Hyperinsulinism and Hyperammonemia in Infants with Regulatory Mutations of the Glutamate Dehydrogenase Gene
Charles A. Stanley, M.D., Yen K. Lieu, B.S., Betty Y.L. Hsu, Ph.D., Alberto B. Burlina, M.D., Cheryl R. Greenberg, M.D., Nancy J. Hopwood, M.D., Kusiel Perlman, M.D., Barry H. Rich, M.D., Enrico Zammarchi, M.D., and Mortimer Poncz, M.D.
Background A new form of congenital hyperinsulinism characterizedby hypoglycemia and hyperammonemia was described recently. Wehypothesized that this syndrome of hyperinsulinism and hyperammonemiawas caused by excessive activity of glutamate dehydrogenase,which oxidizes glutamate to -ketoglutarate and which is a potentialregulator of insulin secretion in pancreatic beta cells andof ureagenesis in the liver.
Methods We measured glutamate dehydrogenase activity in lymphoblastsfrom eight unrelated children with the hyperinsulinismhyperammonemiasyndrome: six with sporadic cases and two with familial cases.We identified mutations in the glutamate dehydrogenase geneby sequencing glutamate dehydrogenase complementary DNA preparedfrom lymphoblast messenger RNA. Site-directed mutagenesis wasused to express the mutations in COS-7 cells.
Results The sensitivity of glutamate dehydrogenase to inhibitionby guanosine 5'-triphosphate was a quarter of the normal levelin the patients with sporadic hyperinsulinismhyperammonemiasyndrome and half the normal level in patients with familialcases and their affected relatives, findings consistent withoveractivity of the enzyme. These differences in enzyme insensitivitycorrelated with differences in the severity of hypoglycemiain the two groups. All eight children were heterozygous forthe wild-type allele and had a mutation in the proposed allostericdomain of the enzyme. Four different mutations were identifiedin the six patients with sporadic cases; the two patients withfamilial cases shared a fifth mutation. In two clones of COS-7cells transfected with the mutant sequence from one patient,the sensitivity of the enzyme to guanosine 5'-triphosphate wasreduced, findings similar to those in the child's lymphoblasts.
Conclusions The hyperinsulinismhyperammonemia syndromeis caused by mutations in the glutamate dehydrogenase gene thatimpair the control of enzyme activity.
Congenital hyperinsulinism is the most common cause of recurrenthypoglycemia in early infancy.1 Affected children present withseizures or coma and are at high risk for permanent brain injury.Treatment consists of diazoxide, octreotide, or subtotal pancreatectomy.Evidence suggests that the majority of cases of congenital hyperinsulinismare caused by genetic defects in the regulation of insulin secretionby pancreatic beta cells.2 In some children, recessively inheritedmutations have been demonstrated in the gene for the plasmamembrane sulfonylurea receptor (SUR1) or its associated inwardlyrectifying potassium channel (Kir6.2) of the beta cells.3,4,5,6,7Other children have been described with milder, dominantly inheritedforms of hyperinsulinism that are not linked to the sulfonylureareceptor locus8,9; a mutation in the glucokinase gene has beenidentified in one of these families.10 In addition, a thirdgroup of children has been described who have an unusual combinationof congenital hyperinsulinism and hyperammonemia.11,12 Plasmaammonium concentrations in these children are persistently threeto eight times normal. The hyperammonemia is not affected bychanges in blood glucose concentrations and is not associatedwith a defect in any urea-cycle enzyme.
We hypothesized that the hyperinsulinismhyperammonemiasyndrome was caused by a single inborn error of metabolism sharedby the pancreas and the liver. A defect in the mitochondrialenzyme glutamate dehydrogenase appeared to be likely (Figure 1).Leucine, an amino acid that stimulates the release of insulin,acts by allosterically activating glutamate dehydrogenase toincrease the rate of glutamate oxidation in the beta cells.14,16,17High concentrations of glutamate are needed for the synthesisof N-acetylglutamate, an essential activator of carbamoyl-phosphatesynthetase, the first step in the conversion of ammonium tourea.18,19 Therefore, the hyperinsulinismhyperammonemiasyndrome could be caused by excessive activity of glutamatedehydrogenase, since this would simultaneously increase therelease of insulin by pancreatic beta cells and impair the detoxificationof ammonia in the liver. We performed enzymatic and molecularstudies in eight families in an effort to prove this hypothesisof an abnormality in glutamate enzyme activity as the causeof the syndrome.
Figure 1. Glutamate Dehydrogenase (GDH) and the Regulation of Insulin Secretion and Hepatic Ureagenesis.
Increases in the rate of oxidation of fuels such as glucose or glutamate stimulate the secretion of insulin by increasing the ratio of ATP to adenosine 5'-diphosphate (ADP), which in turn causes closure of potassium channels and ultimately leads to the depolarization of beta cells, calcium influx, and the release of stored insulin granules.13 Leucine stimulates insulin secretion indirectly by allosterically activating glutamate dehydrogenase (GDH) and increasing the oxidation of glutamate by means of the tricarboxylic acid cycle.14,15,16,17 Diazoxide and tolbutamide have direct effects on the sulfonylurea receptor (SUR) and inwardly rectifying potassium channel (Kir6.2). In the liver, glutamate governs the synthesis of N -acetylglutamate, a required allosteric effector of carbamoyl-phosphate synthetase (CPS)18,19; the oxidation of glutamate by glutamate dehydrogenase also provides free ammonia derived from the -amino nitrogen of amino acids. GTP denotes guanosine 5'-triphosphate.
