Background Systemic sclerosis is a disease of unknown originwhich often occurs in women after their childbearing years.It has many clinical and histopathological similarities to chronicgraft-versus-host disease. Recent studies indicate that fetalstem cells can survive in the maternal circulation for manyyears post partum. This finding suggests that fetal cells persistingin the maternal circulation or tissues could be involved inthe pathogenesis of systemic sclerosis by initiating a graft-versus-hostreaction.
Methods We used the polymerase chain reaction (PCR) to identifyY-chromosome sequences in DNA extracted from peripheral-bloodcells and skin lesions from women with systemic sclerosis ofrecent onset. To confirm the PCR findings, we used fluorescencein situ hybridization of peripheral-blood cells and cells withinchronic inflammatory-cell infiltrates in biopsy specimens ofaffected skin.
Results Y-chromosome sequences were found in DNA from peripheral-bloodcells in 32 of 69 women with systemic sclerosis (46 percent),as compared with 1 of 25 normal women (4 percent, P<0.001),and in T lymphocytes from 3 women with systemic sclerosis whohad male offspring. Furthermore, Y-chromosome sequences wereidentified in skin-biopsy specimens from 11 of 19 women withsystemic sclerosis (58 percent); 9 of the 11 were known to havecarried male fetuses. Nucleated cells containing Y chromosomeswere detected by fluorescence in situ hybridization in paraffin-embeddedsections of skin lesions from all seven women we tested whoseskin-biopsy specimens contained Y-chromosome sequences.
Conclusions Fetal antimaternal graft-versus-host reactions maybe involved in the pathogenesis of systemic sclerosis in somewomen.
Systemic sclerosis is a connective-tissue disease of unknownorigin that is characterized by cutaneous and visceral fibrosis;production of autoantibodies, including anticentromere and anti-topoisomeraseantibodies; and prominent microvascular changes, with endothelial-celldamage and proliferation of subendothelial connective tissue.The highest incidence of systemic sclerosis occurs between 45and 55 years of age,1,2 and it is three to eight times as frequentin women as in men.3,4,5 These observations suggest that pregnancy-relatedevents are involved in its pathogenesis, although epidemiologicstudies to evaluate to what extent a previous pregnancy is arisk factor for systemic sclerosis have not been performed.
Systemic sclerosis has clinical features similar to those ofgraft-versus-host disease,6 and it has therefore been postulatedthat it may be a form of that disease.7,8,9,10,11 Skin, lung,and esophageal involvement is prominent in both diseases,9,10,12and both are characterized by lymphocytic infiltration of affectedtissues,13,14,15 up-regulation of inflammatory cytokines,16,17,18and fibrosis of the dermis and visceral organs.19 Furthermore,in a recent study, the systemic sclerosisspecific autoantibodiesScl-70 and Pm-Scl were found in 6 of 19 patients (32 percent)with chronic graft-versus-host disease who presented with clinicalsymptoms and findings similar to those of diffuse systemic sclerosis.20Graft-versus-host disease due to the transplacental transferof maternal T cells has been reported in infants,21 and erythematoxicum neonatorum has been postulated to be a mild, self-limitedform of graft-versus-host disease caused by maternal cells innewborns.22
During pregnancy, fetal and maternal cells of various typesare transferred between the mother and the fetus, predominantlyfrom the fetus to the mother.23 Fetal erythrocytes and leukocytescan be found in the peripheral blood of up to 25 percent ofpregnant women during the first trimester24 and 40 to 70 percentof women by the third trimester.25 Fetal stem cells engraftedin the maternal lymphoid organs or bone marrow may help to maintaintolerance to the semiallogeneic fetoplacental graft, and fetalhematopoietic stem cells have been detected in the circulationof women up to 27 years post partum.26 It has been suggestedthat a microchimerism established by fetal cells together withactivation of such cells may induce a chronic graft-versus-hostdisease manifesting as systemic sclerosis.27,28,29
To test this hypothesis, it was first necessary to demonstratethe presence of fetal nucleated cells in affected tissues fromwomen with systemic sclerosis who had previously been pregnant.For this purpose, we examined the male-specific Y-chromosomesequence DYZ1 as a marker for fetal cells in affected tissuesfrom women with systemic sclerosis. We describe the presenceof the Y-chromosomespecific sequence in DNA extractedfrom the peripheral blood and affected skin of women with systemicsclerosis. These observations provide support for the hypothesisthat a fetal antimaternal graft-versus-host reaction may bean immunopathogenic mechanism in the development of systemicsclerosis in some women.
Methods
Subjects
We extracted DNA from peripheral-blood cells of 69 women withsystemic sclerosis and 25 normal women by a procedure involvingsodium chlorideethanol precipitation.30 Two of the womenwith systemic sclerosis had had male children, but the pregnancyhistories of the remainder of these women and of the 25 normalwomen were not known. DNA was also extracted from biopsy specimensof active skin lesions from 19 women who had had systemic sclerosisfor 18 months or less, and from peripheral-blood cells of 2of these women. Sixteen of the 19 women with systemic sclerosishad been pregnant before the onset of disease.
As controls, DNA was extracted from skin-biopsy specimens of7 women with osteoarthritis and 61 female relatives of these7 women (who were subjects of another study), 29 percent ofwhom were known to have had male children and 15 percent ofwhom were known to have had female children (31 percent werenulliparous, but the pregnancy histories of the remainder werenot known). We also extracted DNA from biopsy specimens of skinand fascia from active lesions of nine women with eosinophiliamyalgia syndrome and two women with eosinophilic fasciitis andfrom a muscle-biopsy specimen from one woman with polymyositis.One of these 12 women had had multiple pregnancies; the historiesof the remainder were not known.
