FREE NEJM E-TOC    HOME   |   SUBSCRIBE   |   CURRENT ISSUE   |   PAST ISSUES   |   COLLECTIONS   |   Search Term  Advanced Search

Sign in | Get NEJM's E-Mail Table of Contents — Free | Subscribe

Previous Volume 338:1352-1357 May 7, 1998 Number 19 Next

Abstract PDF Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited PubMed Citation

ABSTRACT

Background A new form of congenital hyperinsulinism characterized by hypoglycemia and hyperammonemia was described recently. We hypothesized that this syndrome of hyperinsulinism and hyperammonemia was caused by excessive activity of glutamate dehydrogenase, which oxidizes glutamate to -ketoglutarate and which is a potential regulator of insulin secretion in pancreatic beta cells and of ureagenesis in the liver.

Methods We measured glutamate dehydrogenase activity in lymphoblasts from eight unrelated children with the hyperinsulinism–hyperammonemia syndrome: six with sporadic cases and two with familial cases. We identified mutations in the glutamate dehydrogenase gene by sequencing glutamate dehydrogenase complementary DNA prepared from lymphoblast messenger RNA. Site-directed mutagenesis was used to express the mutations in COS-7 cells.

Results The sensitivity of glutamate dehydrogenase to inhibition by guanosine 5'-triphosphate was a quarter of the normal level in the patients with sporadic hyperinsulinism–hyperammonemia syndrome and half the normal level in patients with familial cases and their affected relatives, findings consistent with overactivity of the enzyme. These differences in enzyme insensitivity correlated with differences in the severity of hypoglycemia in the two groups. All eight children were heterozygous for the wild-type allele and had a mutation in the proposed allosteric domain of the enzyme. Four different mutations were identified in the six patients with sporadic cases; the two patients with familial cases shared a fifth mutation. In two clones of COS-7 cells transfected with the mutant sequence from one patient, the sensitivity of the enzyme to guanosine 5'-triphosphate was reduced, findings similar to those in the child's lymphoblasts.

Conclusions The hyperinsulinism–hyperammonemia syndrome is caused by mutations in the glutamate dehydrogenase gene that impair the control of enzyme activity.

We hypothesized that the hyperinsulinism–hyperammonemia syndrome was caused by a single inborn error of metabolism shared by the pancreas and the liver. A defect in the mitochondrial enzyme glutamate dehydrogenase appeared to be likely (Figure 1). Leucine, an amino acid that stimulates the release of insulin, acts by allosterically activating glutamate dehydrogenase to increase the rate of glutamate oxidation in the beta cells.^14,16,17 High concentrations of glutamate are needed for the synthesis of N-acetylglutamate, an essential activator of carbamoyl-phosphate synthetase, the first step in the conversion of ammonium to urea.^18,19 Therefore, the hyperinsulinism–hyperammonemia syndrome could be caused by excessive activity of glutamate dehydrogenase, since this would simultaneously increase the release of insulin by pancreatic beta cells and impair the detoxification of ammonia in the liver. We performed enzymatic and molecular studies in eight families in an effort to prove this hypothesis of an abnormality in glutamate enzyme activity as the cause of the syndrome.

View larger version (7K): [in this window] [in a new window]   Figure 1. Glutamate Dehydrogenase (GDH) and the Regulation of Insulin Secretion and Hepatic Ureagenesis. Increases in the rate of oxidation of fuels such as glucose or glutamate stimulate the secretion of insulin by increasing the ratio of ATP to adenosine 5'-diphosphate (ADP), which in turn causes closure of potassium channels and ultimately leads to the depolarization of beta cells, calcium influx, and the release of stored insulin granules.13 Leucine stimulates insulin secretion indirectly by allosterically activating glutamate dehydrogenase (GDH) and increasing the oxidation of glutamate by means of the tricarboxylic acid cycle.14,15,16,17 Diazoxide and tolbutamide have direct effects on the sulfonylurea receptor (SUR) and inwardly rectifying potassium channel (Kir6.2). In the liver, glutamate governs the synthesis of N -acetylglutamate, a required allosteric effector of carbamoyl-phosphate synthetase (CPS)18,19; the oxidation of glutamate by glutamate dehydrogenase also provides free ammonia derived from the -amino nitrogen of amino acids. GTP denotes guanosine 5'-triphosphate.

 
Methods

Study Subjects

We studied eight unrelated children, ranging in age from 3 months to 10 years, with the hyperinsulinism–hyperammonemia syndrome. Patients 1 through 6 (five boys and one girl) had sporadic cases, because they had no affected relatives. They were from the United States, Mexico, Italy, and Canada. Two other boys (Patients 7 and 8), one from Italy and one from Canada, were classified as having familial cases, because other family members had hyperammonemia and hypoglycemia. These included the mother of Patient 7 and the mother, a maternal aunt and her daughter, and the maternal grandfather of Patient 8. The mode of inheritance in these families appeared to be autosomal dominant. Clinical descriptions of Patients 1, 2, and 7 have been reported previously.^11,12

All the children presented with episodes of symptomatic hypoglycemia during the first year of life. The patients with sporadic cases all responded to treatment with diazoxide (Figure 1); they required either continuous treatment with diazoxide or subtotal pancreatectomy to prevent hypoglycemia. The patients with familial cases appeared to have milder hypoglycemia; Patient 8 was treated with diazoxide, but Patient 7 was treated with only a low-protein diet. The affected relatives of these two patients had not been treated. None of the affected subjects, whose plasma ammonium concentrations ranged from 112 to 280 µg per deciliter (80 to 200 µmol per liter; normal, <50 µg per deciliter [40 µmol per liter]) had symptoms of hyperammonemia, such as lethargy or coma.

The study protocol was approved by the institutional review board of Children's Hospital of Philadelphia, and informed consent was obtained from all subjects or their parents or guardians.

Enzymatic and DNA Studies

Peripheral-blood samples were obtained from the patients, 5 affected and 16 unaffected family members, and 10 unrelated normal subjects. Lymphocytes isolated from peripheral blood were transformed with Epstein–Barr virus to establish lymphoblast cultures. The activity of glutamate dehydrogenase in lymphoblast homogenates and the effects of added adenosine 5'-diphosphate (ADP) or guanosine 5'-triphosphate (GTP) were determined spectrophotometrically in triplicate.²⁰ In some cases, lymphoblast homogenates were subjected to dialysis overnight in the presence of 10 mM potassium phosphate, pH 7.1, to eliminate possible effects of adherent allosteric regulators. Protein was measured according to the method of Lowry et al.²¹

The complementary DNA (cDNA) for glutamate dehydrogenase was prepared from lymphoblast polyA messenger RNA and amplified by the polymerase chain reaction (PCR) for automated fluorescence sequencing (Applied Biosystems). The forward primers spanned nucleotides 137 to 155, 363 to 380, 721 to 741, and 1241 to 1261, and the reverse primers spanned nucleotides 450 to 432, 902 to 883, 1380 to 1360, and 1730 to 1710.²² Exons 11 and 12 of the gene for glutamate dehydrogenase (GLUD 1), together with portions of their adjacent introns,²³ were also amplified by PCR from lymphoblast genomic DNA for sequence analysis and restriction-endonuclease analysis. For exon 11, the forward primer was TGTAGTGTCTGTTCAAGAGAG and the reverse primer was ACACACATGTCACGCACTTAC. For exon 12, the forward primer was ACAGGGACACAAAGCAGGTC and the reverse primer was ACAGTCTGGCGGCTGAGATAG.