Methods
Study Subjects
We studied eight unrelated children, ranging in age from 3 monthsto 10 years, with the hyperinsulinismhyperammonemia syndrome.Patients 1 through 6 (five boys and one girl) had sporadic cases,because they had no affected relatives. They were from the UnitedStates, Mexico, Italy, and Canada. Two other boys (Patients7 and 8), one from Italy and one from Canada, were classifiedas having familial cases, because other family members had hyperammonemiaand hypoglycemia. These included the mother of Patient 7 andthe mother, a maternal aunt and her daughter, and the maternalgrandfather of Patient 8. The mode of inheritance in these familiesappeared to be autosomal dominant. Clinical descriptions ofPatients 1, 2, and 7 have been reported previously.11,12
All the children presented with episodes of symptomatic hypoglycemiaduring the first year of life. The patients with sporadic casesall responded to treatment with diazoxide (Figure 1); they requiredeither continuous treatment with diazoxide or subtotal pancreatectomyto prevent hypoglycemia. The patients with familial cases appearedto have milder hypoglycemia; Patient 8 was treated with diazoxide,but Patient 7 was treated with only a low-protein diet. Theaffected relatives of these two patients had not been treated.None of the affected subjects, whose plasma ammonium concentrationsranged from 112 to 280 µg per deciliter (80 to 200 µmolper liter; normal, <50 µg per deciliter [40 µmolper liter]) had symptoms of hyperammonemia, such as lethargyor coma.
The study protocol was approved by the institutional reviewboard of Children's Hospital of Philadelphia, and informed consentwas obtained from all subjects or their parents or guardians.
Enzymatic and DNA Studies
Peripheral-blood samples were obtained from the patients, 5affected and 16 unaffected family members, and 10 unrelatednormal subjects. Lymphocytes isolated from peripheral bloodwere transformed with EpsteinBarr virus to establishlymphoblast cultures. The activity of glutamate dehydrogenasein lymphoblast homogenates and the effects of added adenosine5'-diphosphate (ADP) or guanosine 5'-triphosphate (GTP) weredetermined spectrophotometrically in triplicate.20 In some cases,lymphoblast homogenates were subjected to dialysis overnightin the presence of 10 mM potassium phosphate, pH 7.1, to eliminatepossible effects of adherent allosteric regulators. Proteinwas measured according to the method of Lowry et al.21
The complementary DNA (cDNA) for glutamate dehydrogenase wasprepared from lymphoblast polyA messenger RNA and amplifiedby the polymerase chain reaction (PCR) for automated fluorescencesequencing (Applied Biosystems). The forward primers spannednucleotides 137 to 155, 363 to 380, 721 to 741, and 1241 to1261, and the reverse primers spanned nucleotides 450 to 432,902 to 883, 1380 to 1360, and 1730 to 1710.22 Exons 11 and 12of the gene for glutamate dehydrogenase (GLUD 1), together withportions of their adjacent introns,23 were also amplified byPCR from lymphoblast genomic DNA for sequence analysis and restriction-endonucleaseanalysis. For exon 11, the forward primer was TGTAGTGTCTGTTCAAGAGAGand the reverse primer was ACACACATGTCACGCACTTAC. For exon 12,the forward primer was ACAGGGACACAAAGCAGGTC and the reverseprimer was ACAGTCTGGCGGCTGAGATAG.
Site-directed mutagenesis was used to construct a pcDNA3 plasmid(Invitrogen) capable of expressing in COS-7 cells the mutationidentified in Patient 1: a change from histidine to tyrosineat position 454 of the enzyme (His454Tyr). Full-length normalhuman glutamate dehydrogenase cDNA was obtained through thecourtesy of Dr. Roberta Colman (Department of Chemistry, Universityof Delaware). The corresponding nucleotide substitution of thymidinefor cytosine at position 1532 was incorporated with two roundsof overlapping PCR with a pair of internal primers containingthe mutant base. After confirmation that the orientation andsequence were correct, the His454Tyr mutant glutamate dehydrogenasepcDNA3 was transfected into COS-7 cells with Lipofectin (BRL)and clones were selected with G418 (Geneticin, BRL). Aliquotsof G418-resistant cells were grown in a 96-well plate, and thesubclones were tested to determine whether they had increasedexpression of glutamate dehydrogenase and whether the sensitivityof the enzyme to GTP was altered. Cells transfected with thepcDNA3 vector alone were used as controls. Student's t-testwas used to compare the results of these studies in the variousgroups of subjects.
Results
Enzymatic Activity of Glutamate Dehydrogenase
The activity and allosteric responses of glutamate dehydrogenasein lymphoblasts from the patients are shown in Table 1. Theactivity of the enzyme in the patients with sporadic cases ofthe hyperinsulinemiahyperammonemia syndrome was not inhibitedby GTP, as shown by the fact that the half-maximal inhibitoryconcentration (IC50) for this effector was nearly four timesas high as in the normal subjects. Enzyme activity in the subjectswith the clinically milder familial cases was also less sensitiveto inhibition by GTP, but the IC50 was only twice the normalvalue.
Table 1. Activity and Allosteric Responsiveness of Glutamate Dehydrogenase in Lymphoblasts from Children with Sporadic or Familial HyperinsulinismHyperammonemia Syndrome, Their Affected Relatives, and Normal Subjects.
Basal and maximal ADP-stimulated glutamate dehydrogenase activitieswere similar in the patients with sporadic hyperinsulinismhyperammonemiaand the normal subjects. In the patients with familial cases,basal enzyme activity was 38 percent of normal, although maximallystimulated glutamate dehydrogenase activity was only slightlyless than normal (P = 0.07). The sensitivity to stimulationwith ADP was similar in the three groups. The pattern of differencesamong the three groups was similar after dialysis of the lymphoblasthomogenates, thus ruling out the possibility that the abnormalitieswere caused by binding of the effector molecules to the enzyme(data not shown). These results are compatible with the presenceof intrinsic abnormalities in glutamate dehydrogenase in bothgroups of patients. Lymphoblast glutamate dehydrogenase fromthe unaffected parents and siblings of both groups of patientshad normal responses to GTP. These results suggested that thedefect in glutamate dehydrogenase is dominantly expressed andthat the sporadic cases represented spontaneous mutations.