The diagnosis of systemic sclerosis was established accordingto the criteria of the American College of Rheumatology (previouslyknown as the American Rheumatism Association).31 All the womenattended the Scleroderma Center of Thomas Jefferson UniversityHospital between 1987 and 1997. The mean age of the women withsystemic sclerosis was 53 years (range, 20 to 86), and the meanage of the normal subjects and control patients was 49 years(range, 25 to 75). The study protocol was approved by the institutionalreview board of Thomas Jefferson University, and informed consentwas obtained from all subjects.
Polymerase-Chain-Reaction Analysis for Y-ChromosomePositive Cells
A specific Y-chromosome sequence was detected by amplifyingDNA in a nested polymerase chain reaction (PCR) with primersY1-1 and Y1-2, as described previously.32 The first amplificationwas done with primers Y1-1 and Y1-2, and the second amplificationwas done with primers designed by our laboratory; they wereY1-3, which has the sequence 5'CAGGCCTGTCCATTACACTACA3', andY1-4, which has the sequence 5'GAATGGGAACGAATGGAGTGAA3'. Sixtyamplification cycles were performed in the presence of 10 percentdimethyl sulfoxide and 10 U of Taq polymerase (PerkinElmerCetus, Foster City, Calif.) in a Rapidcycler PCR thermocycler(Idaho Technologies, Idaho Falls, Idaho). The conditions foramplification were denaturation at 94°C (five seconds),annealing at 60°C (two seconds), and extension at 72°C(five seconds) for 20 cycles, followed by 40 cycles of denaturationat 94°C (five seconds), annealing at 54°C (two seconds),and extension at 72°C (five seconds). All PCR analyses containeda blank (without DNA) for a negative control and a known positivesample for the Y sequence (male DNA). The resulting 148-bp Y-chromosomespecificfragment was identified by ethidium bromide staining after electrophoresison a 1.5 percent agarose gel.
Sequence Analysis of the PCR-Amplified Product
The 148-bp PCR product was sequenced to confirm its identity.The fragment was cloned into the TA cloning vector (Clontech,Palo Alto, Calif.) and sequenced with M13 forward and reverseprimers. The sequence results were analyzed with the programGenBank Search.
Fluorescence in Situ Hybridization of Peripheral-Blood Cells
Peripheral-blood cells from three women with systemic sclerosiswho had carried male fetuses, one woman with systemic sclerosiswho had never been pregnant, and two normal women were separatedby a magnetic cell-separation device (Immunicon, HuntingtonValley, Pa.). Peripheral-blood mononuclear cells were isolatedby FicollHypaque centrifugation (Pharmacia Biotech, Piscataway,N.J.) and washed twice in phosphate-buffered saline containing0.1 percent bovine serum albumin. The cells were resuspendedin 0.85 ml of solution, and 20 µl (0.25 µg per milliliter)of mouse monoclonal antibodies directed either against CD3 (Tcells) or against CD14 (monocytes) and CD45 (leukocytes) wasadded. The reaction mixtures were incubated at room temperaturefor 25 minutes, and 0.85 ml of a freshly prepared 1:20 dilutionof goat antimouse antibodies conjugated to magnetic colloidalparticles (Immunicon) was added. After a further 10 minutesof incubation, the cells were washed in 10 ml of phosphate-bufferedsaline, centrifuged, and resuspended in 1.7 ml of phosphate-bufferedsaline.
The resuspended cells were transferred to a collection vesseland inserted into a magnetic field for 15 minutes at room temperature.A new collection vessel containing 1.7 ml of phosphate-bufferedsaline was then raised onto the collecting loops, and the cellswere recovered by agitating the collection device for one totwo minutes. Cells recovered from the wire loops and those notadhering to the loops were suspended in 50 µl of fresh3:1 methanolacetic acid solution for fixation. Between30 and 40 µl of the cell suspension was then pipettedonto clean glass slides and air-dried. The number of cells oneach slide was approximately 5000 per square centimeter. TheX- and Y-chromosome probes were pipetted onto the slides andincubated as described below for the tissue sections. Signalswere visualized with a Leitz Orthoplan II fluorescence microscopewith a triple-bandpass filter (Leitz, Rockleigh, N.J.). In eachsubject, 3000 nuclei were examined, and the number of signalsfor each probe was recorded. Image capture and recording wereperformed with the Oncor Image Analysis System (Oncor, Gaithersburg,Md.).
Fluorescence in Situ Hybridization of Paraffin-Embedded Skin-Biopsy Specimens
Sections were cut from paraffin-embedded skin-biopsy specimensfrom seven women with systemic sclerosis in whom PCR amplificationof DNA extracted from skin lesions yielded the 148-bp fragment.The sections were analyzed for the presence of Y-chromosomepositivecells by fluorescence in situ hybridization. Skin-biopsy specimensfrom 10 women without systemic sclerosis were examined simultaneously.The sections were deparaffinized in xylene for 10 minutes andwashed twice for 5 minutes each in 100 percent ethanol. Thesections were treated with 0.1 percent pronase at 45°C for10 minutes and then with 0.25 mg of proteinase K per milliliterat 45°C for 30 minutes, after which they were dehydratedin 70, 80, and 95 percent ethanol for 1 minute each. The X-and Y-chromosome probes (Oncor) were diluted 1:10 with HybrisolVI (Oncor), and 10 µl was pipetted onto each section andcovered with plastic film. The slides were heated at 70°Cfor five minutes, incubated overnight at 37°C, washed at70°C in 2x saline sodium citrate (1x saline sodium citrateis 0.15 M sodium chloride and 0.015 M sodium citrate) for fiveminutes, counterstained with 0.1 µg of 4,6-diamidino-2-phenylindolein an antifade solution (Oncor), and viewed with an epi-fluorescencemicroscope (Zeiss, Thornwood, N.Y.) with a triple-bandpass filter.The nuclei in the paraffin-embedded skin-biopsy specimens wereexamined by fluorescence in situ hybridization for both theX chromosome (fluorescein) and the Y chromosome (Texas red).The results from the control and test groups were compared bythe chi-square test with Yates' correction.
