were performed in accordance with themethods described by Diss et al.10 Samples from the patientswere analyzed in duplicate, and DNA from the Raji cell lineof human B-cell lymphoma was used as a positive control. A negativecontrol containing all PCR reagents without any template DNAwas also used. The amplification products were analyzed on 10percent nondenaturing polyacrylamide gels and visualized withultraviolet light after staining with ethidium bromide. Thepresence of a distinct single band (with or without other lessintense bands, reflecting the formation of heteroduplexes) wasconsidered to indicate monoclonality, the presence of a fewintensely stained distinct bands oligoclonality, and the presenceof a smear of amplified products polyclonality.18,19
Cloning and Sequencing of PCR Products
Monoclonal bands from at least two different lymphoma-containingsamples from each patient were excised from the polyacrylamidegel. DNA was extracted19,20 and purified with Sephacryl MicroSpinS-400 HR columns (Pharmacia, Uppsala, Sweden). Cloning and sequencingof CDR3 were performed with the pMOSBlue T-vector kit (Amersham,Little Chalfont, Buckinghamshire, United Kingdom) and a SequenaseDNA Sequencing kit (version 2.0, Amersham), according to themanufacturer's instructions.
Allele-Specific PCR
Allele-specific oligonucleotides were designed for each patientfrom the CDR3 sequences of the predominant clones (i.e., identicalclones representing at least three of six recombinants examinedfrom each patient) and used as 5' primers to perform nestedPCR in DNA from biopsy samples showing gastritis in the twopatients. The CDR3 sequences have been assigned GenBank accessionnumbers AF016207 and AF016208 in the case of the two clonesin Patient 1 and AF016215 in the case of the predominant clonein Patient 2. The first round of amplification was carried outin the same manner as the PCR for the consensus sequence ofCDR3; in the second round the allele-specific oligonucleotidewas used as a primer in conjunction with the consensus VLJHprimer. DNA from the sequenced lymphoma sample from each patientwas used as a positive control. In order to assess the specificityof the lymphoma allele-specific oligonucleotide, DNA from adisease-free specimen from the patients and DNA from the Rajicell line were analyzed. Reaction products were analyzed on10 percent nondenaturing polyacrylamide gels as described above.
Results
Patient 1
In Patient 1, chronic gastritis (histologic score, 3) was confirmedby histologic review only in the initial sample (Figure 1A),obtained in 1981. This sample had an oligoclonal pattern ofB cells on PCR assay of the CDR3 segment of the immunoglobulingene. Low-grade MALT lymphoma (histologic score, 4 or 5) wasdiagnosed in biopsy specimens obtained from 1985 onward (Figure 1Cand Figure 1D); a monoclonal rearrangement of the immunoglobulinheavy-chain gene with a similar band size was detected in allsamples (Table 1).
Figure 1. Histologic Patterns in the Evolution from Chronic Gastritis to Gastric Lymphoma.
Chronic gastritis is evident in biopsy specimens obtained in 1981 from Patient 1 (Panel A) and in 1984 from Patient 2 (Panel B) (x100). Panel C shows low-grade MALT lymphoma in the 1990 biopsy specimen from Patient 1 (x200), and Panel D shows a lymphoepithelial lesion from this specimen (x1000). A 1988 biopsy of the gastric stump in Patient 2 revealed areas of low-grade MALT lymphoma (Panel E, x200) within a high-grade, predominantly large cell lymphoma (Panel F, x1000). All specimens were stained with hematoxylin and eosin.
Sequencing analysis of the monoclonal band in the specimensof low-grade MALT lymphoma that were obtained in 1990 and 1992showed two major lymphoma clones of 97 bp and 100 bp. Becausethe two differed by only 3 bp, they could not be clearly distinguishedon gel electrophoresis. Both CDR3 sequences of these cloneswere used for allele-specific PCR, and both clones were presentin the initial (1981) sample as well as in the biopsy specimensobtained in 1985 (Table 1, Figure 2A, and Figure 2B). After1993, one of the two B-cell clones was no longer detectable(Table 1). Both CDR3 sequences were in the correct reading framefor the production of a potentially functional protein. As aresult of allelic exclusion, a B-cell clone usually producesonly a single immunoglobulin. The fact that both sequences werein the correct reading frame suggests the presence of a biclonallymphoma.