Site-directed mutagenesis was used to construct a pcDNA3 plasmid (Invitrogen) capable of expressing in COS-7 cells the mutation identified in Patient 1: a change from histidine to tyrosine at position 454 of the enzyme (His454Tyr). Full-length normal human glutamate dehydrogenase cDNA was obtained through the courtesy of Dr. Roberta Colman (Department of Chemistry, University of Delaware). The corresponding nucleotide substitution of thymidine for cytosine at position 1532 was incorporated with two rounds of overlapping PCR with a pair of internal primers containing the mutant base. After confirmation that the orientation and sequence were correct, the His454Tyr mutant glutamate dehydrogenase pcDNA3 was transfected into COS-7 cells with Lipofectin (BRL) and clones were selected with G418 (Geneticin, BRL). Aliquots of G418-resistant cells were grown in a 96-well plate, and the subclones were tested to determine whether they had increased expression of glutamate dehydrogenase and whether the sensitivity of the enzyme to GTP was altered. Cells transfected with the pcDNA3 vector alone were used as controls. Student's t-test was used to compare the results of these studies in the various groups of subjects.

Results

Enzymatic Activity of Glutamate Dehydrogenase

The activity and allosteric responses of glutamate dehydrogenase in lymphoblasts from the patients are shown in Table 1. The activity of the enzyme in the patients with sporadic cases of the hyperinsulinemia–hyperammonemia syndrome was not inhibited by GTP, as shown by the fact that the half-maximal inhibitory concentration (IC₅₀) for this effector was nearly four times as high as in the normal subjects. Enzyme activity in the subjects with the clinically milder familial cases was also less sensitive to inhibition by GTP, but the IC₅₀ was only twice the normal value.

View this table: [in this window] [in a new window]   Table 1. Activity and Allosteric Responsiveness of Glutamate Dehydrogenase in Lymphoblasts from Children with Sporadic or Familial Hyperinsulinism–Hyperammonemia Syndrome, Their Affected Relatives, and Normal Subjects.

 
Basal and maximal ADP-stimulated glutamate dehydrogenase activities were similar in the patients with sporadic hyperinsulinism–hyperammonemia and the normal subjects. In the patients with familial cases, basal enzyme activity was 38 percent of normal, although maximally stimulated glutamate dehydrogenase activity was only slightly less than normal (P = 0.07). The sensitivity to stimulation with ADP was similar in the three groups. The pattern of differences among the three groups was similar after dialysis of the lymphoblast homogenates, thus ruling out the possibility that the abnormalities were caused by binding of the effector molecules to the enzyme (data not shown). These results are compatible with the presence of intrinsic abnormalities in glutamate dehydrogenase in both groups of patients. Lymphoblast glutamate dehydrogenase from the unaffected parents and siblings of both groups of patients had normal responses to GTP. These results suggested that the defect in glutamate dehydrogenase is dominantly expressed and that the sporadic cases represented spontaneous mutations.

Mutation Analysis of Glutamate Dehydrogenase

Each of the eight patients with the hyperinsulinism–hyperammonemia syndrome was found to have a change in a single nucleotide that was predicted to alter 1 of 4 amino acids between residues 446 and 454 of the 505-amino-acid mature glutamate dehydrogenase (Table 2 and Figure 2). Among the six patients with sporadic cases, four different mutations were found. The two patients with familial cases shared a fifth mutation, although there was no evidence that they were related. No other mutations were found in any of the patients when the rest of the cDNA coding region for the enzyme was sequenced.

View this table: [in this window] [in a new window]   Table 2. Mutations Identified in the Glutamate Dehydrogenase Gene in Eight Children with the Hyperinsulinism–Hyperammonemia Syndrome.

 

View larger version (5K): [in this window] [in a new window]   Figure 2. Location of Mutations in the Glutamate Dehydrogenase Gene in Patients with Sporadic and Familial Cases of the Hyperinsulinism–Hyperammonemia Syndrome. Shown are the regions encoded by the 13 exons, the leader peptide, and the catalytic and allosteric domains of the enzyme. The mutations in both groups of patients are clustered in an area of 10 amino acid residues in the allosteric domain encoded by exons 11 and 12. Solid symbols indicate clinically more severe mutations in the sporadic cases, and the stippled symbol a clinically milder mutation in the familial cases.

 
Each of the five mutations eliminated a restriction-endonuclease digestion site or created a new site, thus making it possible to distinguish readily wild-type and mutant alleles in PCR products from either the cDNA or genomic DNA for glutamate dehydrogenase. All eight patients were heterozygous, with one mutant and one wild-type allele, a pattern consistent with the dominant expression of the mutations. None of the mutations were found on restriction-endonuclease analysis of genomic DNA from 55 normal subjects, suggesting that none of the mutations represented a common silent polymorphism. Similar analyses of genomic DNA from the mothers and fathers of the six patients with sporadic cases showed that none had their child's mutation, confirming that the mutation in these children was spontaneous.

Restriction-enzyme analysis of the PCR products of the cDNA for glutamate dehydrogenase or exon 12 genomic DNA in the parents and other relatives of Patients 7 and 8 showed that all seven affected relatives were heterozygous for the Ser448Pro mutation and the wild-type allele and that none of the six unaffected relatives who were studied had the mutation.

Expression of Glutamate Dehydrogenase Mutations in COS-7 Cells

The glutamate dehydrogenase activity of two clones of COS-7 cells transfected with the His454Tyr mutation (from Patient 1) was 57 and 35 nmol per minute per milligram of protein, as compared with a value of 24 nmol per minute per milligram of protein in cells transfected with vector alone. The enzyme in these two clones was less sensitive to GTP-induced inhibition than was the endogenous glutamate dehydrogenase in the control COS-7 cells (estimated IC₅₀, 200 nmol per liter) (Figure 3) or in normal human lymphoblasts. These results confirmed that the His454Tyr mutation resulted in decreased sensitivity to GTP-induced inhibition in a manner similar to that found in the patient's lymphoblasts.

View larger version (5K): [in this window] [in a new window]   Figure 3. Sensitivity of Mutant Glutamate Dehydrogenase to Inhibition by Guanosine 5'-Triphosphate. Two clones of COS-7 cells with the His454Tyr mutation (solid symbols) and control cells transfected with vector alone (open symbols) were incubated with various concentrations of guanosine 5'-triphosphate. The mean residual enzyme activity was significantly greater in cells containing the mutant glutamate dehydrogenase than in the control cells for both concentrations of guanosine 5'-triphosphate: at 300 nM guanosine 5'-triphosphate, the mean (±SE) activity of the mutant enzyme was 80±3 percent, and the mean activity of the normal enzyme was 37±7 percent (P = 0.002); at 500 nM guanosine 5'-triphosphate, the respective values were 61±10 percent and 20±5 percent (P = 0.004). Values are the means of four experiments for the mutant enzyme; for the normal enzyme, means and 95 percent confidence intervals for seven experiments are shown.