Results
PCR Analyses of Peripheral-Blood and Skin DNA
The Y-chromosome sequence was amplified from DNA extracted fromperipheral-blood cells in 32 of the 69 women with systemic sclerosis(46 percent), but in only 1 of the 25 normal women (4 percent,P<0.001). Cloning and sequencing confirmed the identity ofthe Y-chromosomespecific product amplified from the DNAsamples of the women with systemic sclerosis. The amplifiedproduct had 98 percent sequence identity with the DYZ1 sequenceunique to the Y chromosome, indicating that it was a male-chromosomesequence and not an unrelated gene.
Y-chromosomespecific DNA was detected in skin lesionsof 11 of the 19 women in whom it was sought (58 percent), butin none of the skin-biopsy specimens of the 68 women with osteoarthritisor their relatives (P<0.001). The results of a representativeexperiment are shown in Figure 1. A prominent band representsthe 148-bp product amplified from Y-chromosome DNA in samplesfrom three women with systemic sclerosis (lanes 5, 8, and 10;arrow) and a similar product in DNA from skin-biopsy specimensfrom two normal men (lanes 3 and 9). The faster-migrating bandseen in all lanes represents primerdimer formation. Thesample obtained from Patient 4 (lane 8) had such a high concentrationof male DNA that the PCR results are those expected for a malepattern. No Y-chromosomespecific sequence material wasdetected in the DNA extracted from the active lesions of thewomen with the eosinophilia myalgia syndrome, eosinophilic fasciitis,or polymyositis.
Figure 1. PCR Analysis of DYZ1 in DNA Extracted from Active Skin Lesions in Women with Systemic Sclerosis.
Lane 1 shows a 100-bp size marker; lane 2 is blank; lane 3 shows DNA from a normal man; lane 4 shows DNA from Patient 5; lane 5 shows DNA from Patient 14; lane 6 shows DNA from Patient 15; lane 7 shows DNA from Patient 16; lane 8 shows DNA from Patient 4; lane 9 shows DNA from a normal man; and lane 10 shows DNA from Patient 2. The samples in lanes 3, 5, 8, 9, and 10 show a band corresponding to the 148-bp product amplified from Y-chromosome DNA, as indicated by the arrow. The faster-migrating band in all lanes represents primerdimer formation, as illustrated by its presence in lane 2, which contains no DNA (blank).
Fluorescence in Situ Hybridization of Peripheral-Blood Cells
Cell populations enriched either for CD3 T cells or for CD14and CD45 cells from three women with systemic sclerosis whohad carried male fetuses (Patients 1, 18, and 23) containedY-chromosome sequences (Table 1 and Figure 2). No Y-chromosomepositivecells were detected in cell populations from these women thatwere depleted of CD14 and CD45 cells or CD3 cells, nor in anyof the cells from the two normal women or a woman with systemicsclerosis who had never been pregnant (Patient 17).
Table 1. Results of Fluorescence in Situ Hybridization of Magnetically Sorted Cells from Peripheral Blood of Two Normal Subjects and Four Patients with Systemic Sclerosis.
Figure 2. Fluorescence in Situ Hybridization of CD3 Cells from the Peripheral Blood of a Woman with Systemic Sclerosis.
The X chromosome was labeled with Texas red (red signal), and the Y chromosome with fluorescein (green signal). The nuclei are stained blue by 4,6-diamidino-2-phenylindole in an antifade solution (0.1 µg per milliliter) and viewed with an epi-fluorescence microscope with a triple-bandpass filter. The arrow indicates a nucleus containing both X and Y chromosomes, and the arrowhead indicates a nucleus with only an X chromosome. (x2000.)
Fluorescence in Situ Hybridization of Skin-Biopsy Specimens
Nucleated cells containing Y chromosomes were detected in theskin-biopsy specimens of all seven women with systemic sclerosiswhose specimens contained Y-chromosome sequences as detectedby PCR and whose skin-biopsy specimens were tested by in situhybridization. The majority of the Y-chromosomecontainingnucleated cells were present within inflammatory-cell infiltrateslocalized in the extracellular matrix of the deep dermis (Figure 3A)or in the walls of small vessels (Figure 3B). Y-chromosomecontainingnucleated cells were not seen in any of the skin biopsy specimensfrom the 10 normal women studied.
Figure 3. Fluorescence in Situ Hybridization of a Paraffin-Embedded Tissue Section from an Active Skin Lesion in a Woman with Systemic Sclerosis.
The X chromosome was labeled with fluorescein (green signal), and the Y chromosome with Texas red (red signal). The sections were counterstained with 4,6-diamidino-2-phenylindole in an antifade solution (0.1 µg per milliliter) and viewed with an epi-fluorescence microscope with a triple-bandpass filter. The nuclei are stained blue. In Panel A (x1200), a nucleus with a Y signal (red) is seen deep within the dermis (arrow). A nucleus containing two X signals (green) is identified by an arrowhead. In Panel B (x1200), a nucleus containing both X (green) and Y (red) signals is shown within the wall of a vessel (arrow). A nucleus containing two X chromosomes (green signals) is identified by an arrowhead.
Pregnancy History
Among the 11 women with systemic sclerosis whose skin-biopsyspecimens contained Y-chromosomespecific sequences detectedby PCR amplification, all but 2 were known to have carried malefetuses (Table 2). Among the eight women with systemic sclerosiswho had negative PCR skin-biopsy results, three (Patients 17,19, and 20) had never been pregnant and had systemic sclerosisbefore the age of 20 years, one (Patient 21) had delivered twogirls, and one (Patient 22) had delivered one girl. The remainingthree women had died or were lost to follow-up. Of the 68 womenwith osteoarthritis or their relatives whose skin-biopsy specimenswere examined, 30 percent were known to have had male offspring.