Figure 2. Results of Polyacrylamide-Gel Electrophoresis of the Immunoglobulin Heavy-Chain CDR3 PCR Products from the Two Patients.
Panel A shows the results of PCR analysis of B-cell clonality with consensus primers for the conserved-framework-3 segment of the variable region and for the joining region of the immunoglobulin heavy-chain genes. In stomach-biopsy specimens obtained at the time chronic gastritis was diagnosed (1981 in Patient 1 and 1982 in Patient 2), multiple faint bands are evident, indicating oligoclonality, whereas samples obtained at the time MALT lymphoma was diagnosed (1990 in Patient 1 and 1988 in Patient 2) show a monoclonal B-cell population. In Patient 2, a similar monoclonal pattern was evident in the bone marrow sample obtained before autologous bone marrow transplantation (BMT) in 1988, but it was no longer detectable after transplantation in 1996. In both patients, peripheral-blood mononuclear cells (PBMC) showed a smear of amplified products, indicating B-cell polyclonality. Sequencing of the lymphoma bands showed a single predominant clone in Patient 2 and two major clones in Patient 1. The amplified CDR3 sequences of each clone were used to design allele-specific primers. Panel B shows results of allele-specific PCR analysis. In each case, lane 1 shows a DNA size marker. In Patient 1, the gastritis specimens show the two B-cell clones (lanes 2 and 3) that predominated after the transformation to malignant lymphoma (lanes 4 and 5). In Patient 2, the lymphoma clone (lane 3) is evident in the gastritis specimen (lane 2), as well as in the bone marrow specimen obtained before transplantation (lane 4), but not in that obtained afterward (lane 5). In both patients PBMC were analyzed to assess the specificity of allele-specific PCR (Patient 1, lanes 6 and 7; Patient 2, lane 6).
Patient 2
Histologic review of the gastric-biopsy specimens obtained threemonths before gastric resection in 1984 and at gastrectomy confirmedthe absence of lymphoma (Figure 1B). The pathological featureswere those of active gastritis, with lymphoid follicles, focalintestinal metaplasia, and chronic peptic ulceration (histologicscore, 2). The presence of H. pylori was documented in specimensobtained in 1984 and 1988. The patient never received antibioticswith the specific aim of eradicating H. pylori. However, duringand after chemotherapy, she received a variety of antibioticsto treat infections. These treatments may have eradicated H.pylori.
Review of samples from the gastric-stump biopsy performed in1988 confirmed the presence of diffuse, aggressive non-Hodgkin'slymphoma, which was reclassified as a large-cell lymphoma withfocal areas of low-grade MALT lymphoma (Figure 1E and Figure 1F).The presence of large lymphoma cells was also substantiatedin the bone marrow after histologic review of the specimen obtainedby trephine biopsy. The histologic examination of the endoscopic-biopsyspecimens obtained immediately before the relapse of lymphomain the bone marrow showed focal suspicious-appearing dense,small lymphocytic infiltrates (histologic score, 4) that mayhave been related to the presence of residual low-grade MALTlymphoma. The gastric-biopsy specimen obtained after transplantationshowed no such B-cell infiltration.
PCR amplification of the immunoglobulin gene with consensusprimers demonstrated an oligoclonal pattern in the samples obtainedat the time gastritis was diagnosed and a monoclonal band ofthe same size in all the samples of both low-grade and high-gradelymphoma obtained in 1988 and 1990 before autologous bone marrowtransplantation. An oligoclonal or polyclonal pattern continuedto be present after transplantation (Table 1). One predominantB-cell clone was sequenced from a paraffin-embedded lymphomaspecimen, and its CDR3 sequence was used to make an allele-specificprimer. Allele-specific PCR demonstrated the presence of thisclone in the gastritis specimen and in all subsequent biopsysamples until bone marrow transplantation in 1990, after whichthis clone became undetectable (Figure 2A and Figure 2B).