Mutation Analysis of Glutamate Dehydrogenase
Each of the eight patients with the hyperinsulinismhyperammonemiasyndrome was found to have a change in a single nucleotide thatwas predicted to alter 1 of 4 amino acids between residues 446and 454 of the 505-amino-acid mature glutamate dehydrogenase(Table 2 and Figure 2). Among the six patients with sporadiccases, four different mutations were found. The two patientswith familial cases shared a fifth mutation, although therewas no evidence that they were related. No other mutations werefound in any of the patients when the rest of the cDNA codingregion for the enzyme was sequenced.
Figure 2. Location of Mutations in the Glutamate Dehydrogenase Gene in Patients with Sporadic and Familial Cases of the HyperinsulinismHyperammonemia Syndrome.
Shown are the regions encoded by the 13 exons, the leader peptide, and the catalytic and allosteric domains of the enzyme. The mutations in both groups of patients are clustered in an area of 10 amino acid residues in the allosteric domain encoded by exons 11 and 12. Solid symbols indicate clinically more severe mutations in the sporadic cases, and the stippled symbol a clinically milder mutation in the familial cases.
Each of the five mutations eliminated a restriction-endonucleasedigestion site or created a new site, thus making it possibleto distinguish readily wild-type and mutant alleles in PCR productsfrom either the cDNA or genomic DNA for glutamate dehydrogenase.All eight patients were heterozygous, with one mutant and onewild-type allele, a pattern consistent with the dominant expressionof the mutations. None of the mutations were found on restriction-endonucleaseanalysis of genomic DNA from 55 normal subjects, suggestingthat none of the mutations represented a common silent polymorphism.Similar analyses of genomic DNA from the mothers and fathersof the six patients with sporadic cases showed that none hadtheir child's mutation, confirming that the mutation in thesechildren was spontaneous.
Restriction-enzyme analysis of the PCR products of the cDNAfor glutamate dehydrogenase or exon 12 genomic DNA in the parentsand other relatives of Patients 7 and 8 showed that all sevenaffected relatives were heterozygous for the Ser448Pro mutationand the wild-type allele and that none of the six unaffectedrelatives who were studied had the mutation.
Expression of Glutamate Dehydrogenase Mutations in COS-7 Cells
The glutamate dehydrogenase activity of two clones of COS-7cells transfected with the His454Tyr mutation (from Patient1) was 57 and 35 nmol per minute per milligram of protein, ascompared with a value of 24 nmol per minute per milligram ofprotein in cells transfected with vector alone. The enzyme inthese two clones was less sensitive to GTP-induced inhibitionthan was the endogenous glutamate dehydrogenase in the controlCOS-7 cells (estimated IC50, 200 nmol per liter) (Figure 3)or in normal human lymphoblasts. These results confirmed thatthe His454Tyr mutation resulted in decreased sensitivity toGTP-induced inhibition in a manner similar to that found inthe patient's lymphoblasts.
Figure 3. Sensitivity of Mutant Glutamate Dehydrogenase to Inhibition by Guanosine 5'-Triphosphate.
Two clones of COS-7 cells with the His454Tyr mutation (solid symbols) and control cells transfected with vector alone (open symbols) were incubated with various concentrations of guanosine 5'-triphosphate. The mean residual enzyme activity was significantly greater in cells containing the mutant glutamate dehydrogenase than in the control cells for both concentrations of guanosine 5'-triphosphate: at 300 nM guanosine 5'-triphosphate, the mean (±SE) activity of the mutant enzyme was 80±3 percent, and the mean activity of the normal enzyme was 37±7 percent (P = 0.002); at 500 nM guanosine 5'-triphosphate, the respective values were 61±10 percent and 20±5 percent (P = 0.004). Values are the means of four experiments for the mutant enzyme; for the normal enzyme, means and 95 percent confidence intervals for seven experiments are shown.
Discussion
The results of these studies indicate that the hyperinsulinismhyperammonemiasyndrome is associated with dominantly expressed mutations ofmitochondrial glutamate dehydrogenase, which is encoded by theGLUD1 gene on chromosome 10. In all affected patients who weretested, glutamate dehydrogenase had reduced sensitivity to inhibitionby GTP. This defect would be expected to result in abnormallyhigh rates of glutamate oxidation, leading to excessive insulinsecretion and impaired detoxification of ammonia by the liver(Figure 1).
The two groups of patients with hyperinsulinism and hyperammonemiahad different degrees of impaired responsiveness to GTP inhibitionthat correlated with differences in the clinical phenotype.The patients with familial cases, in whom enzyme activity wasmore sensitive to inhibition by GTP than in the patients withsporadic cases, had less severe hypoglycemia. The lower basalenzyme activity in the patients with familial cases may alsohave contributed to their less severe hypoglycemia. Whetherthis difference reflects lower intrinsic activity of the enzyme,an altered allosteric effect, or lesser amounts of enzyme proteinis not known.
The five mutations in glutamate dehydrogenase identified inthese patients were all within exons 11 and 12 of GLUD1.23 Thetertiary structure of mammalian glutamate dehydrogenase hasnot been determined, but sequence comparisons with the nonallostericglutamate dehydrogenase of prokaryotes and photoaffinity studiesof bovine glutamate dehydrogenase suggest that the GTP allostericdomain of the mammalian enzyme is near the region encoded bythese exons.24,25,26 This suggestion is consistent with ourobservation that the mutations in the patients with sporadiccases impaired enzyme sensitivity to GTP-induced inhibitionbut did not affect basal or ADP-stimulated enzyme activity.All the mutations identified lie within a sequence of 15 aminoacids that has been suggested to contain the GTP binding site.26Whether the mutations alter responses to other allosteric effectorsof glutamate dehydrogenase, such as leucine or palmitoylcoenzymeA,27,28 is not known.