Table 2. Pregnancy History and Onset of Systemic Sclerosis in Women Positive for Y Chromosomes in DNA Extracted from Biopsy Specimens of Affected Skin.
Discussion
The results described here demonstrate the presence of fetalnucleated cells in the skin lesions of women with systemic sclerosisand thus support the hypothesis that persistent fetal cellsin the maternal circulation or tissues mediate a graft-versus-hostreaction, resulting in autoimmune disease.27,28,29
The fate of the cells transferred from the fetal to the maternalcirculation (or vice versa) is not known, although transferredstem cells would be expected to mature either to relativelyshort-lived B cells or to longer-lived T cells. Thus, it islikely that the fetal cells in the skin lesions of women withsystemic sclerosis are T cells. Although activated T cells haveprofound effects on fibroblast proliferation and biosyntheticactivity, there is no evidence that the foreign cells detectedin the affected tissues of patients with systemic sclerosisare capable of stimulating the biosynthesis of connective tissueby resident fibroblasts.
It is likely that the hosts were immunologically unaware ofthe fetal cells, because the cells were not eliminated immunologically,as would have been expected. This tolerance of the fetal cellsby the host may be due to maternalfetal HLA compatibility.33Tissues from women with the eosinophilia myalgia syndrome, eosinophilicfasciitis, or polymyositis did not contain Y-chromosome sequences;presumably, these women either had no male offspring or, ifthey did, fetal cells did not become localized in their tissues.
Passage of cells from the fetus to the mother is a frequentand expected occurrence, and passage of cells from the motherto the fetus also occurs.22,34 Our study offers no explanationfor the occurrence of systemic sclerosis in women who have nothad children or in men. Maternal cells do reach the fetus,34and if they persisted they could cause systemic sclerosis inwomen who have not had children or in men. Persistence of allogeneicT cells after blood transfusion may also explain the occurrenceof systemic sclerosis in men or in nulliparous women.35,36
Our results indicate that the fetal cells that cross the placentaduring pregnancy either remain in the circulation or migrateto various tissue sites. We hypothesize that a subsequent event,such as an environmental exposure (viral, chemical, or other),activates them, initiating a cascade of events that resultsin systemic sclerosis.
Supported by grants from the National Institutes of Health (AM19616,to Dr. Jimenez) and the Scleroderma Federation of the UnitedStates (to Dr. Artlett) and in part by a contract from the NationalInstitute of Child Health and Human Development (CRMC-92-15,to Dr. Smith).
We are indebted to Drs. M.K. Haynes and R.J. Wapner for valuedcriticism of the manuscript and to Ms. A. Ruta, Ms. L. Gibbas,and Mr. K. Ansari for their expert technical assistance.
Source Information
From the Department of Medicine, Division of Rheumatology, Jefferson Medical College, Thomas Jefferson University, Philadelphia.
Address reprint requests to Dr. Jimenez at the Department of Medicine, Division of Rheumatology, Thomas Jefferson University, Rm. 509, Bluemle Life Sciences Bldg., 233 S. 10th St., Philadelphia, PA 19107-5541.
References
Silman AJ, Black CM, Welsh KI. Epidemiology, demographics, genetics. In: Clements PJ, Furst DE, eds. Systemic sclerosis. Baltimore: Williams& Wilkins, 1996:23-49.
Medsger TA Jr. Epidemiology of systemic sclerosis. Clin Dermatol 1994;12:207-216. [CrossRef][Medline]
Silman AJ, Jannini S, Symmons D, Bacon P. An epidemiological study of scleroderma in the West Midlands. Br J Rheumatol 1988;27:286-290. [Free Full Text]
Steen VD, Medsger TA Jr. Epidemiology and natural history of systemic sclerosis. Rheum Dis Clin North Am 1990;16:1-10.
Medsger TA Jr, Masi AT. Epidemiology of systemic sclerosis (scleroderma). Ann Intern Med 1971;74:714-721.
Chosidow O, Bagot M, Vernant J-P, et al. Sclerodermatous chronic graft-versus-host disease: analysis of seven cases. J Am Acad Dermatol 1992;26:49-55. [Medline]
Valenta LJ, Elias JN. Familial scleroderma in a kindred with high incidence of autoimmune disease: correlation with HLA-A1/B8 haplotype. Arch Dermatol 1987;123:1438-1440. [Free Full Text]
Clements PJ, Furst DE, Ho W, Gale R. Progressive systemic sclerosis-like disease following bone marrow transplantation. In: Black CM, Myers AR, eds. Current topics in rheumatology: systemic sclerosis (scleroderma). New York: Gower Medical Publishing, 1985:376-81.
Graham-Brown RAC, Sarkany I. Scleroderma-like changes due to chronic graft-versus-host disease. Clin Exp Dermatol 1983;8:531-538. [CrossRef][Medline]
Lawley TJ, Peck GL, Moutsopoulos HM, Gratwohl AA, Deisseroth AB. Scleroderma, Sjogren-like syndrome, and chronic graft-versus-host disease. Ann Intern Med 1977;87:707-709.
Bos GMJ, Majoor GD, Slaaf DW, van der Gaar MJ, Weijmer-van Velzen JS, van Breda Vriesman PJ. Similarity of scleroderma-like skin lesions in allogeneic and syngeneic bone marrow transplantation models. Transplant Proc 1989;21:3262-3263. [Medline]
Herzog P, Clements PJ, Roberts NK, Furst DE, Johnson CE, Feig SA. Progressive systemic sclerosis-like syndrome after bone marrow transplantation: clinical, immunologic, and pathologic findings. J Rheumatol 1980;7:56-64. [Medline]
Kahaleh MB, LeRoy EC. Interleukin-2 in scleroderma: correlation of serum level with extent of skin involvement and disease duration. Ann Intern Med 1989;110:446-450.