Discussion
Epidemiologic,4,5 experimental,21 and clinical6,7,15,22 datasupport a strong association between primary MALT lymphoma ofthe stomach (a clonal B-cell cancer) and gastric H. pylori infection.In our study, we used a sensitive, patient-specific moleculartechnique allele-specific PCR to show that histologicallyconfirmed H. pylori gastritis harbors the clonal B cell thateventually gives rise to MALT lymphoma.
A spectrum of lymphoproliferations, from polyclonal to monoclonal,may be involved in the transformation from benign to overtlyneoplastic forms in the stomach.23,24 The scoring system proposedby Wotherspoon et al.11 reflects this continuum from a histologicpoint of view. Tumor progression is a multistep process, anddefining the point at which a non-neoplastic lesion becomesneoplastic is difficult.25 Some genetic lesions have a clonalabnormality that remains responsive to normal regulators ofgrowth and differentiation.25,26 Recent studies27,28,29 haveshown antigenic selection and clonal expansion in B-cell clonesof MALT lymphoma. The proliferation of these clones might besubclinical or of minimal clinical significance until additionalgenetic changes occur and the process becomes irreversible.
Sequencing analysis of DNA from Patient 1 showed two major lymphomaclones apparently arising from a biclonal proliferation of Bcells. Allele-specific PCR based on these sequences was positivein the gastritis samples and in the subsequent lymphoma samples.One clone disappeared after several years, after antibiotictreatment, whereas the other did not. The persistent clone mayhave progressed to a stage of independence from H. pylori. Thedevelopment of biclonal or oligoclonal lymphomas has also beendocumented in other circumstances, such as after organ transplantation.30,31,32In lymphomas induced by EpsteinBarr virus and associatedwith organ transplantation, a similar process of clonal B-cellproliferation is seen, and withdrawal of immunosuppression maysuppress the proliferation and halt the progression of lymphoma.31,32Withdrawal of the H. pylori antigenic stimulus at an early stageof clonal B-cell proliferation such as by eradicatingthe microorganism may reverse the malignant processbefore it becomes irreversible.
H. pylori is a very common bacterial infection in humans, presentin almost half of all people.33 Gastric MALT lymphoma, however,will develop in only a very small percentage. The estimatedincidence of this lymphoma in the United States is between 1in 30,000 and 1 in 80,000.34 A higher incidence (13 in 100,000)has been reported in northeastern Italy.4 Additional environmentalor host-related factors may be needed to sustain gastric lymphomagenesis.
The point at which H. pylori infection should be treated iscontroversial. There is general agreement only that it shouldbe eradicated in patients with gastric or duodenal peptic ulcer.35,36Our findings could be seen as supporting the use of antibiotictherapy in all symptomatic patients with H. pylori gastritis.However, considerations of cost as well as the high cure rateof MALT lymphoma37,38 and the increasing resistance to antibiotics36,39weigh against the indiscriminate use of antibiotics to treatall people with H. pylori gastritis. Moreover, there are insufficientdata to demonstrate that eradicating H. pylori prevents theprogression of gastritis to cancer or lymphoma.
Nevertheless, our findings suggest that analysis of B-cell clonalityby PCR may help physicians to care for patients with H. pylorigastritis, particularly those with suspicious-appearing lymphoidinfiltrates at histologic examination. In patients with a monoclonalB-cell population, which might represent an early, reversiblestep in the process of lymphomagenesis, we believe that antibiotictreatment of gastritis should be considered in order to reducethe risk of lymphoma.