 
Discussion

The results of these studies indicate that the hyperinsulinism–hyperammonemia syndrome is associated with dominantly expressed mutations of mitochondrial glutamate dehydrogenase, which is encoded by the GLUD1 gene on chromosome 10. In all affected patients who were tested, glutamate dehydrogenase had reduced sensitivity to inhibition by GTP. This defect would be expected to result in abnormally high rates of glutamate oxidation, leading to excessive insulin secretion and impaired detoxification of ammonia by the liver (Figure 1).

The two groups of patients with hyperinsulinism and hyperammonemia had different degrees of impaired responsiveness to GTP inhibition that correlated with differences in the clinical phenotype. The patients with familial cases, in whom enzyme activity was more sensitive to inhibition by GTP than in the patients with sporadic cases, had less severe hypoglycemia. The lower basal enzyme activity in the patients with familial cases may also have contributed to their less severe hypoglycemia. Whether this difference reflects lower intrinsic activity of the enzyme, an altered allosteric effect, or lesser amounts of enzyme protein is not known.

The five mutations in glutamate dehydrogenase identified in these patients were all within exons 11 and 12 of GLUD1.²³ The tertiary structure of mammalian glutamate dehydrogenase has not been determined, but sequence comparisons with the nonallosteric glutamate dehydrogenase of prokaryotes and photoaffinity studies of bovine glutamate dehydrogenase suggest that the GTP allosteric domain of the mammalian enzyme is near the region encoded by these exons.^24,25,26 This suggestion is consistent with our observation that the mutations in the patients with sporadic cases impaired enzyme sensitivity to GTP-induced inhibition but did not affect basal or ADP-stimulated enzyme activity. All the mutations identified lie within a sequence of 15 amino acids that has been suggested to contain the GTP binding site.²⁶ Whether the mutations alter responses to other allosteric effectors of glutamate dehydrogenase, such as leucine or palmitoyl–coenzyme A,^27,28 is not known.

Since mature glutamate dehydrogenase is a hexamer of six identical subunits, the enzyme in patients with the hyperinsulinism–hyperammonemia syndrome is likely to be composed of a mixture of heterohexamers containing, on average, equal numbers of mutant and wild-type subunits. Protein–protein interactions between these subunits may be an important factor in the dominant effects of the mutations. The glutamate dehydrogenase with the His454Tyr mutation had impaired sensitivity to GTP when transfected into COS-7 cells, a finding similar to those in lymphoblasts from the heterozygous patients.

The existence of the hyperinsulinism–hyperammonemia syndrome highlights the importance of glutamate dehydrogenase in the regulation of insulin secretion^15,16,29 and indicates that the enzyme has an important role in regulating hepatic ureagenesis.¹⁸ Partial deficiency of glutamate dehydrogenase has been reported in some patients with cerebellar degeneration,³⁰ suggesting that the enzyme is important in brain function. Further studies of glutamate dehydrogenase in beta cells, liver, and brain may provide explanations for three features in patients with the hyperinsulinism–hyperammonemia syndrome that remain a puzzle: sensitivity to leucine or protein-induced hypoglycemia, the ability to ingest protein loads without worsening hyperammonemia, and the apparent absence of central nervous system symptoms due to hyperammonemia.^11,12

In conclusion, the hyperinsulinism–hyperammonemia syndrome is a distinctive genetic disorder of insulin secretion caused by mutations in the gene for glutamate dehydrogenase. The disorder should be considered as part of the differential diagnosis in children with hyperinsulinism who respond to diazoxide; it can be recognized by the finding of a high plasma ammonium concentration in association with insulin-induced hypoglycemia.

Supported in part by grants from the National Institutes of Health (RR-00240) and the American Diabetes Association.

We are indebted to Drs. Lester Baker, Paul Thornton, Franz Matschinsky, Catherine Stolle, Gerard T. Berry, and Marc Yudkoff for helpful discussions; to Dr. Roberta Colman for her advice; to Drs. Heather Dean and John Christodoulo and Louise A. Dilling for helping to acquire samples; to Dr. Ramesh Basani for many contributions to this work; and to Linda Liszewski and Lev Grunstein for assisting with the mutation analysis.

Source Information

From the Divisions of Endocrinology (C.A.S., Y.K.L., B.Y.L.H.) and Hematology (M.P.), Children's Hospital of Philadelphia, University of Pennsylvania School of Medicine, Philadelphia; the Department of Pediatrics, University of Padua, Padua, Italy (A.B.B.); the Section of Genetics and Metabolism, Department of Pediatrics and Child Health, University of Manitoba, Winnipeg, Canada (C.R.G.); the Endocrinology Division, C.S. Mott Children's Hospital, University of Michigan School of Medicine, Ann Arbor (N.J.H.); the Division of Endocrinology, Hospital for Sick Children, University of Toronto School of Medicine, Toronto (K.P.); the Section of Endocrinology, Chicago Children's Hospital, University of Chicago Pritzker School of Medicine, Chicago (B.H.R.); and the Department of Pediatrics, University of Florence, Florence, Italy (E.Z.).

Address reprint requests to Dr. Stanley at the Division of Endocrinology, Children's Hospital of Philadelphia, 34th St. and Civic Center Blvd., Philadelphia, PA 19104.