Postlethwaite AE. Connective tissue metabolism including cytokines in scleroderma. Curr Opin Rheumatol 1993;5:766-772. [Medline]
Janin-Mercier A, Devergie A, van Cauwenberg D, et al. Immunohistologic and ultrastructural study of the sclerotic skin in chronic graft-versus-host disease in man. Am J Pathol 1984;115:296-306. [Abstract]
Bell SA, Faust H, Mittermüller J, Kolb H-J, Meurer M. Specificity of antinuclear antibodies in scleroderma-like chronic graft-versus-host disease: clinical correlation and histocompatibility locus antigen association. Br J Dermatol 1996;134:848-854. [CrossRef][Medline]
O'Reilly RJ, Patterson JH, Bach FH, et al. Chimerism detected by HL-A typing. Transplantation 1973;15:505-507. [Medline]
Bassukas ID. Is erythema toxicum neonatorum a mild self-limited acute cutaneous graft-versus-host-reaction from maternal-to-fetal lymphocyte transfer? Med Hypotheses 1992;38:334-338. [CrossRef][Medline]
Schroder J. Transplacental passage of blood cells. J Med Genet 1975;12:230-242. [Free Full Text]
Steele CD, Wapner RJ, Smith JB, Haynes MK, Jackson LG. Prenatal diagnosis using fetal cells isolated from maternal peripheral blood: a review. Clin Obstet Gynecol 1996;39:801-813. [CrossRef][Medline]
Gill TJ III. Chimerism in humans. Transplant Proc 1977;9:1423-1431. [Medline]
Bianchi DW, Zickwolf GK, Weil GJ, Sylvester S, DeMaria MA. Male fetal progenitor cells persist in maternal blood for as long as 27 years postpartum. Proc Natl Acad Sci U S A 1996;93:705-708. [Free Full Text]
Silman AJ, Black C. Increased incidence of spontaneous abortion and infertility in women with scleroderma before disease onset: a controlled study. Ann Rheum Dis 1988;47:441-444. [Free Full Text]
Black CM, Stevens WM. Scleroderma. Rheum Dis Clin North Am 1989;15:193-212.
Nelson JL. Maternal-fetal immunology and autoimmune disease: is some autoimmune disease auto-alloimmune or allo-autoimmune? Arthritis Rheum 1996;39:191-194. [Medline]
Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 1988;16:1215-1215. [Free Full Text]
Subcommittee for Scleroderma Criteria of the American Rheumatism Association Diagnostic and Therapeutic Criteria Committee. Preliminary criteria for the classification of systemic sclerosis (scleroderma). Arthritis Rheum 1980;23:581-590. [Medline]
Patri S, Daheron L, Kitzis A, Chomel J-C. Evaluation of bone marrow transplantation efficiency by competitive PCR on Y sequences. PCR Methods Appl 1994;3:361-364. [Medline]
Artlett CM, Welsh KI, Black CM, Jimenez SA. Fetal-maternal HLA compatibility confers susceptibility to systemic sclerosis. Immunogenetics 1997;47:17-22. [CrossRef][Medline]
Appleton AL, Curtis A, Wilkes A, Cant AJ. Differentiation of materno-fetal GVHD from Omenn's syndrome in pre-BMT patients with severe combined immunodeficiency. Bone Marrow Transplant 1994;14:157-159. [Medline]
Brubaker DB. Immunopathogenic mechanisms of posttransfusion graft-vs-host disease. Proc Soc Exp Biol Med 1993;202:122-147. [CrossRef][Medline]
Juji T, Takahashi K, Shibata Y, et al. Post-transfusion graft-versus-host disease in immunocompetent patients after cardiac surgery in Japan. N Engl J Med 1989;321:56-56. [Medline]
Gabrielli, A., Avvedimento, E. V., Krieg, T.
(2009). Scleroderma. NEJM
360: 1989-2003
[Full Text]
RAMARAJ, R., SORRELL, V. L.
(2009). Peripartum cardiomyopathy: Causes, diagnosis, and treatment. Cleveland Clinic Journal of Medicine
76: 289-296
[Abstract][Full Text]
Hongling Du, , Taylor, H. S.
(2009). Reviews: Stem Cells and Female Reproduction. Reproductive Sciences
16: 126-139
[Abstract]
O'Donoghue, K.
(2008). Fetal microchimerism and maternal health during and after pregnancy. Obstet Med
1: 56-64
[Abstract][Full Text]
Cirello, V., Recalcati, M. P., Muzza, M., Rossi, S., Perrino, M., Vicentini, L., Beck-Peccoz, P., Finelli, P., Fugazzola, L.
(2008). Fetal Cell Microchimerism in Papillary Thyroid Cancer: A Possible Role in Tumor Damage and Tissue Repair. Cancer Res.
68: 8482-8488
[Abstract][Full Text]
Bartynski, W.S.
(2008). Posterior Reversible Encephalopathy Syndrome, Part 2: Controversies Surrounding Pathophysiology of Vasogenic Edema. Am. J. Neuroradiol.
29: 1043-1049
[Abstract][Full Text]
Lipsker, D., Flory, E., Wiesel, M.-L., Hanau, D., de la Salle, H.
(2008). Between Light and Dark, the Chimera Comes Out. Arch Dermatol
144: 327-330
[Abstract][Full Text]
Bustos, M. L., Frias, S., Ramos, S., Estrada, A., Arreola, J. L., Mendoza, F., Gaxiola, M., Salcedo, M., Pardo, A., Selman, M.
(2007). Local and Circulating Microchimerism Is Associated with Hypersensitivity Pneumonitis. Am. J. Respir. Crit. Care Med.
176: 90-95
[Abstract][Full Text]
Svegliati, S., Olivieri, A., Campelli, N., Luchetti, M., Poloni, A., Trappolini, S., Moroncini, G., Bacigalupo, A., Leoni, P., Avvedimento, E. V., Gabrielli, A.