Supported by grants from the Swiss National Science Foundation(32-45993.95) and the Schweizerische KrebsligaKrebsforschungSchweiz (AKT 623), and grants and fellowships from the FondazioneTettamanti per lo Studio delle Leucemie ed Emopatie Infantili,the Associazione Italiana per la Ricerca sul Cancro, and theConsiglio Nazionale delle Ricerche.
We are indebted to Dr. Antonio Bonetti and Dr. Bernard Miazzafor performing diagnostic and follow-up endoscopies and to Dr.Finbarr Cotter, Dr. Michele De Boni, and Dr. Giorgio Mombellifor helpful discussions.
Source Information
From the Servizio Oncologico Cantonale, Ospedale San Giovanni, Bellinzona, Switzerland (E.Z., F.B., E.R., G.B., F.C.); Clinica Pediatrica dell'Università di Milano, Ospedale San Gerardo, Monza, Italy (G.C., A.B.); and Istituto Cantonale di Patologia, Locarno, Switzerland (E.P.).
Address reprint requests to Dr. Cavalli at the Servizio Oncologico Cantonale, Ospedale San Giovanni, 6500 Bellinzona, Switzerland.
References
Isaacson PG. The MALT lymphoma concept updated. Ann Oncol 1995;6:319-320. [Free Full Text]
Zucca E, Roggero E. Biology and treatment of MALT lymphoma: the state-of-the-art in 1996: a workshop at the 6th International Conference on Malignant Lymphoma. Ann Oncol 1996;7:787-792. [Free Full Text]
Doglioni C, Wotherspoon AC, Moschini A, de Boni M, Isaacson PG. High incidence of primary gastric lymphoma in northeastern Italy. Lancet 1992;339:834-835. [CrossRef][Medline]
Parsonnet J, Hansen S, Rodriguez L, et al. Helicobacter pylori infection and gastric lymphoma. N Engl J Med 1994;330:1267-1271. [Free Full Text]
Roggero E, Zucca E, Pinotti G, et al. Eradication of Helicobacter pylori infection in primary low-grade gastric lymphoma of mucosa-associated lymphoid tissue. Ann Intern Med 1995;122:767-769. [Free Full Text]
Bayerdörffer E, Neubauer A, Rudolph B, et al. Regression of primary gastric lymphoma of mucosa-associated lymphoid tissue type after cure of Helicobacter pylori infection. Lancet 1995;345:1591-1594. [CrossRef][Medline]
Carlson SJ, Yokoo H, Vanagunas A. Progression of gastritis to monoclonal B-cell lymphoma with resolution and recurrence following eradication of Helicobacter pylori. JAMA 1996;275:937-939. [Free Full Text]
Schwartz RS. Jumping genes and the immunoglobulin V gene system. N Engl J Med 1995;333:42-44. [Free Full Text]
Diss TC, Peng H, Wotherspoon AC, Isaacson PG, Pan L. Detection of monoclonality in low-grade B-cell lymphomas using the polymerase chain reaction is dependent on primer selection and lymphoma type. J Pathol 1993;169:291-295. [CrossRef][Medline]
Wotherspoon AC, Doglioni C, Diss TC, et al. Regression of primary low-grade B-cell gastric lymphoma of mucosa-associated lymphoid tissue type after eradication of Helicobacter pylori. Lancet 1993;342:575-577. [CrossRef][Medline]
Rohatiner A, d'Amore F, Coiffier B, et al. Report on a workshop convened to discuss the pathological and staging classifications of gastrointestinal tract lymphoma. Ann Oncol 1994;5:397-400. [Free Full Text]
Zucca E, Martinelli G, Csontos S, Cavalli F. MACOP/CytaBEP: a novel effective treatment for aggressive non-Hodgkin's lymphomas. Proc Am Soc Clin Oncol 1993;12:369. abstract.
Cabanillas F. Experience with salvage regimens at M.D. Anderson Hospital. Ann Oncol 1991;2:Suppl 1:31-32.