Since mature glutamate dehydrogenase is a hexamer of six identicalsubunits, the enzyme in patients with the hyperinsulinismhyperammonemiasyndrome is likely to be composed of a mixture of heterohexamerscontaining, on average, equal numbers of mutant and wild-typesubunits. Proteinprotein interactions between these subunitsmay be an important factor in the dominant effects of the mutations.The glutamate dehydrogenase with the His454Tyr mutation hadimpaired sensitivity to GTP when transfected into COS-7 cells,a finding similar to those in lymphoblasts from the heterozygouspatients.
The existence of the hyperinsulinismhyperammonemia syndromehighlights the importance of glutamate dehydrogenase in theregulation of insulin secretion15,16,29 and indicates that theenzyme has an important role in regulating hepatic ureagenesis.18Partial deficiency of glutamate dehydrogenase has been reportedin some patients with cerebellar degeneration,30 suggestingthat the enzyme is important in brain function. Further studiesof glutamate dehydrogenase in beta cells, liver, and brain mayprovide explanations for three features in patients with thehyperinsulinismhyperammonemia syndrome that remain apuzzle: sensitivity to leucine or protein-induced hypoglycemia,the ability to ingest protein loads without worsening hyperammonemia,and the apparent absence of central nervous system symptomsdue to hyperammonemia.11,12
In conclusion, the hyperinsulinismhyperammonemia syndromeis a distinctive genetic disorder of insulin secretion causedby mutations in the gene for glutamate dehydrogenase. The disordershould be considered as part of the differential diagnosis inchildren with hyperinsulinism who respond to diazoxide; it canbe recognized by the finding of a high plasma ammonium concentrationin association with insulin-induced hypoglycemia.
Supported in part by grants from the National Institutes ofHealth (RR-00240) and the American Diabetes Association.
We are indebted to Drs. Lester Baker, Paul Thornton, Franz Matschinsky,Catherine Stolle, Gerard T. Berry, and Marc Yudkoff for helpfuldiscussions; to Dr. Roberta Colman for her advice; to Drs. HeatherDean and John Christodoulo and Louise A. Dilling for helpingto acquire samples; to Dr. Ramesh Basani for many contributionsto this work; and to Linda Liszewski and Lev Grunstein for assistingwith the mutation analysis.
Source Information
From the Divisions of Endocrinology (C.A.S., Y.K.L., B.Y.L.H.) and Hematology (M.P.), Children's Hospital of Philadelphia, University of Pennsylvania School of Medicine, Philadelphia; the Department of Pediatrics, University of Padua, Padua, Italy (A.B.B.); the Section of Genetics and Metabolism, Department of Pediatrics and Child Health, University of Manitoba, Winnipeg, Canada (C.R.G.); the Endocrinology Division, C.S. Mott Children's Hospital, University of Michigan School of Medicine, Ann Arbor (N.J.H.); the Division of Endocrinology, Hospital for Sick Children, University of Toronto School of Medicine, Toronto (K.P.); the Section of Endocrinology, Chicago Children's Hospital, University of Chicago Pritzker School of Medicine, Chicago (B.H.R.); and the Department of Pediatrics, University of Florence, Florence, Italy (E.Z.).
Address reprint requests to Dr. Stanley at the Division of Endocrinology, Children's Hospital of Philadelphia, 34th St. and Civic Center Blvd., Philadelphia, PA 19104.
References
Stanley CA. Hyperinsulinism in infants and children. Pediatr Clin North Am 1997;44:363-374. [CrossRef][Medline]
Thornton PS, Sumner AE, Ruchelli ED, Spielman RS, Baker L, Stanley CA. Familial and sporadic hyperinsulinism: histopathologic findings and segregation analysis support a single autosomal recessive disorder. J Pediatr 1991;119:721-724. [CrossRef][Medline]
Nestorowicz A, Wilson BA, Schoor KP, et al. Mutations in the sulfonylurea receptor gene are associated with familial hyperinsulinism in Ashkenazi Jews. Hum Mol Genet 1996;5:1813-1822. [Free Full Text]
Thomas PM, Cote GJ, Wohllk N, et al. Mutations in the sulfonylurea receptor gene in familial persistent hyperinsulinemic hypoglycemia of infancy. Science 1995;268:426-429. [Free Full Text]
Permutt MA, Nestorowicz A, Glaser B. Familial hyperinsulinism: an inherited disorder of spontaneous hypoglycemia in neonates and infants. Diabetes Rev 1996;4:347-55.
Dunne MJ, Kane C, Shepherd RM, et al. Familial persistent hyperinsulinemic hypoglycemia of infancy and mutations in the sulfonylurea receptor. N Engl J Med 1997;336:703-706. [Free Full Text]
Thomas P, Ye YY, Lightner E. Mutation of the pancreatic islet inward rectifier Kir6.2 also leads to familial persistent hyperinsulinemic hypoglycemia of infancy. Hum Mol Genet 1996;5:1809-1812. [Free Full Text]
Thornton PS, Satin-Smith M, Herold K, et al. Familial hyperinsulinism with apparent autosomal dominant inheritance: clinical and genetic differences from the autosomal recessive variant. J Pediatr 1998;132:9-14. [CrossRef][Medline]
Kukuvitis A, Deal C, Arbour L, Polychronakos C. An autosomal dominant form of familial persistent hyperinsulinemic hypoglycemia of infancy, not linked to the sulfonylurea receptor locus. J Clin Endocrinol Metab 1997;82:1192-1194. [Free Full Text]
Glaser B, Kesavan P, Heyman M, et al. Familial hyperinsulinism caused by an activating glucokinase mutation. N Engl J Med 1998;338:226-230. [Free Full Text]
Weinzimer SA, Stanley CA, Berry GT, Yudkoff M, Tuchman M, Thornton PS. A syndrome of congenital hyperinsulinism and hyperammonemia. J Pediatr 1997;130:661-664. [CrossRef][Medline]
Zammarchi E, Filippi L, Novembre E, Donati MA. Biochemical evaluation of a patient with a familial form of leucine-sensitive hypoglycemia and concomitant hyperammonemia. Metabolism 1996;45:957-960. [CrossRef][Medline]
Matschinsky FM, Sweet IR. Annotated questions and answers about glucose metabolism and insulin secretion of -cells. Diabetes Rev 1996;4:130-44.