(2007). Stimulatory autoantibodies to PDGF receptor in patients with extensive chronic graft-versus-host disease. Blood
110: 237-241
[Abstract][Full Text]
Khosrotehrani, K., Reyes, R.R., Johnson, K.L., Freeman, R.B., Salomon, R.N., Peter, I., Stroh, H., Guegan, S., Bianchi, D.W.
(2007). Fetal cells participate over time in the response to specific types of murine maternal hepatic injury. Hum Reprod
22: 654-661
[Abstract][Full Text]
McNallan, K. T., Aponte, C., el-Azhary, R., Mason, T., Nelson, A. M., Paat, J. J., Crowson, C. S., Reed, A. M.
(2007). Immunophenotyping of chimeric cells in localized scleroderma. Rheumatology (Oxford)
46: 398-402
[Abstract][Full Text]
Nguyen Huu, S., Oster, M., Uzan, S., Chareyre, F., Aractingi, S., Khosrotehrani, K.
(2007). Maternal neoangiogenesis during pregnancy partly derives from fetal endothelial progenitor cells. Proc. Natl. Acad. Sci. USA
104: 1871-1876
[Abstract][Full Text]
Kremer Hovinga, I. C. L., Koopmans, M., de Heer, E., Bruijn, J. A., Bajema, I. M.
(2007). Chimerism in systemic lupus erythematosus--three hypotheses. Rheumatology (Oxford)
46: 200-208
[Abstract][Full Text]
Piper, K. P., McLarnon, A., Arrazi, J., Horlock, C., Ainsworth, J., Kilby, M. D., Martin, W. L., Moss, P. A.
(2007). Functional HY-Specific CD8+ T Cells Are Found in a High Proportion of Women Following Pregnancy with a Male Fetus. Biol. Reprod.
76: 96-101
[Abstract][Full Text]
Zuber, J.-P., Spertini, F.
(2006). Immunological basis of systemic sclerosis. Rheumatology (Oxford)
45: iii23-iii25
[Abstract][Full Text]
Klintschar, M., Immel, U.-D., Kehlen, A., Schwaiger, P., Mustafa, T., Mannweiler, S., Regauer, S., Kleiber, M., Hoang-Vu, C.
(2006). Fetal microchimerism in Hashimoto's thyroiditis: a quantitative approach. Eur J Endocrinol
154: 237-241
[Abstract][Full Text]
Khosrotehrani, K., Bianchi, D. W.
(2005). Multi-lineage potential of fetal cells in maternal tissue: a legacy in reverse. J. Cell Sci.
118: 1559-1563
[Abstract][Full Text]
Vernochet, C., Caucheteux, S. M., Gendron, M.-C., Wantyghem, J., Kanellopoulos-Langevin, C.
(2005). Affinity-Dependent Alterations of Mouse B Cell Development by Noninherited Maternal Antigen. Biol. Reprod.
72: 460-469
[Abstract][Full Text]
Johnson, K. L., Bianchi, D. W.
(2004). Fetal cells in maternal tissue following pregnancy: what are the consequences?. Hum Reprod Update
10: 497-502
[Abstract][Full Text]
Sawaya, H. H. B., Jimenez, S. A., Artlett, C. M.
(2004). Quantification of fetal microchimeric cells in clinically affected and unaffected skin of patients with systemic sclerosis. Rheumatology (Oxford)
43: 965-968
[Abstract][Full Text]
Khosrotehrani, K., Johnson, K. L., Cha, D. H., Salomon, R. N., Bianchi, D. W.
(2004). Transfer of Fetal Cells With Multilineage Potential to Maternal Tissue. JAMA
292: 75-80
[Abstract][Full Text]
Polan, M. L., Yao, M. W. M.
(2004). Stem Cell Transfer and the Uterus: The Egg Teaches the Chicken. JAMA
292: 104-105
[Full Text]
Spyridonidis, A., Schmitt-Graff, A., Tomann, T., Dwenger, A., Follo, M., Behringer, D., Finke, J.
(2004). Epithelial Tissue Chimerism after Human Hematopoietic Cell Transplantation Is a Real Phenomenon. Am. J. Pathol.
164: 1147-1155
[Abstract][Full Text]
Adams, K. M., Nelson, J. L.
(2004). Microchimerism: An Investigative Frontier in Autoimmunity and Transplantation. JAMA
291: 1127-1131
[Abstract][Full Text]
Jimenez, S. A., Derk, C. T.
(2004). Following the Molecular Pathways toward an Understanding of the Pathogenesis of Systemic Sclerosis. ANN INTERN MED
140: 37-50
[Full Text]
Deguchi, M., Whitaker-Menezes, D., Jones, S. C., Aiba, S., Nakagawa, S., Tagami, H., Korngold, R., Murphy, G. F.
(2003). 12E2: A Cloned Murine Dermal Cell with Features of Dermal Dendrocytes and Capacity to Produce Pathologic Changes Resembling Early Kaposi's Sarcoma. Am. J. Pathol.
163: 1817-1825
[Abstract][Full Text]
O'Donoghue, K., Choolani, M., Chan, J., de la Fuente, J., Kumar, S., Campagnoli, C., Bennett, P.R., Roberts, I.A.G., Fisk, N.M.
(2003). Identification of fetal mesenchymal stem cells in maternal blood: implications for non-invasive prenatal diagnosis. Mol Hum Reprod
9: 497-502
[Abstract][Full Text]
Ando, T., Davies, T. F.
(2003). Postpartum Autoimmune Thyroid Disease: The Potential Role of Fetal Microchimerism. J. Clin. Endocrinol. Metab.
88: 2965-2971
[Abstract][Full Text]
Mosca, M, Curcio, M, Lapi, S, Valentini, G, D'Angelo, S, Rizzo, G, Bombardieri, S
(2003). Correlations of Y chromosome microchimerism with disease activity in patients with SLE: analysis of preliminary data. Ann Rheum Dis
62: 651-654
[Abstract][Full Text]
Cox, L. A., Ramos, R. C., Dennis, T. N., Jimenez, S. A., Smith, J. B., Artlett, C. M.