Isaacson PG, Norton AJ. Malignant lymphoma of the gastrointestinal tract. In: Isaacson PG, Norton AJ, eds. Extranodal lymphomas. Edinburgh, Scotland: Churchill Livingstone, 1994:15-65.
Potter HVPJ, Loffeld RJLF, Stobberingh E, van Spreeuwel JP, Arends JW. Rapid staining of Campylobacter pyloridis. Histopathology 1987;11:1223-1223.
Wright DK, Manos M. Sample preparation from paraffin-embedded tissues. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ, eds. PCR protocols: a guide to methods and applications. London: Academic Press, 1990:153-8.
Bottaro M, Berti E, Biondi A, Migone N, Crosti L. Heteroduplex analysis of T-cell receptor gene rearrangements for diagnosis and monitoring of cutaneous T-cell lymphomas. Blood 1994;83:3271-3278. [Free Full Text]
Goulden N, Langlands K, Steward C, Knechtli C, Potter M, Oakhill T. PCR of gene rearrangements for the detection of minimal residual disease in childhood ALL. In: Cotter FE, ed. Molecular diagnosis of cancer. Totowa, N.J.: Humana Press, 1996:3-23.
Ausubel FM, Brent R, Kingston RE, et al., eds. Short protocols in molecular biology. 2nd ed. New York: Greene Publishing, 1992:2.21-2.22.
Hussell T, Isaacson PG, Crabtree JE, Spencer J. The response of cells from low-grade B-cell gastric lymphomas of mucosa-associated lymphoid tissue to Helicobacter pylori. Lancet 1993;342:571-574. [CrossRef][Medline]
Weber DM, Dimopoulos MA, Anandu DP, Pugh WC, Steinbach G. Regression of gastric lymphoma of mucosa-associated lymphoid tissue with antibiotic therapy for Helicobacter pylori. Gastroenterology 1994;107:1835-1838. [Medline]
Rudolph B, Bayerdörffer E, Ritter M, et al. Is the polymerase chain reaction or cure of Helicobacter pylori infection of help in the differential diagnosis of early gastric mucosa-associated lymphatic tissue lymphoma? J Clin Oncol 1997;15:1104-1109. [Free Full Text]
Savio A, Franzin G, Wotherspoon AC, et al. Diagnosis and posttreatment follow-up of Helicobacter pylori-positive gastric lymphoma of mucosa-associated lymphoid tissue: histology, polymerase chain reaction, or both? Blood 1996;87:1255-1260. [Free Full Text]
Magrath IT. Concepts and controversies in lymphoid neoplasia. In: Magrath IT, ed. The non-Hodgkin's lymphomas. 2nd ed. London: Arnold, 1997:3-46.
Ludwig CU, Gencik M, Shipman R. Multistep transformation in low-grade lymphoproliferative diseases. Ann Oncol 1993;4:825-830. [Free Full Text]
Qin Y, Greiner A, Trunk MJF, Schmausser B, Ott MM, Müller-Hermelink HK. Somatic hypermutation in low-grade mucosa-associated lymphoid tissue-type B-cell lymphoma. Blood 1995;86:3528-3534. [Free Full Text]
Du M, Diss TC, Xu C, Peng H, Isaacson PG, Pan L. Ongoing mutation in MALT lymphoma immunoglobulin gene suggests that antigen stimulation plays a role in the clonal expansion. Leukemia 1996;10:1190-1197. [Medline]
Bertoni F, Cazzaniga G, Bosshard G, et al. Immunoglobulin heavy chain diversity genes rearrangement pattern indicates that MALT-type gastric lymphoma B cells have undergone an antigen selection process. Br J Haematol 1997;97:830-836. [CrossRef][Medline]