References

1. Stanley CA. Hyperinsulinism in infants and children. Pediatr Clin North Am 1997;44:363-374. [CrossRef][Medline]
2. Thornton PS, Sumner AE, Ruchelli ED, Spielman RS, Baker L, Stanley CA. Familial and sporadic hyperinsulinism: histopathologic findings and segregation analysis support a single autosomal recessive disorder. J Pediatr 1991;119:721-724. [CrossRef][Medline]
3. Nestorowicz A, Wilson BA, Schoor KP, et al. Mutations in the sulfonylurea receptor gene are associated with familial hyperinsulinism in Ashkenazi Jews. Hum Mol Genet 1996;5:1813-1822. [Free Full Text]
4. Thomas PM, Cote GJ, Wohllk N, et al. Mutations in the sulfonylurea receptor gene in familial persistent hyperinsulinemic hypoglycemia of infancy. Science 1995;268:426-429. [Free Full Text]
5. Permutt MA, Nestorowicz A, Glaser B. Familial hyperinsulinism: an inherited disorder of spontaneous hypoglycemia in neonates and infants. Diabetes Rev 1996;4:347-55.
6. Dunne MJ, Kane C, Shepherd RM, et al. Familial persistent hyperinsulinemic hypoglycemia of infancy and mutations in the sulfonylurea receptor. N Engl J Med 1997;336:703-706. [Free Full Text]
7. Thomas P, Ye YY, Lightner E. Mutation of the pancreatic islet inward rectifier Kir6.2 also leads to familial persistent hyperinsulinemic hypoglycemia of infancy. Hum Mol Genet 1996;5:1809-1812. [Free Full Text]
8. Thornton PS, Satin-Smith M, Herold K, et al. Familial hyperinsulinism with apparent autosomal dominant inheritance: clinical and genetic differences from the autosomal recessive variant. J Pediatr 1998;132:9-14. [CrossRef][Medline]
9. Kukuvitis A, Deal C, Arbour L, Polychronakos C. An autosomal dominant form of familial persistent hyperinsulinemic hypoglycemia of infancy, not linked to the sulfonylurea receptor locus. J Clin Endocrinol Metab 1997;82:1192-1194. [Free Full Text]
10. Glaser B, Kesavan P, Heyman M, et al. Familial hyperinsulinism caused by an activating glucokinase mutation. N Engl J Med 1998;338:226-230. [Free Full Text]
11. Weinzimer SA, Stanley CA, Berry GT, Yudkoff M, Tuchman M, Thornton PS. A syndrome of congenital hyperinsulinism and hyperammonemia. J Pediatr 1997;130:661-664. [CrossRef][Medline]
12. Zammarchi E, Filippi L, Novembre E, Donati MA. Biochemical evaluation of a patient with a familial form of leucine-sensitive hypoglycemia and concomitant hyperammonemia. Metabolism 1996;45:957-960. [CrossRef][Medline]
13. Matschinsky FM, Sweet IR. Annotated questions and answers about glucose metabolism and insulin secretion of -cells. Diabetes Rev 1996;4:130-44.
14. Gylfe E. Comparison of the effects of leucines, non-metabolizable leucine analogues and other insulin secretagogues on the activity of glutamate dehydrogenase. Acta Diabetol Lat 1976;13:20-24. [Medline]
15. Sener A, Malaisse-Lagae F, Malaisse WJ. Stimulation of pancreatic islet metabolism and insulin release by a nonmetabolizable amino acid. Proc Natl Acad Sci U S A 1981;78:5460-5464. [Free Full Text]
16. Fahien LA, MacDonald MJ, Kmiotek EH, Mertz RJ, Fahien CM. Regulation of insulin release by factors that also modify glutamate dehydrogenase. J Biol Chem 1988;263:13610-13614. [Free Full Text]
17. Sener A, Malaisse WJ. L-leucine and a nonmetabolized analogue activate pancreatic islet glutamate dehydrogenase. Nature 1980;288:187-189. [CrossRef][Medline]
18. Brusilow SW, Horwich AL. Urea cycle enzymes. In: Scriver CR, Beaudet AL, Sly WS, Valle D, eds. The metabolic and molecular bases of inherited disease. 7th ed. Vol. 1. New York: McGraw-Hill, 1995:1187-232.
19. Stewart PM, Walser M. Short term regulation of ureagenesis. J Biol Chem 1980;255:5270-5280. [Free Full Text]
20. Wrzeszczynski KO, Colman RF. Activation of bovine liver glutamate dehydrogenase by covalent reaction of adenosine 5'-O-[S-(4-bromo-2,3-dioxobutyl)thiophosphate] with arginine-459 at an ADP regulatory site. Biochemistry 1994;33:11544-11553. [CrossRef][Medline]
21. Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein measurement with the Folin phenol reagent. J Biol Chem 1951;193:265-275. [Free Full Text]
22. Nakatani Y, Schneider M, Banner C, Freese E. Complete nucleotide sequence of human glutamate dehydrogenase cDNA. Nucleic Acids Res 1988;16:6237-6237. [Free Full Text]
23. Michaelidis TM, Tzimagiorgis G, Moschonas NK, Papamatheakis J. The human glutamate dehydrogenase gene family: gene organization and structural characterization. Genomics 1993;16:150-160. [CrossRef][Medline]
24. Brunhuber NMW, Blanchard JS. The biochemistry and enzymology of amino acid dehydrogenases. Crit Rev Biochem Mol Biol 1994;29:415-467. [Medline]
25. Teller JK, Baker PJ, Britton KL, Engel PC, Rice DW, Stillman TJ. Correlation of intron-exon organisation with the three-dimensional structure in glutamate dehydrogenase. Biochim Biophys Acta 1995;1247:231-238. [CrossRef][Medline]
26. Cho SW, Ahn JY, Lee J, Choi SY. Identification of a peptide of the guanosine triphosphate binding site within brain glutamate dehydrogenase isoproteins using 8-azidoguanosine triphosphate. Biochemistry 1996;35:13907-13913. [CrossRef][Medline]
27. Colman RF. Glutamate dehydrogenase (bovine liver). In: Kuby SA, ed. A study of enzymes. Vol. 2. Mechanism of enzyme action. Boca Raton, Fla.: CRC Press, 1991:173-92.
28. Fahien LA, Kmiotek E. Regulation of glutamate dehydrogenase by palmitoyl-coenzyme A. Arch Biochem Biophys 1981;212:247-253. [CrossRef][Medline]
29. Bryla J, Michalik M, Nelson J, Erecinska M. Regulation of the glutamate dehydrogenase activity in rat islets of Langerhans and its consequence on insulin release. Metabolism 1994;43:1187-1195. [CrossRef][Medline]
30. Plaitakis A, Flessas P, Natsiou AB, Shashidharan P. Glutamate dehydrogenase deficiency in cerebellar degenerations: clinical, biochemical and molecular genetic aspects. Can J Neurol Sci 1993;20:Suppl 3:S109-S116.

Abstract PDF Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited PubMed Citation

This article has been cited by other articles:

• Kapoor, R. R, Flanagan, S. E, Fulton, P., Chakrapani, A., Chadefaux, B., Ben-Omran, T., Banerjee, I., Shield, J. P, Ellard, S., Hussain, K. (2009). Hyperinsulinism-hyperammonaemia syndrome: novel mutations in the GLUD1 gene and genotype-phenotype correlations. Eur J Endocrinol 161: 731-735 [Abstract] [Full Text]  
• Stanley, C. A (2009). Regulation of glutamate metabolism and insulin secretion by glutamate dehydrogenase in hypoglycemic children. Am. J. Clin. Nutr. 90: 862S-866S [Abstract] [Full Text]  
• Li, M., Smith, C. J., Walker, M. T., Smith, T. J. (2009). Novel Inhibitors Complexed with Glutamate Dehydrogenase: ALLOSTERIC REGULATION BY CONTROL OF PROTEIN DYNAMICS. J. Biol. Chem. 284: 22988-23000 [Abstract] [Full Text]  
• Tennant, D. A., Duran, R. V., Boulahbel, H., Gottlieb, E. (2009). Metabolic transformation in cancer. Carcinogenesis 30: 1269-1280 [Abstract] [Full Text]  
• Kapoor, R. R., James, C., Flanagan, S. E., Ellard, S., Eaton, S., Hussain, K. (2009). 3-Hydroxyacyl-Coenzyme A Dehydrogenase Deficiency and Hyperinsulinemic Hypoglycemia: Characterization of a Novel Mutation and Severe Dietary Protein Sensitivity. J. Clin. Endocrinol. Metab. 94: 2221-2225 [Abstract] [Full Text]  
• Sayed, S., Langdon, D. R., Odili, S., Chen, P., Buettger, C., Schiffman, A. B., Suchi, M., Taub, R., Grimsby, J., Matschinsky, F. M., Stanley, C. A. (2009). Extremes of Clinical and Enzymatic Phenotypes in Children With Hyperinsulinism Caused by Glucokinase Activating Mutations. Diabetes 58: 1419-1427 [Abstract] [Full Text]  
• Kapoor, R R, Flanagan, S E, James, C, Shield, J, Ellard, S, Hussain, K (2009). Hyperinsulinaemic hypoglycaemia. Arch. Dis. Child. 94: 450-457 [Abstract] [Full Text]  
• James, C, Kapoor, R R, Ismail, D, Hussain, K (2009). The genetic basis of congenital hyperinsulinism. J. Med. Genet. 46: 289-299 [Abstract] [Full Text]  
• Carobbio, S., Frigerio, F., Rubi, B., Vetterli, L., Bloksgaard, M., Gjinovci, A., Pournourmohammadi, S., Herrera, P. L., Reith, W., Mandrup, S., Maechler, P. (2009). Deletion of Glutamate Dehydrogenase in ss-Cells Abolishes Part of the Insulin Secretory Response Not Required for Glucose Homeostasis. J. Biol. Chem. 284: 921-929 [Abstract] [Full Text]  
• Jensen, M. V., Joseph, J. W., Ronnebaum, S. M., Burgess, S. C., Sherry, A. D., Newgard, C. B. (2008). Metabolic cycling in control of glucose-stimulated insulin secretion. Am. J. Physiol. Endocrinol. Metab. 295: E1287-E1297 [Abstract] [Full Text]  
• Klootwijk, R. D., Savelkoul, P. J. M., Ciccone, C., Manoli, I., Caplen, N. J., Krasnewich, D. M., Gahl, W. A., Huizing, M. (2008). Allele-specific silencing of the dominant disease allele in sialuria by RNA interference. FASEB J. 22: 3846-3852 [Abstract] [Full Text]  
• Christesen, H. B T, Tribble, N. D, Molven, A., Siddiqui, J., Sandal, T., Brusgaard, K., Ellard, S., Njolstad, P. R, Alm, J., Brock Jacobsen, B., Hussain, K., Gloyn, A. L (2008). Activating glucokinase (GCK) mutations as a cause of medically responsive congenital hyperinsulinism: prevalence in children and characterisation of a novel GCK mutation.. Eur J Endocrinol 159: 27-34 [Abstract] [Full Text]  
• Palladino, A. A., Bennett, M. J., Stanley, C. A. (2008). Hyperinsulinism in Infancy and Childhood: When an Insulin Level Is Not Always Enough. Clin. Chem. 54: 256-263 [Abstract] [Full Text]  
• Martens, G. A., Vervoort, A., Van de Casteele, M., Stange, G., Hellemans, K., Van Thi, H. V., Schuit, F., Pipeleers, D. (2007). Specificity in Beta Cell Expression of L-3-Hydroxyacyl-CoA Dehydrogenase, Short Chain, and Potential Role in Down-regulating Insulin Release. J. Biol. Chem. 282: 21134-21144 [Abstract] [Full Text]  
• Choi, M.-M., Kim, E.-A, Yang, S.-J., Choi, S. Y., Cho, S.-W., Huh, J.-W. (2007). Amino Acid Changes within Antenna Helix Are Responsible for Different Regulatory Preferences of Human Glutamate Dehydrogenase Isozymes. J. Biol. Chem. 282: 19510-19517 [Abstract] [Full Text]  
• Newsholme, P., Brennan, L., Bender, K. (2006). Amino Acid Metabolism, {beta}-Cell Function, and Diabetes. Diabetes 55: S39-S47 [Abstract] [Full Text]  
• Haigis, M. C., Guarente, L. P. (2006). Mammalian sirtuins--emerging roles in physiology, aging, and calorie restriction.. Genes Dev. 20: 2913-2921 [Abstract] [Full Text]  
• Giurgea, I., Sempoux, C., Bellanne-Chantelot, C., Ribeiro, M., Hubert, L., Boddaert, N., Saudubray, J.-M., Robert, J.-J., Brunelle, F., Rahier, J., Jaubert, F., Nihoul-Fekete, C., de Lonlay, P. (2006). The Knudson's Two-Hit Model and Timing of Somatic Mutation May Account for the Phenotypic Diversity of Focal Congenital Hyperinsulinism. J. Clin. Endocrinol. Metab. 91: 4118-4123 [Abstract] [Full Text]  
• Corless, M., Kiely, A., McClenaghan, N. H, Flatt, P. R, Newsholme, P. (2006). Glutamine regulates expression of key transcription factor, signal transduction, metabolic gene, and protein expression in a clonal pancreatic {beta}-cell line.. J Endocrinol 190: 719-727 [Abstract] [Full Text]  
• Li, C., Matter, A., Kelly, A., Petty, T. J., Najafi, H., MacMullen, C., Daikhin, Y., Nissim, I., Lazarow, A., Kwagh, J., Collins, H. W., Hsu, B. Y. L., Nissim, I., Yudkoff, M., Matschinsky, F. M., Stanley, C. A. (2006). Effects of a GTP-insensitive Mutation of Glutamate Dehydrogenase on Insulin Secretion in Transgenic Mice. J. Biol. Chem. 281: 15064-15072 [Abstract] [Full Text]  