(2003). Detection of Microchimeric Cells in the Peripheral Blood of Nonpregnant Women Is Enhanced by Magnetic Cell Sorting before PCR. Clin. Chem.
49: 309-312
[Full Text]
Selva-O'Callaghan, A, Mijares-Boeckh-Behrens, T, Prades, E B., Solans-Laque, R, Simeon-Aznar, C P, Fonollosa-Pla, V, Vilardell-Tarres, M
(2003). Lack of evidence of foetal microchimerism in female Spanish patients with systemic sclerosis. Lupus
12: 15-20
[Abstract]
Giacomelli, R, Matucci-Cerinic, M, Bombardieri, S
(2002). Microchimerism in Sjogren's syndrome. Ann Rheum Dis
61: 1039-1040
[Full Text]
Kuroki, M, Okayama, A, Nakamura, S, Sasaki, T, Murai, K, Shiba, R, Shinohara, M, Tsubouchi, H
(2002). Detection of maternal-fetal microchimerism in the inflammatory lesions of patients with Sjogren's syndrome. Ann Rheum Dis
61: 1041-1046
[Abstract][Full Text]
Nelson, J L
(2002). Microchimerism and human autoimmune diseases. Lupus
11: 651-654
[Abstract]
Lambert, N. C., Lo, Y. M. D., Erickson, T. D., Tylee, T. S., Guthrie, K. A., Furst, D. E., Nelson, J. L.
(2002). Male microchimerism in healthy women and women with scleroderma: cells or circulating DNA? A quantitative answer. Blood
100: 2845-2851
[Abstract][Full Text]
Ando, T., Imaizumi, M., Graves, P. N., Unger, P., Davies, T. F.
(2002). Intrathyroidal Fetal Microchimerism in Graves' Disease. J. Clin. Endocrinol. Metab.
87: 3315-3320
[Abstract][Full Text]
Penas, P. F., Jones-Caballero, M., Aragues, M., Fernandez-Herrera, J., Fraga, J., Garcia-Diez, A.
(2002). Sclerodermatous Graft-vs-Host Disease: Clinical and Pathological Study of 17 Patients. Arch Dermatol
138: 924-934
[Abstract][Full Text]
Endo, Y., Negishi, I., Ishikawa, O.
(2002). Possible contribution of microchimerism to the pathogenesis of Sjogren's syndrome. Rheumatology (Oxford)
41: 490-495
[Abstract][Full Text]
Sakkas, L. I., Xu, B., Artlett, C. M., Lu, S., Jimenez, S. A., Platsoucas, C. D.
(2002). Oligoclonal T Cell Expansion in the Skin of Patients with Systemic Sclerosis. J. Immunol.
168: 3649-3659
[Abstract][Full Text]
Artlett, C M, Rasheed, M, Russo-Stieglitz, K E, Sawaya, H H B, Jimenez, S A
(2002). Influence of prior pregnancies on disease course and cause of death in systemic sclerosis. Ann Rheum Dis
61: 346-350
[Abstract][Full Text]
Zhang, Y., McCormick, L. L., Desai, S. R., Wu, C., Gilliam, A. C.
(2002). Murine Sclerodermatous Graft-Versus-Host Disease, a Model for Human Scleroderma: Cutaneous Cytokines, Chemokines, and Immune Cell Activation. J. Immunol.
168: 3088-3098
[Abstract][Full Text]
Imaizumi, M., Pritsker, A., Unger, P., Davies, T. F.
(2002). Intrathyroidal Fetal Microchimerism in Pregnancy and Postpartum. Endocrinology
143: 247-253
[Abstract][Full Text]
Stevens, A., Nelson, J. L.
(2002). Maternal and Fetal Microchimerism: Implications for Human Diseases. NeoReviews
3: e11-19
[Full Text]
Artlett, C. M., Miller, F. W., Rider, L. G.
(2001). Persistent maternally derived peripheral microchimerism is associated with the juvenile idiopathic inflammatory myopathies. Rheumatology (Oxford)
40: 1279-1284
[Abstract][Full Text]
MIJARES-BOECKH-BEHRENS, T, SELVA-O'CALLAGHAN, A, SOLANS-LAQUE, R, BOSCH-GIL, J A., VILARDELL-TARRES, M, BALADA-PRADES, E, KUWANA, M, OGAWA, Y, TODA, I
(2001). Fetal microchimerism in Sjogren's syndrome. Ann Rheum Dis
60: 897a-898
[Full Text]
Kruskall, M. S., Lee, T.-H., Assmann, S. F., Laycock, M., Kalish, L. A., Lederman, M. M., Busch, M. P.
(2001). Survival of transfused donor white blood cells in HIV-infected recipients. Blood
98: 272-279
[Abstract][Full Text]
Klintschar, M., Schwaiger, P., Mannweiler, S., Regauer, S., Kleiber, M.
(2001). Evidence of Fetal Microchimerism in Hashimoto's Thyroiditis. J. Clin. Endocrinol. Metab.
86: 2494-2498
[Abstract][Full Text]
Bree, A. F., Siegfried, E., Sotelo-Avila, C., Nahass, G.
(2001). Infantile Hemangiomas: Speculation on Placental Trophoblastic Origin. Arch Dermatol
137: 573-577
[Abstract][Full Text]
Toda, I, Kuwana, M, Tsubota, K, Kawakami, Y
(2001). Lack of evidence for an increased microchimerism in the circulation of patients with Sjogren's syndrome. Ann Rheum Dis
60: 248-253
[Abstract][Full Text]
Imaizumi, M., Pritsker, A., Kita, M., Ahmad, L., Unger, P., Davies, T. F.
(2001). Pregnancy and Murine Thyroiditis: Thyroglobulin Immunization Leads to Fetal Loss in Specific Allogeneic Pregnancies. Endocrinology
142: 823-829
[Abstract][Full Text]
Boneva, R. S., Folks, T. M., Chapman, L. E.