Gylfe E. Comparison of the effects of leucines, non-metabolizable leucine analogues and other insulin secretagogues on the activity of glutamate dehydrogenase. Acta Diabetol Lat 1976;13:20-24. [Medline]
Sener A, Malaisse-Lagae F, Malaisse WJ. Stimulation of pancreatic islet metabolism and insulin release by a nonmetabolizable amino acid. Proc Natl Acad Sci U S A 1981;78:5460-5464. [Free Full Text]
Fahien LA, MacDonald MJ, Kmiotek EH, Mertz RJ, Fahien CM. Regulation of insulin release by factors that also modify glutamate dehydrogenase. J Biol Chem 1988;263:13610-13614. [Free Full Text]
Sener A, Malaisse WJ. L-leucine and a nonmetabolized analogue activate pancreatic islet glutamate dehydrogenase. Nature 1980;288:187-189. [CrossRef][Medline]
Brusilow SW, Horwich AL. Urea cycle enzymes. In: Scriver CR, Beaudet AL, Sly WS, Valle D, eds. The metabolic and molecular bases of inherited disease. 7th ed. Vol. 1. New York: McGraw-Hill, 1995:1187-232.
Stewart PM, Walser M. Short term regulation of ureagenesis. J Biol Chem 1980;255:5270-5280. [Free Full Text]
Wrzeszczynski KO, Colman RF. Activation of bovine liver glutamate dehydrogenase by covalent reaction of adenosine 5'-O-[S-(4-bromo-2,3-dioxobutyl)thiophosphate] with arginine-459 at an ADP regulatory site. Biochemistry 1994;33:11544-11553. [CrossRef][Medline]
Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein measurement with the Folin phenol reagent. J Biol Chem 1951;193:265-275. [Free Full Text]
Nakatani Y, Schneider M, Banner C, Freese E. Complete nucleotide sequence of human glutamate dehydrogenase cDNA. Nucleic Acids Res 1988;16:6237-6237. [Free Full Text]
Michaelidis TM, Tzimagiorgis G, Moschonas NK, Papamatheakis J. The human glutamate dehydrogenase gene family: gene organization and structural characterization. Genomics 1993;16:150-160. [CrossRef][Medline]
Brunhuber NMW, Blanchard JS. The biochemistry and enzymology of amino acid dehydrogenases. Crit Rev Biochem Mol Biol 1994;29:415-467. [Medline]
Teller JK, Baker PJ, Britton KL, Engel PC, Rice DW, Stillman TJ. Correlation of intron-exon organisation with the three-dimensional structure in glutamate dehydrogenase. Biochim Biophys Acta 1995;1247:231-238. [CrossRef][Medline]
Cho SW, Ahn JY, Lee J, Choi SY. Identification of a peptide of the guanosine triphosphate binding site within brain glutamate dehydrogenase isoproteins using 8-azidoguanosine triphosphate. Biochemistry 1996;35:13907-13913. [CrossRef][Medline]
Colman RF. Glutamate dehydrogenase (bovine liver). In: Kuby SA, ed. A study of enzymes. Vol. 2. Mechanism of enzyme action. Boca Raton, Fla.: CRC Press, 1991:173-92.
Fahien LA, Kmiotek E. Regulation of glutamate dehydrogenase by palmitoyl-coenzyme A. Arch Biochem Biophys 1981;212:247-253. [CrossRef][Medline]
Bryla J, Michalik M, Nelson J, Erecinska M. Regulation of the glutamate dehydrogenase activity in rat islets of Langerhans and its consequence on insulin release. Metabolism 1994;43:1187-1195. [CrossRef][Medline]
Plaitakis A, Flessas P, Natsiou AB, Shashidharan P. Glutamate dehydrogenase deficiency in cerebellar degenerations: clinical, biochemical and molecular genetic aspects. Can J Neurol Sci 1993;20:Suppl 3:S109-S116.
Carobbio, S., Frigerio, F., Rubi, B., Vetterli, L., Bloksgaard, M., Gjinovci, A., Pournourmohammadi, S., Herrera, P. L., Reith, W., Mandrup, S., Maechler, P.
(2009). Deletion of Glutamate Dehydrogenase in ss-Cells Abolishes Part of the Insulin Secretory Response Not Required for Glucose Homeostasis. J. Biol. Chem.
284: 921-929
[Abstract][Full Text]
Jensen, M. V., Joseph, J. W., Ronnebaum, S. M., Burgess, S. C., Sherry, A. D., Newgard, C. B.
(2008). Metabolic cycling in control of glucose-stimulated insulin secretion. Am. J. Physiol. Endocrinol. Metab.
295: E1287-E1297
[Abstract][Full Text]
Klootwijk, R. D., Savelkoul, P. J. M., Ciccone, C., Manoli, I., Caplen, N. J., Krasnewich, D. M., Gahl, W. A., Huizing, M.
(2008). Allele-specific silencing of the dominant disease allele in sialuria by RNA interference. FASEB J.