• Li, C., Allen, A., Kwagh, J., Doliba, N. M., Qin, W., Najafi, H., Collins, H. W., Matschinsky, F. M., Stanley, C. A., Smith, T. J. (2006). Green Tea Polyphenols Modulate Insulin Secretion by Inhibiting Glutamate Dehydrogenase. J. Biol. Chem. 281: 10214-10221 [Abstract] [Full Text]  
• Giurgea, I, Sanlaville, D, Fournet, J-C, Sempoux, C, Bellanne-Chantelot, C, Touati, G, Hubert, L, Groos, M-S, Brunelle, F, Rahier, J, Henquin, J-C, Dunne, M J, Jaubert, F, Robert, J-J, Nihoul-Fekete, C, Vekemans, M, Junien, C, de Lonlay, P (2006). Congenital hyperinsulinism and mosaic abnormalities of the ploidy. J. Med. Genet. 43: 248-254 [Abstract] [Full Text]  
• Hussain, K., Bryan, J., Christesen, H. T., Brusgaard, K., Aguilar-Bryan, L. (2005). Serum Glucagon Counterregulatory Hormonal Response to Hypoglycemia Is Blunted in Congenital Hyperinsulinism. Diabetes 54: 2946-2951 [Abstract] [Full Text]  
• Rabaglia, M. E., Gray-Keller, M. P., Frey, B. L., Shortreed, M. R., Smith, L. M., Attie, A. D. (2005). {alpha}-Ketoisocaproate-induced hypersecretion of insulin by islets from diabetes-susceptible mice. Am. J. Physiol. Endocrinol. Metab. 289: E218-E224 [Abstract] [Full Text]  
• Hussain, K., Cosgrove, K. E., Shepherd, R. M., Luharia, A., Smith, V. V., Kassem, S., Gregory, J. W., Sivaprasadarao, A., Christesen, H. T., Jacobsen, B. B., Brusgaard, K., Glaser, B., Maher, E. A., Lindley, K. J., Hindmarsh, P., Dattani, M., Dunne, M. J. (2005). Hyperinsulinemic Hypoglycemia in Beckwith-Wiedemann Syndrome due to Defects in the Function of Pancreatic {beta}-Cell Adenosine Triphosphate-Sensitive Potassium Channels. J. Clin. Endocrinol. Metab. 90: 4376-4382 [Abstract] [Full Text]  
• Giurgea, I., Ulinski, T., Touati, G., Sempoux, C., Mochel, F., Brunelle, F., Saudubray, J.-M., Fekete, C., de Lonlay, P. (2005). Factitious Hyperinsulinism Leading to Pancreatectomy: Severe Forms of Munchausen Syndrome by Proxy. Pediatrics 116: e145-e148 [Abstract] [Full Text]  
• Ribeiro, M.-J., De Lonlay, P., Delzescaux, T., Boddaert, N., Jaubert, F., Bourgeois, S., Dolle, F., Nihoul-Fekete, C., Syrota, A., Brunelle, F. (2005). Characterization of Hyperinsulinism in Infancy Assessed with PET and 18F-Fluoro-L-DOPA. JNM 46: 560-566 [Abstract] [Full Text]  
• MacDonald, M. J., Fahien, L. A., Brown, L. J., Hasan, N. M., Buss, J. D., Kendrick, M. A. (2005). Perspective: emerging evidence for signaling roles of mitochondrial anaplerotic products in insulin secretion. Am. J. Physiol. Endocrinol. Metab. 288: E1-E15 [Abstract] [Full Text]  
• Tornovsky, S., Crane, A., Cosgrove, K. E., Hussain, K., Lavie, J., Heyman, M., Nesher, Y., Kuchinski, N., Ben-Shushan, E., Shatz, O., Nahari, E., Potikha, T., Zangen, D., Tenenbaum-Rakover, Y., de Vries, L., Argente, J., Gracia, R., Landau, H., Eliakim, A., Lindley, K., Dunne, M. J., Aguilar-Bryan, L., Glaser, B. (2004). Hyperinsulinism of Infancy: Novel ABCC8 and KCNJ11 Mutations and Evidence for Additional Locus Heterogeneity. J. Clin. Endocrinol. Metab. 89: 6224-6234 [Abstract] [Full Text]  
• Cline, G. W., LePine, R. L., Papas, K. K., Kibbey, R. G., Shulman, G. I. (2004). 13C NMR Isotopomer Analysis of Anaplerotic Pathways in INS-1 Cells. J. Biol. Chem. 279: 44370-44375 [Abstract] [Full Text]  
• Magge, S. N., Shyng, S.-L., MacMullen, C., Steinkrauss, L., Ganguly, A., Katz, L. E. L., Stanley, C. A. (2004). Familial Leucine-Sensitive Hypoglycemia of Infancy Due to a Dominant Mutation of the {beta}-Cell Sulfonylurea Receptor. J. Clin. Endocrinol. Metab. 89: 4450-4456 [Abstract] [Full Text]  
• Cuesta-Munoz, A. L., Huopio, H., Otonkoski, T., Gomez-Zumaquero, J. M., Nanto-Salonen, K., Rahier, J., Lopez-Enriquez, S., Garcia-Gimeno, M. A., Sanz, P., Soriguer, F. C., Laakso, M. (2004). Severe Persistent Hyperinsulinemic Hypoglycemia due to a De Novo Glucokinase Mutation. Diabetes 53: 2164-2168 [Abstract] [Full Text]  
• Hojlund, K., Hansen, T., Lajer, M., Henriksen, J. E., Levin, K., Lindholm, J., Pedersen, O., Beck-Nielsen, H. (2004). A Novel Syndrome of Autosomal-Dominant Hyperinsulinemic Hypoglycemia Linked to a Mutation in the Human Insulin Receptor Gene. Diabetes 53: 1592-1598 [Abstract] [Full Text]  
• Li, C., Buettger, C., Kwagh, J., Matter, A., Daikhin, Y., Nissim, I. B., Collins, H. W., Yudkoff, M., Stanley, C. A., Matschinsky, F. M. (2004). A Signaling Role of Glutamine in Insulin Secretion. J. Biol. Chem. 279: 13393-13401 [Abstract] [Full Text]  
• Giurgea, I., Laborde, K., Touati, G., Bellanne-Chantelot, C., Nassogne, M.-C., Sempoux, C., Jaubert, F., Khoa, N., Chigot, V., Rahier, J., Brunelle, F., Nihoul-Fekete, C., Dunne, M. J., Stanley, C., Saudubray, J.-M., Robert, J.-J., de Lonlay, P. (2004). Acute Insulin Responses to Calcium and Tolbutamide Do Not Differentiate Focal from Diffuse Congenital Hyperinsulinism. J. Clin. Endocrinol. Metab. 89: 925-929 [Abstract] [Full Text]  
• Anno, T., Uehara, S., Katagiri, H., Ohta, Y., Ueda, K., Mizuguchi, H., Moriyama, Y., Oka, Y., Tanizawa, Y. (2004). Overexpression of constitutively activated glutamate dehydrogenase induces insulin secretion through enhanced glutamate oxidation. Am. J. Physiol. Endocrinol. Metab. 286: E280-E285 [Abstract] [Full Text]  
• Stanley, C. A., Thornton, P. S., Ganguly, A., MacMullen, C., Underwood, P., Bhatia, P., Steinkrauss, L., Wanner, L., Kaye, R., Ruchelli, E., Suchi, M., Adzick, N. S. (2004). Preoperative Evaluation of Infants with Focal or Diffuse Congenital Hyperinsulinism by Intravenous Acute Insulin Response Tests and Selective Pancreatic Arterial Calcium Stimulation. J. Clin. Endocrinol. Metab. 89: 288-296 [Abstract] [Full Text]  