Sklar J, Cleary ML, Thielemans K, Gralow J, Warnke R, Levy R. Biclonal B-cell lymphoma. N Engl J Med 1984;311:20-27. [Abstract]
Levine AM. Lymphoma complicating immunodeficiency disorders. Ann Oncol 1994;5:Suppl 2:29-35. [Free Full Text]
Knowles DM, Cesarman E, Chadburn A, et al. Correlative morphologic and molecular genetic analysis demonstrates three distinct categories of posttransplantation lymphoproliferative disorders. Blood 1995;85:552-565. [Free Full Text]
Cover TL, Blaser MJ. Helicobacter pylori infection, a paradigm for chronic mucosal inflammation: pathogenesis and implications for eradication and prevention. Adv Intern Med 1996;41:85-117. [Medline]
Zaki M, Schubert ML. Helicobacter pylori and gastric lymphoma. Gastroenterology 1995;108:610-612. [Medline]
NIH Consensus Development Panel on Helicobacter pylori in Peptic Ulcer Disease. Helicobacter pylori in peptic ulcer disease. JAMA 1994;272:65-69. [Free Full Text]
Rabeneck L, Graham DY. Helicobacter pylori: when to test, when to treat. Ann Intern Med 1997;126:315-316. [Free Full Text]
Zucca E, Cavalli F. Gut lymphomas. Baillieres Clin Haematol 1996;9:727-741. [Medline]
Roggero E, Zucca E, Cavalli F. Gastric mucosa-associated lymphoid tissue lymphomas: more than a fascinating model. J Natl Cancer Inst 1997;89:1328-1330. [Free Full Text]
Bower H. Sequencing of Helicobacter pylori will radically alter research. BMJ 1997;315:383-383. [Free Full Text]
Burger, J. A., Ghia, P., Rosenwald, A., Caligaris-Cappio, F.
(2009). The microenvironment in mature B-cell malignancies: a target for new treatment strategies. Blood
114: 3367-3375
[Abstract][Full Text]
Stathis, A., Chini, C., Bertoni, F., Proserpio, I., Capella, C., Mazzucchelli, L., Pedrinis, E., Cavalli, F., Pinotti, G., Zucca, E.
(2009). Long-term outcome following Helicobacter pylori eradication in a retrospective study of 105 patients with localized gastric marginal zone B-cell lymphoma of MALT type. Ann Oncol
20: 1086-1093
[Abstract][Full Text]
Siakantaris, M. P., Pangalis, G. A., Dimitriadou, E., Kontopidou, F. N., Vassilakopoulos, T. P., Kalpadakis, C., Sachanas, S., Yiakoumis, X., Korkolopoulou, P., Kyrtsonis, M.-C., Bobotsis, P., Androulaki, A., Patsouris, E., Panayiotidis, P., Angelopoulou, M. K.
(2009). Early-Stage Gastric MALT Lymphoma: Is It a Truly Localized Disease?. The Oncologist
14: 148-154
[Abstract][Full Text]
Retamales, E., Rodriguez, L., Guzman, L., Aguayo, F., Palma, M., Backhouse, C., Argandona, J., Riquelme, E., Corvalan, A.
(2007). Analytical Detection of Immunoglobulin Heavy Chain Gene Rearrangements in Gastric Lymphoid Infiltrates by Peak Area Analysis of the Melting Curve in the LightCycler System. J. Mol. Diagn.
9: 351-357
[Abstract][Full Text]
Alam, I., Frahad, K., Griffiths, P. A., Hurley, M.
(2007). Simultaneous Gastrointestinal Stromal Tumor and Mucosa-Associated Lymphoid Tissue Lymphoma of the Stomach. JCO
25: 1136-1138
[Full Text]
Cohen, S. M., Petryk, M., Varma, M., Kozuch, P. S., Ames, E. D., Grossbard, M. L.
(2006). Non-Hodgkin's Lymphoma of Mucosa-Associated Lymphoid Tissue. The Oncologist
11: 1100-1117
[Abstract][Full Text]
Suarez, F., Lortholary, O., Hermine, O., Lecuit, M.