22: 3846-3852
[Abstract][Full Text]
Christesen, H. B T, Tribble, N. D, Molven, A., Siddiqui, J., Sandal, T., Brusgaard, K., Ellard, S., Njolstad, P. R, Alm, J., Brock Jacobsen, B., Hussain, K., Gloyn, A. L
(2008). Activating glucokinase (GCK) mutations as a cause of medically responsive congenital hyperinsulinism: prevalence in children and characterisation of a novel GCK mutation.. Eur J Endocrinol
159: 27-34
[Abstract][Full Text]
Palladino, A. A., Bennett, M. J., Stanley, C. A.
(2008). Hyperinsulinism in Infancy and Childhood: When an Insulin Level Is Not Always Enough. Clin. Chem.
54: 256-263
[Abstract][Full Text]
Martens, G. A., Vervoort, A., Van de Casteele, M., Stange, G., Hellemans, K., Van Thi, H. V., Schuit, F., Pipeleers, D.
(2007). Specificity in Beta Cell Expression of L-3-Hydroxyacyl-CoA Dehydrogenase, Short Chain, and Potential Role in Down-regulating Insulin Release. J. Biol. Chem.
282: 21134-21144
[Abstract][Full Text]
Choi, M.-M., Kim, E.-A, Yang, S.-J., Choi, S. Y., Cho, S.-W., Huh, J.-W.
(2007). Amino Acid Changes within Antenna Helix Are Responsible for Different Regulatory Preferences of Human Glutamate Dehydrogenase Isozymes. J. Biol. Chem.
282: 19510-19517
[Abstract][Full Text]
Newsholme, P., Brennan, L., Bender, K.
(2006). Amino Acid Metabolism, {beta}-Cell Function, and Diabetes. Diabetes
55: S39-S47
[Abstract][Full Text]
Haigis, M. C., Guarente, L. P.
(2006). Mammalian sirtuins--emerging roles in physiology, aging, and calorie restriction.. Genes Dev.
20: 2913-2921
[Abstract][Full Text]
Giurgea, I., Sempoux, C., Bellanne-Chantelot, C., Ribeiro, M., Hubert, L., Boddaert, N., Saudubray, J.-M., Robert, J.-J., Brunelle, F., Rahier, J., Jaubert, F., Nihoul-Fekete, C., de Lonlay, P.
(2006). The Knudson's Two-Hit Model and Timing of Somatic Mutation May Account for the Phenotypic Diversity of Focal Congenital Hyperinsulinism. J. Clin. Endocrinol. Metab.
91: 4118-4123
[Abstract][Full Text]
Corless, M., Kiely, A., McClenaghan, N. H, Flatt, P. R, Newsholme, P.
(2006). Glutamine regulates expression of key transcription factor, signal transduction, metabolic gene, and protein expression in a clonal pancreatic {beta}-cell line.. J Endocrinol
190: 719-727
[Abstract][Full Text]
Li, C., Matter, A., Kelly, A., Petty, T. J., Najafi, H., MacMullen, C., Daikhin, Y., Nissim, I., Lazarow, A., Kwagh, J., Collins, H. W., Hsu, B. Y. L., Nissim, I., Yudkoff, M., Matschinsky, F. M., Stanley, C. A.
(2006). Effects of a GTP-insensitive Mutation of Glutamate Dehydrogenase on Insulin Secretion in Transgenic Mice. J. Biol. Chem.
281: 15064-15072
[Abstract][Full Text]
Li, C., Allen, A., Kwagh, J., Doliba, N. M., Qin, W., Najafi, H., Collins, H. W., Matschinsky, F. M., Stanley, C. A., Smith, T. J.
(2006). Green Tea Polyphenols Modulate Insulin Secretion by Inhibiting Glutamate Dehydrogenase. J. Biol. Chem.
281: 10214-10221
[Abstract][Full Text]
Giurgea, I, Sanlaville, D, Fournet, J-C, Sempoux, C, Bellanne-Chantelot, C, Touati, G, Hubert, L, Groos, M-S, Brunelle, F, Rahier, J, Henquin, J-C, Dunne, M J, Jaubert, F, Robert, J-J, Nihoul-Fekete, C, Vekemans, M, Junien, C, de Lonlay, P
(2006). Congenital hyperinsulinism and mosaic abnormalities of the ploidy. J. Med. Genet.
43: 248-254
[Abstract][Full Text]
Hussain, K., Bryan, J., Christesen, H. T., Brusgaard, K., Aguilar-Bryan, L.
(2005). Serum Glucagon Counterregulatory Hormonal Response to Hypoglycemia Is Blunted in Congenital Hyperinsulinism. Diabetes
54: 2946-2951
[Abstract][Full Text]
Rabaglia, M. E., Gray-Keller, M. P., Frey, B. L., Shortreed, M. R., Smith, L. M., Attie, A. D.
(2005). {alpha}-Ketoisocaproate-induced hypersecretion of insulin by islets from diabetes-susceptible mice. Am. J. Physiol. Endocrinol. Metab.
289: E218-E224
[Abstract][Full Text]
Hussain, K., Cosgrove, K. E., Shepherd, R. M., Luharia, A., Smith, V. V., Kassem, S., Gregory, J. W., Sivaprasadarao, A., Christesen, H. T., Jacobsen, B. B., Brusgaard, K., Glaser, B., Maher, E. A., Lindley, K. J., Hindmarsh, P., Dattani, M., Dunne, M. J.
(2005). Hyperinsulinemic Hypoglycemia in Beckwith-Wiedemann Syndrome due to Defects in the Function of Pancreatic {beta}-Cell Adenosine Triphosphate-Sensitive Potassium Channels. J. Clin. Endocrinol. Metab.