• DUNNE, M. J., COSGROVE, K. E., SHEPHERD, R. M., AYNSLEY-GREEN, A., LINDLEY, K. J. (2004). Hyperinsulinism in Infancy: From Basic Science to Clinical Disease. Physiol. Rev. 84: 239-275 [Abstract] [Full Text]  
• Molven, A., Matre, G. E., Duran, M., Wanders, R. J., Rishaug, U., Njolstad, P. R., Jellum, E., Sovik, O. (2004). Familial Hyperinsulinemic Hypoglycemia Caused by a Defect in the SCHAD Enzyme of Mitochondrial Fatty Acid Oxidation. Diabetes 53: 221-227 [Abstract] [Full Text]  
• Hussain, K, Aynsley-Green, A (2004). Hyperinsulinaemic hypoglycaemia in preterm neonates. Arch. Dis. Child. Fetal Neonatal Ed. 89: F65-F67 [Abstract] [Full Text]  
• Thornton, P. S., MacMullen, C., Ganguly, A., Ruchelli, E., Steinkrauss, L., Crane, A., Aguilar-Bryan, L., Stanley, C. A. (2003). Clinical and Molecular Characterization of a Dominant Form of Congenital Hyperinsulinism Caused by a Mutation in the High-Affinity Sulfonylurea Receptor. Diabetes 52: 2403-2410 [Abstract] [Full Text]  
• Eto, K., Yamashita, T., Hirose, K., Tsubamoto, Y., Ainscow, E. K., Rutter, G. A., Kimura, S., Noda, M., Iino, M., Kadowaki, T. (2003). Glucose metabolism and glutamate analog acutely alkalinize pH of insulin secretory vesicles of pancreatic {beta}-cells. Am. J. Physiol. Endocrinol. Metab. 285: E262-E271 [Abstract] [Full Text]  
• Gao, Z., Young, R. A., Li, G., Najafi, H., Buettger, C., Sukumvanich, S. S., Wong, R. K., Wolf, B. A., Matschinsky, F. M. (2003). Distinguishing Features of Leucine and {alpha}-Ketoisocaproate Sensing in Pancreatic {beta}-Cells. Endocrinology 144: 1949-1957 [Abstract] [Full Text]  
• Li, C., Najafi, H., Daikhin, Y., Nissim, I. B., Collins, H. W., Yudkoff, M., Matschinsky, F. M., Stanley, C. A. (2003). Regulation of Leucine-stimulated Insulin Secretion and Glutamine Metabolism in Isolated Rat Islets. J. Biol. Chem. 278: 2853-2858 [Abstract] [Full Text]  
• Otonkoski, T., Kaminen, N., Ustinov, J., Lapatto, R., Meissner, T., Mayatepek, E., Kere, J., Sipila, I. (2003). Physical Exercise-Induced Hyperinsulinemic Hypoglycemia Is an Autosomal-Dominant Trait Characterized by Abnormal Pyruvate-Induced Insulin Release. Diabetes 52: 199-204 [Abstract] [Full Text]  
• Nissim, I., Horyn, O., Daikhin, Y., Nissim, I., Lazarow, A., Yudkoff, M. (2002). Regulation of urea synthesis by agmatine in the perfused liver: studies with 15N. Am. J. Physiol. Endocrinol. Metab. 283: E1123-E1134 [Abstract] [Full Text]  
• Kelly, A., Li, C., Gao, Z., Stanley, C. A., Matschinsky, F. M. (2002). Glutaminolysis and Insulin Secretion: From Bedside to Bench and Back. Diabetes 51: S421-426 [Abstract] [Full Text]  
• Zaganas, I., Spanaki, C., Karpusas, M., Plaitakis, A. (2002). Substitution of Ser for Arg-443 in the Regulatory Domain of Human Housekeeping (GLUD1) Glutamate Dehydrogenase Virtually Abolishes Basal Activity and Markedly Alters the Activation of the Enzyme by ADP and L-Leucine. J. Biol. Chem. 277: 46552-46558 [Abstract] [Full Text]  
• Stanley, C. A. (2002). Advances in Diagnosis and Treatment of Hyperinsulinism in Infants and Children. J. Clin. Endocrinol. Metab. 87: 4857-4859 [Full Text]  
• Cosgrove, K. E., Antoine, M.-H., Lee, A. T., Barnes, P. D., de Tullio, P., Clayton, P., McCloy, R., De Lonlay, P., Nihoul-Fekete, C., Robert, J.-J., Saudubray, J.-M., Rahier, J., Lindley, K. J., Hussain, K., Aynsley-Green, A., Pirotte, B., Lebrun, P., Dunne, M. J. (2002). BPDZ 154 Activates Adenosine 5'-Triphosphate-Sensitive Potassium Channels: In Vitro Studies Using Rodent Insulin-Secreting Cells and Islets Isolated from Patients with Hyperinsulinism. J. Clin. Endocrinol. Metab. 87: 4860-4868 [Abstract] [Full Text]  
• Huopio, H., Shyng, S.-L., Otonkoski, T., Nichols, C. G. (2002). KATP channels and insulin secretion disorders. Am. J. Physiol. Endocrinol. Metab. 283: E207-E216 [Abstract] [Full Text]  
• Zaganas, I., Plaitakis, A. (2002). Single Amino Acid Substitution (G456A) in the Vicinity of the GTP Binding Domain of Human Housekeeping Glutamate Dehydrogenase Markedly Attenuates GTP Inhibition and Abolishes the Cooperative Behavior of the Enzyme. J. Biol. Chem. 277: 26422-26428 [Abstract] [Full Text]  
• Dekel, B., Lubin, D., Modan-Moses, D., Quint, J., Glaser, B., Meyerovitch, J. (2002). Compound Heterozygosity for the Common Sulfonylurea Receptor Mutations Can Cause Mild Diazoxide-Sensitive Hyperinsulinism. CLIN PEDIATR 41: 183-186 [Abstract]  
• Christesen, H. B.T., Jacobsen, B. B., Odili, S., Buettger, C., Cuesta-Munoz, A., Hansen, T., Brusgaard, K., Massa, O., Magnuson, M. A., Shiota, C., Matschinsky, F. M., Barbetti, F. (2002). The Second Activating Glucokinase Mutation (A456V): Implications for Glucose Homeostasis and Diabetes Therapy. Diabetes 51: 1240-1246 [Abstract] [Full Text]  
• Tanizawa, Y., Nakai, K., Sasaki, T., Anno, T., Ohta, Y., Inoue, H., Matsuo, K., Koga, M., Furukawa, S., Oka, Y. (2002). Unregulated Elevation of Glutamate Dehydrogenase Activity Induces Glutamine-Stimulated Insulin Secretion: Identification and Characterization of a GLUD1 Gene Mutation and Insulin Secretion Studies With MIN6 Cells Overexpressing the Mutant Glutamate Dehydrogenase . Diabetes 51: 712-717 [Abstract] [Full Text]  
• Sadeghi-Nejad, A., Graeme-Cook, F. M. (2001). Case 39-2001- A Newborn Girl with Seizures and Persistent Hypoglycemia. NEJM 345: 1833-1839 [Full Text]  
• Young, V. R., Ajami, A. M. (2001). Glutamine: The Emperor or His Clothes?. J. Nutr. 131: 2449S-2459 [Abstract] [Full Text]  