(2006). Infection-associated lymphomas derived from marginal zone B cells: a model of antigen-driven lymphoproliferation. Blood
107: 3034-3044
[Abstract][Full Text]
Wundisch, T., Thiede, C., Morgner, A., Dempfle, A., Gunther, A., Liu, H., Ye, H., Du, M.-Q., Kim, T. D., Bayerdorffer, E., Stolte, M., Neubauer, A.
(2005). Long-Term Follow-Up of Gastric MALT Lymphoma After Helicobacter Pylori Eradication. JCO
23: 8018-8024
[Abstract][Full Text]
Zucca, E., Bertoni, F.
(2005). Another Piece of the MALT Lymphomas Jigsaw. JCO
23: 4832-4834
[Full Text]
Bende, R. J., Aarts, W. M., Riedl, R. G., de Jong, D., Pals, S. T., van Noesel, C. J.M.
(2005). Among B cell non-Hodgkin's lymphomas, MALT lymphomas express a unique antibody repertoire with frequent rheumatoid factor reactivity. JEM
201: 1229-1241
[Abstract][Full Text]
Zompi, S., Couderc, L.-J., Cadranel, J., Antoine, M., Epardeau, B., Fleury-Feith, J., Popa, N., Santoli, F., Farcet, J.-P., Delfau-Larue, M.-H.
(2004). Clonality analysis of alveolar B lymphocytes contributes to the diagnostic strategy in clinical suspicion of pulmonary lymphoma. Blood
103: 3208-3215
[Abstract][Full Text]
Aljurf, M. D., Owaidah, T. W., Ezzat, A., Ibrahim, E., Tbakhi, A.
(2003). Antigen- and/or immune-driven lymphoproliferative disorders. Ann Oncol
14: 1595-1606
[Full Text]
Rollinson, S., Levene, A. P., Mensah, F. K., Roddam, P. L., Allan, J. M., Diss, T. C., Roman, E., Jack, A., MacLennan, K., Dixon, M. F., Morgan, G. J.
(2003). Gastric marginal zone lymphoma is associated with polymorphisms in genes involved in inflammatory response and antioxidative capacity. Blood
102: 1007-1011
[Abstract][Full Text]
Zucca, E., Conconi, A., Pedrinis, E., Cortelazzo, S., Motta, T., Gospodarowicz, M. K., Patterson, B. J., Ferreri, A. J. M., Ponzoni, M., Devizzi, L., Giardini, R., Pinotti, G., Capella, C., Zinzani, P. L., Pileri, S., Lopez-Guillermo, A., Campo, E., Ambrosetti, A., Baldini, L., Cavalli, F.
(2003). Nongastric marginal zone B-cell lymphoma of mucosa-associated lymphoid tissue. Blood
101: 2489-2495
[Abstract][Full Text]
Ahrens, K., Braylan, R., Almasri, N., Foss, R., Rimsza, L.
(2002). IgH PCR of Zinc Formalin-Fixed, Paraffin-Embedded Non-Lymphomatous Gastric Samples Produces Artifactual "Clonal" Bands Not Observed in Paired Tissues Unexposed to Zinc Formalin. J. Mol. Diagn.
4: 159-163
[Abstract][Full Text]
Barth, T. F. E., Bentz, M., Leithauser, F., Stilgenbauer, S., Siebert, R., Schlotter, M., Schlenk, R. F., Dohner, H., Moller, P., Starostik, P., Greiner, A., Kalla, J., Zettl, A., Muller-Hermelink, H. K.
(2002). Pathogenic complexity of gastric B-cell lymphoma. Blood
100: 1095-1097
[Full Text]
Bertoni, F., Conconi, A., Capella, C., Motta, T., Giardini, R., Ponzoni, M., Pedrinis, E., Novero, D., Rinaldi, P., Cazzaniga, G., Biondi, A., Wotherspoon, A., Hancock, B. W., Smith, P., Souhami, R., Cotter, F. E., Cavalli, F., Zucca, E.