90: 4376-4382
[Abstract][Full Text]
Giurgea, I., Ulinski, T., Touati, G., Sempoux, C., Mochel, F., Brunelle, F., Saudubray, J.-M., Fekete, C., de Lonlay, P.
(2005). Factitious Hyperinsulinism Leading to Pancreatectomy: Severe Forms of Munchausen Syndrome by Proxy. Pediatrics
116: e145-e148
[Abstract][Full Text]
Ribeiro, M.-J., De Lonlay, P., Delzescaux, T., Boddaert, N., Jaubert, F., Bourgeois, S., Dolle, F., Nihoul-Fekete, C., Syrota, A., Brunelle, F.
(2005). Characterization of Hyperinsulinism in Infancy Assessed with PET and 18F-Fluoro-L-DOPA. JNM
46: 560-566
[Abstract][Full Text]
MacDonald, M. J., Fahien, L. A., Brown, L. J., Hasan, N. M., Buss, J. D., Kendrick, M. A.
(2005). Perspective: emerging evidence for signaling roles of mitochondrial anaplerotic products in insulin secretion. Am. J. Physiol. Endocrinol. Metab.
288: E1-E15
[Abstract][Full Text]
Tornovsky, S., Crane, A., Cosgrove, K. E., Hussain, K., Lavie, J., Heyman, M., Nesher, Y., Kuchinski, N., Ben-Shushan, E., Shatz, O., Nahari, E., Potikha, T., Zangen, D., Tenenbaum-Rakover, Y., de Vries, L., Argente, J., Gracia, R., Landau, H., Eliakim, A., Lindley, K., Dunne, M. J., Aguilar-Bryan, L., Glaser, B.
(2004). Hyperinsulinism of Infancy: Novel ABCC8 and KCNJ11 Mutations and Evidence for Additional Locus Heterogeneity. J. Clin. Endocrinol. Metab.
89: 6224-6234
[Abstract][Full Text]
Cline, G. W., LePine, R. L., Papas, K. K., Kibbey, R. G., Shulman, G. I.
(2004). 13C NMR Isotopomer Analysis of Anaplerotic Pathways in INS-1 Cells. J. Biol. Chem.
279: 44370-44375
[Abstract][Full Text]
Magge, S. N., Shyng, S.-L., MacMullen, C., Steinkrauss, L., Ganguly, A., Katz, L. E. L., Stanley, C. A.
(2004). Familial Leucine-Sensitive Hypoglycemia of Infancy Due to a Dominant Mutation of the {beta}-Cell Sulfonylurea Receptor. J. Clin. Endocrinol. Metab.
89: 4450-4456
[Abstract][Full Text]
Cuesta-Munoz, A. L., Huopio, H., Otonkoski, T., Gomez-Zumaquero, J. M., Nanto-Salonen, K., Rahier, J., Lopez-Enriquez, S., Garcia-Gimeno, M. A., Sanz, P., Soriguer, F. C., Laakso, M.
(2004). Severe Persistent Hyperinsulinemic Hypoglycemia due to a De Novo Glucokinase Mutation. Diabetes
53: 2164-2168
[Abstract][Full Text]
Hojlund, K., Hansen, T., Lajer, M., Henriksen, J. E., Levin, K., Lindholm, J., Pedersen, O., Beck-Nielsen, H.
(2004). A Novel Syndrome of Autosomal-Dominant Hyperinsulinemic Hypoglycemia Linked to a Mutation in the Human Insulin Receptor Gene. Diabetes
53: 1592-1598
[Abstract][Full Text]
Li, C., Buettger, C., Kwagh, J., Matter, A., Daikhin, Y., Nissim, I. B., Collins, H. W., Yudkoff, M., Stanley, C. A., Matschinsky, F. M.
(2004). A Signaling Role of Glutamine in Insulin Secretion. J. Biol. Chem.
279: 13393-13401
[Abstract][Full Text]
Giurgea, I., Laborde, K., Touati, G., Bellanne-Chantelot, C., Nassogne, M.-C., Sempoux, C., Jaubert, F., Khoa, N., Chigot, V., Rahier, J., Brunelle, F., Nihoul-Fekete, C., Dunne, M. J., Stanley, C., Saudubray, J.-M., Robert, J.-J., de Lonlay, P.
(2004). Acute Insulin Responses to Calcium and Tolbutamide Do Not Differentiate Focal from Diffuse Congenital Hyperinsulinism. J. Clin. Endocrinol. Metab.
89: 925-929
[Abstract][Full Text]
Anno, T., Uehara, S., Katagiri, H., Ohta, Y., Ueda, K., Mizuguchi, H., Moriyama, Y., Oka, Y., Tanizawa, Y.
(2004). Overexpression of constitutively activated glutamate dehydrogenase induces insulin secretion through enhanced glutamate oxidation. Am. J. Physiol. Endocrinol. Metab.
286: E280-E285
[Abstract][Full Text]
Stanley, C. A., Thornton, P. S., Ganguly, A., MacMullen, C., Underwood, P., Bhatia, P., Steinkrauss, L., Wanner, L., Kaye, R., Ruchelli, E., Suchi, M., Adzick, N. S.
(2004). Preoperative Evaluation of Infants with Focal or Diffuse Congenital Hyperinsulinism by Intravenous Acute Insulin Response Tests and Selective Pancreatic Arterial Calcium Stimulation. J. Clin. Endocrinol. Metab.
89: 288-296
[Abstract][Full Text]
DUNNE, M. J., COSGROVE, K. E., SHEPHERD, R. M., AYNSLEY-GREEN, A., LINDLEY, K. J.
(2004). Hyperinsulinism in Infancy: From Basic Science to Clinical Disease. Physiol. Rev.
84: 239-275
[Abstract][Full Text]
Molven, A., Matre, G. E., Duran, M., Wanders, R. J., Rishaug, U., Njolstad, P. R., Jellum, E., Sovik, O.