(2001). Infectious Disease Issues in Xenotransplantation. Clin. Microbiol. Rev.
14: 1-14
[Abstract][Full Text]
Lo, Y.M. D.
(2000). Fetal DNA in Maternal Plasma: Biology and Diagnostic Applications. Clin. Chem.
46: 1903-1906
[Abstract][Full Text]
Arvola, M., Gustafsson, E., Svensson, L., Jansson, L., Holmdahl, R., Heyman, B., Okabe, M., Mattsson, R.
(2000). Immunoglobulin-Secreting Cells of Maternal Origin Can Be Detected in B Cell-Deficient Mice. Biol. Reprod.
63: 1817-1824
[Abstract][Full Text]
Stummvoll, G. H., Aringer, M., Smolen, J. S., Koller, M., Kiener, H. P., Steiner, C. W., Bohle, B., Knobler, R., Graninger, W. B.
(2000). Derangement of apoptosis-related lymphocyte homeostasis in systemic sclerosis. Rheumatology (Oxford)
39: 1341-1350
[Abstract][Full Text]
Lo, Y.M. D., Lau, T. K., Chan, L. Y.S., Leung, T. N., Chang, A. M.Z.
(2000). Quantitative Analysis of the Bidirectional Fetomaternal Transfer of Nucleated Cells and Plasma DNA. Clin. Chem.
46: 1301-1309
[Abstract][Full Text]
MIYASHITA, Y., ONO, M., ONO, M., UEKI, H., KURASAWA, K.
(2000). Y chromosome microchimerism in rheumatic autoimmune disease. Ann Rheum Dis
59: 654b-654
[Full Text]
Lambert, N. C., Evans, P. C., Hashizumi, T. L., Maloney, S., Gooley, T., Furst, D. E., Nelson, J. L.
(2000). Cutting Edge: Persistent Fetal Microchimerism in T Lymphocytes Is Associated with HLA-DQA1*0501: Implications in Autoimmunity. J. Immunol.
164: 5545-5548
[Abstract][Full Text]
Vietor, H. E., Hallensleben, E., van Bree, S. P. M. J., van der Meer, E. M. W., Kaal, S. E. J., Bennebroek-Gravenhorst, J., Kanhai, H. H. H., Brand, A., Claas, F. H. J.
(2000). Survival of donor cells 25 years after intrauterine transfusion. Blood
95: 2709-2714
[Abstract][Full Text]
Pearson, G. D., Veille, J.-C., Rahimtoola, S., Hsia, J., Oakley, C. M., Hosenpud, J. D., Ansari, A., Baughman, K. L.
(2000). Peripartum Cardiomyopathy: National Heart, Lung, and Blood Institute and Office of Rare Diseases (National Institutes of Health) Workshop Recommendations and Review. JAMA
283: 1183-1188
[Abstract][Full Text]
McCormick, L. L., Zhang, Y., Tootell, E., Gilliam, A. C.
(1999). Anti-TGF-{beta} Treatment Prevents Skin and Lung Fibrosis in Murine Sclerodermatous Graft-Versus-Host Disease: A Model for Human Scleroderma. J. Immunol.
163: 5693-5699
[Abstract][Full Text]
Kaal, S. E. J., Van den Hoogen, F. H. J., De Jong, E. M. G. J., Viëtor, H. E.
(1999). Systemic Sclerosis: New Insights in Autoimmunity. Exp. Biol. Med.
222: 1-8
[Abstract][Full Text]
Bodo, I., Peters, M., Radich, J. P., Hess, J., Blinder, M., Watson, M. S., Van Rheeden, R., Natarajan, S., Lowell, J. A., Brown, R., DiPersio, J., Adkins, D.
(1999). Donor-Derived Acute Promyelocytic Leukemia in a Liver-Transplant Recipient. NEJM
341: 807-813
[Full Text]
Sakkas, L. I., Tourtellotte, C., Berney, S., Myers, A. R., Platsoucas, C. D.
(1999). Increased Levels of Alternatively Spliced Interleukin 4 (IL-4delta 2) Transcripts in Peripheral Blood Mononuclear Cells from Patients with Systemic Sclerosis. CVI
6: 660-664
[Abstract][Full Text]
Nelson, J L.
(1999). Autoimmune disease and the long-term persistence of fetal and maternal microchimerism. Lupus
8: 493-496
NELSON, J L.
(1999). Non-host cells in the pathogenesis of autoimmune disease: a new paradigm?. Ann Rheum Dis
58: 518-520
[Full Text]
Nelson, J L
(1999). Microchimerism: implications for autoimmune disease. Lupus
8: 370-374
[Abstract]
Starzl, T. E., Zinkernagel, R. M.
(1998). Antigen Localization and Migration in Immunity and Tolerance. NEJM
339: 1905-1913
[Full Text]
van der Horst-Bruinsma, I E, Hazes, J M W, Schreuder, G M T., Radstake, T R D J, Barrera, P, van de Putte, L B A, Mustamu, D, van Schaardenburg, D, Breedveld, F C, de Vries, R R P
(1998). Influence of non-inherited maternal HLA-DR antigens on susceptibility to rheumatoid arthritis. Ann Rheum Dis
57: 672-675
[Abstract][Full Text]
Connolly, M. K., McCalmont, T. H., Daniell, H. W., Artlett, C. M., Smith, J. B., Jimenez, S. A.
(1998). Fetal DNA and Cells in Women with Systemic Sclerosis. NEJM
339: 771-772
[Full Text]
Nelson, J. L.
(1998). Microchimerism and Autoimmune Disease. NEJM
338: 1223-1225
[Full Text]
Lockshin, M.D.
(1998). Review : Pregnancy loss and antiphospholipid antibodies. Lupus
7: S86-S89
[Abstract]