• Kelly, A., Ng, D., Ferry, R. J. Jr., Grimberg, A., Koo-McCoy, S., Thornton, P. S., Stanley, C. A. (2001). Acute Insulin Responses to Leucine in Children with the Hyperinsulinism/Hyperammonemia Syndrome. J. Clin. Endocrinol. Metab. 86: 3724-3728 [Abstract] [Full Text]  
• MacMullen, C., Fang, J., Hsu, B. Y. L., Kelly, A., de Lonlay-Debeney, P., Saudubray, J.-M., Ganguly, A., Smith, T. J., Stanley, C. A. (2001). Hyperinsulinism/Hyperammonemia Syndrome in Children with Regulatory Mutations in the Inhibitory Guanosine Triphosphate-Binding Domain of Glutamate Dehydrogenase. J. Clin. Endocrinol. Metab. 86: 1782-1787 [Abstract] [Full Text]  
• Meissner, T, Otonkoski, T, Feneberg, R, Beinbrech, B, Apostolidou, S, Sipilä, I, Schaefer, F, Mayatepek, E (2001). Exercise induced hypoglycaemic hyperinsulinism. Arch. Dis. Child. 84: 254-257 [Abstract] [Full Text]  
• Ronner, P., Naumann, C. M., Friel, E. (2001). Effects of Glucose and Amino Acids on Free ADP in {beta}HC9 Insulin-Secreting Cells. Diabetes 50: 291-300 [Abstract] [Full Text]  
• Grimberg, A., Ferry, R.J. Jr., Kelly, A., Koo-McCoy, S., Polonsky, K., Glaser, B., Permutt, M.A., Aguilar-Bryan, L., Stafford, D., Thornton, P.S., Baker, L., Stanley, C. A. (2001). Dysregulation of Insulin Secretion in Children With Congenital Hyperinsulinism due to Sulfonylurea Receptor Mutations. Diabetes 50: 322-328 [Abstract] [Full Text]  
• Straub, S. G., Cosgrove, K. E., Ämmälä, C., Shepherd, R. M., O'Brien, R. E., Barnes, P. D., Kuchinski, N.'a., Chapman, J. C., Schaeppi, M., Glaser, B., Lindley, K. J., Sharp, G. W.G., Aynsley-Green, A., Dunne, M. J. (2001). Hyperinsulinism of Infancy: The Regulated Release of Insulin by KATP Channel--Independent Pathways. Diabetes 50: 329-339 [Abstract] [Full Text]  
• Munns, C F J, Batch, J A (2001). Hyperinsulinism and Beckwith-Wiedemann syndrome. Arch. Dis. Child. Fetal Neonatal Ed. 84: 67F-69 [Full Text]  
• Maechler, P., Wollheim, C. B (2000). Mitochondrial signals in glucose-stimulated insulin secretion in the beta cell. J. Physiol. 529: 49-56 [Abstract] [Full Text]  
• Thomas, P. M. (2000). Neonatal Insulin Secretion and Persistent Hyperinsulinemia of Infancy. NeoReviews 1: e210-214 [Full Text]  
• Huijmans, J. G. M., Duran, M., de Klerk, J. B. C., Rovers, M. J., Scholte, H. R. (2000). Functional Hyperactivity of Hepatic Glutamate Dehydrogenase as a Cause of the Hyperinsulinism/Hyperammonemia Syndrome: Effect of Treatment. Pediatrics 106: 596-600 [Abstract] [Full Text]  
• Adzick, N. S., Nance, M. L. (2000). Pediatric Surgery- First of Two Parts. NEJM 342: 1651-1657 [Full Text]  
• Young, V. R., Ajami, A. M. (2000). Glutamate: An Amino Acid of Particular Distinction. J. Nutr. 130: 892-892 [Abstract] [Full Text]  
• Glaser, B., Thornton, P., Otonkoski, T., Junien, C. (2000). Genetics of neonatal hyperinsulinism. Arch. Dis. Child. Fetal Neonatal Ed. 82: 79F-86 [Abstract] [Full Text]  
• Shepherd, R. M, Cosgrove, K. E, O'Brien, R. E, Barnes, P. D, Ämmälä, C., Dunne, M. J (2000). Hyperinsulinism of infancy: towards an understanding of unregulated insulin release. Arch. Dis. Child. Fetal Neonatal Ed. 82: 87F-97 [Abstract] [Full Text]  
• Aynsley-Green, A, Hussain, K, Hall, J, Saudubray, J M, Nihoul-Fékété, C, De Lonlay-Debeney, P, Brunelle, F, Otonkoski, T, Thornton, P, Lindley, K J (2000). Practical management of hyperinsulinism in infancy. Arch. Dis. Child. Fetal Neonatal Ed. 82: 98F-107 [Abstract] [Full Text]  
• Rahier, J, Guiot, Y, Sempoux, C (2000). Persistent hyperinsulinaemic hypoglycaemia of infancy: a heterogeneous syndrome unrelated to nesidioblastosis. Arch. Dis. Child. Fetal Neonatal Ed. 82: 108F-112 [Full Text]  
• MacFarlane, W. M., Chapman, J. C., Shepherd, R. M., Hashmi, M. N., Kamimura, N., Cosgrove, K. E., O'Brien, R. E., Barnes, P. D., Hart, A. W., Docherty, H. M., Lindley, K. J., Aynsley-Green, A., James, R. F. L., Docherty, K., Dunne, M. J. (1999). Engineering a Glucose-responsive Human Insulin-secreting Cell Line from Islets of Langerhans Isolated from a Patient with Persistent Hyperinsulinemic Hypoglycemia of Infancy. J. Biol. Chem. 274: 34059-34066 [Abstract] [Full Text]  
• ABRAHAM, M. R., JAHANGIR, A., ALEKSEEV, A. E., TERZIC, A. (1999). Channelopathies of inwardly rectifying potassium channels. FASEB J. 13: 1901-1910 [Abstract] [Full Text]  
• Nissim, I., Brosnan, M. E., Yudkoff, M., Nissim, I., Brosnan, J. T. (1999). Studies of Hepatic Glutamine Metabolism in the Perfused Rat Liver with 15N-Labeled Glutamine. J. Biol. Chem. 274: 28958-28965 [Abstract] [Full Text]  
• Marx, S. J. (1999). CLINICAL REVIEW 109: Contrasting Paradigms for Hereditary Hyperfunction of Endocrine Cells. J. Clin. Endocrinol. Metab. 84: 3001-3009 [Full Text]  
• Levitt Katz, L. E., Ferry, R. J. Jr., Stanley, C. A., Collett-Solberg, P. F., Baker, L., Cohen, P. (1999). Suppression of Insulin Oversecretion by Subcutaneous Recombinant Human Insulin-Like Growth Factor I in Children with Congenital Hyperinsulinism Due to Defective {beta}-Cell Sulfonylurea Receptor. J. Clin. Endocrinol. Metab. 84: 3117-3124 [Abstract] [Full Text]  
• de Lonlay-Debeney, P., Poggi-Travert, F., Fournet, J.-C., Sempoux, C., Vici, C. D., Brunelle, F., Touati, G., Rahier, J., Junien, C., Nihoul-Fekete, C., Robert, J.-J., Saudubray, J.-M. (1999). Clinical Features of 52 Neonates with Hyperinsulinism. NEJM 340: 1169-1175 [Abstract] [Full Text]  
• Stanley, C. A., Baker, L. (1999). The Causes of Neonatal Hypoglycemia. NEJM 340: 1200-1201 [Full Text]