(2002). Molecular follow-up in gastric mucosa-associated lymphoid tissue lymphomas: early analysis of the LY03 cooperative trial. Blood
99: 2541-2544
[Abstract][Full Text]
Starostik, P., Patzner, J., Greiner, A., Schwarz, S., Kalla, J., Ott, G., Muller-Hermelink, H. K.
(2002). Gastric marginal zone B-cell lymphomas of MALT type develop along 2 distinct pathogenetic pathways. Blood
99: 3-9
[Abstract][Full Text]
Chen, L.-T., Lin, J.-T., Shyu, R.-Y., Jan, C.-M., Chen, C.-L., Chiang, I-P., Liu, S.-M., Su, I.-J., Cheng, A.-L.
(2001). Prospective Study of Helicobacter pylori Eradication Therapy in Stage IE High-Grade Mucosa-Associated Lymphoid Tissue Lymphoma of the Stomach. JCO
19: 4245-4251
[Abstract][Full Text]
Thiede, C., Wundisch, T., Alpen, B., Neubauer, B., Morgner, A., Schmitz, M., Ehninger, G., Stolte, M., Bayerdorffer, E., Neubauer, A.
(2001). Long-Term Persistence of Monoclonal B Cells After Cure of Helicobacter pylori Infection and Complete Histologic Remission in Gastric Mucosa-Associated Lymphoid Tissue B-Cell Lymphoma. JCO
19: 1600-1609
[Abstract][Full Text]
Solnick, J. V., Schauer, D. B.
(2001). Emergence of Diverse Helicobacter Species in the Pathogenesis of Gastric and Enterohepatic Diseases. Clin. Microbiol. Rev.
14: 59-97
[Abstract][Full Text]
Cavalli, F., Isaacson, P. G., Gascoyne, R. D., Zucca, E.
(2001). MALT Lymphomas. ASH Education Book
2001: 241-258
[Abstract][Full Text]
Rossi, G., Fortuna, D., Pancotto, L., Renzoni, G., Taccini, E., Ghiara, P., Rappuoli, R., Del Giudice, G.
(2000). Immunohistochemical Study of Lymphocyte Populations Infiltrating the Gastric Mucosa of Beagle Dogs Experimentally Infected with Helicobacter pylori. Infect. Immun.
68: 4769-4772
[Abstract][Full Text]
Zucca, E., Bertoni, F., Roggero, E., Cavalli, F.
(2000). The gastric marginal zone B-cell lymphoma of MALT type. Blood
96: 410-419
[Full Text]
Van den Brink, G R, Tytgat, K M A J, Van der Hulst, R W M, Van der Loos, C M, Einerhand, A W C, Buller, H A, Dekker, J
(2000). H pylori colocalises with MUC5AC in the human stomach. Gut
46: 601-607
[Abstract][Full Text]
van den Brink, G. R., ten Kate, F. J., Ponsioen, C. Y., Rive, M. M., Tytgat, G. N., van Deventer, S. J. H., Peppelenbosch, M. P.
(2000). Expression and Activation of NF-{kappa}B in the Antrum of the Human Stomach. J. Immunol.
164: 3353-3359
[Abstract][Full Text]
Gerhard, M., Lehn, N., Neumayer, N., Boren, T., Rad, R., Schepp, W., Miehlke, S., Classen, M., Prinz, C.
(1999). Clinical relevance of the Helicobacter pylori gene for blood-group antigen-binding adhesin. Proc. Natl. Acad. Sci. USA
96: 12778-12783
[Abstract][Full Text]
Rossi, G., Rossi, M., Vitali, C. G., Fortuna, D., Burroni, D., Pancotto, L., Capecchi, S., Sozzi, S., Renzoni, G., Braca, G., Del Giudice, G., Rappuoli, R., Ghiara, P., Taccini, E.
(1999). A Conventional Beagle Dog Model for Acute and Chronic Infection with Helicobacter pylori. Infect. Immun.
67: 3112-3120
[Abstract][Full Text]