(2004). Familial Hyperinsulinemic Hypoglycemia Caused by a Defect in the SCHAD Enzyme of Mitochondrial Fatty Acid Oxidation. Diabetes
53: 221-227
[Abstract][Full Text]
Hussain, K, Aynsley-Green, A
(2004). Hyperinsulinaemic hypoglycaemia in preterm neonates. Arch. Dis. Child. Fetal Neonatal Ed.
89: F65-F67
[Abstract][Full Text]
Thornton, P. S., MacMullen, C., Ganguly, A., Ruchelli, E., Steinkrauss, L., Crane, A., Aguilar-Bryan, L., Stanley, C. A.
(2003). Clinical and Molecular Characterization of a Dominant Form of Congenital Hyperinsulinism Caused by a Mutation in the High-Affinity Sulfonylurea Receptor. Diabetes
52: 2403-2410
[Abstract][Full Text]
Eto, K., Yamashita, T., Hirose, K., Tsubamoto, Y., Ainscow, E. K., Rutter, G. A., Kimura, S., Noda, M., Iino, M., Kadowaki, T.
(2003). Glucose metabolism and glutamate analog acutely alkalinize pH of insulin secretory vesicles of pancreatic {beta}-cells. Am. J. Physiol. Endocrinol. Metab.
285: E262-E271
[Abstract][Full Text]
Gao, Z., Young, R. A., Li, G., Najafi, H., Buettger, C., Sukumvanich, S. S., Wong, R. K., Wolf, B. A., Matschinsky, F. M.
(2003). Distinguishing Features of Leucine and {alpha}-Ketoisocaproate Sensing in Pancreatic {beta}-Cells. Endocrinology
144: 1949-1957
[Abstract][Full Text]
Li, C., Najafi, H., Daikhin, Y., Nissim, I. B., Collins, H. W., Yudkoff, M., Matschinsky, F. M., Stanley, C. A.
(2003). Regulation of Leucine-stimulated Insulin Secretion and Glutamine Metabolism in Isolated Rat Islets. J. Biol. Chem.
278: 2853-2858
[Abstract][Full Text]
Otonkoski, T., Kaminen, N., Ustinov, J., Lapatto, R., Meissner, T., Mayatepek, E., Kere, J., Sipila, I.
(2003). Physical Exercise-Induced Hyperinsulinemic Hypoglycemia Is an Autosomal-Dominant Trait Characterized by Abnormal Pyruvate-Induced Insulin Release. Diabetes
52: 199-204
[Abstract][Full Text]
Nissim, I., Horyn, O., Daikhin, Y., Nissim, I., Lazarow, A., Yudkoff, M.
(2002). Regulation of urea synthesis by agmatine in the perfused liver: studies with 15N. Am. J. Physiol. Endocrinol. Metab.
283: E1123-E1134
[Abstract][Full Text]
Kelly, A., Li, C., Gao, Z., Stanley, C. A., Matschinsky, F. M.
(2002). Glutaminolysis and Insulin Secretion: From Bedside to Bench and Back. Diabetes
51: S421-426
[Abstract][Full Text]
Zaganas, I., Spanaki, C., Karpusas, M., Plaitakis, A.
(2002). Substitution of Ser for Arg-443 in the Regulatory Domain of Human Housekeeping (GLUD1) Glutamate Dehydrogenase Virtually Abolishes Basal Activity and Markedly Alters the Activation of the Enzyme by ADP and L-Leucine. J. Biol. Chem.
277: 46552-46558
[Abstract][Full Text]
Stanley, C. A.
(2002). Advances in Diagnosis and Treatment of Hyperinsulinism in Infants and Children. J. Clin. Endocrinol. Metab.
87: 4857-4859
[Full Text]
Cosgrove, K. E., Antoine, M.-H., Lee, A. T., Barnes, P. D., de Tullio, P., Clayton, P., McCloy, R., De Lonlay, P., Nihoul-Fekete, C., Robert, J.-J., Saudubray, J.-M., Rahier, J., Lindley, K. J., Hussain, K., Aynsley-Green, A., Pirotte, B., Lebrun, P., Dunne, M. J.
(2002). BPDZ 154 Activates Adenosine 5'-Triphosphate-Sensitive Potassium Channels: In Vitro Studies Using Rodent Insulin-Secreting Cells and Islets Isolated from Patients with Hyperinsulinism. J. Clin. Endocrinol. Metab.
87: 4860-4868
[Abstract][Full Text]
Huopio, H., Shyng, S.-L., Otonkoski, T., Nichols, C. G.
(2002). KATP channels and insulin secretion disorders. Am. J. Physiol. Endocrinol. Metab.
283: E207-E216
[Abstract][Full Text]
Zaganas, I., Plaitakis, A.
(2002). Single Amino Acid Substitution (G456A) in the Vicinity of the GTP Binding Domain of Human Housekeeping Glutamate Dehydrogenase Markedly Attenuates GTP Inhibition and Abolishes the Cooperative Behavior of the Enzyme. J. Biol. Chem.
277: 26422-26428
[Abstract][Full Text]
Dekel, B., Lubin, D., Modan-Moses, D., Quint, J., Glaser, B., Meyerovitch, J.
(2002). Compound Heterozygosity for the Common Sulfonylurea Receptor Mutations Can Cause Mild Diazoxide-Sensitive Hyperinsulinism. CLIN PEDIATR
41: 183-186
[Abstract]
Christesen, H. B.T., Jacobsen, B. B., Odili, S., Buettger, C., Cuesta-Munoz, A., Hansen, T., Brusgaard, K., Massa, O., Magnuson, M. A., Shiota, C., Matschinsky, F. M., Barbetti, F.
(2002). The Second Activating Glucokinase Mutation (A456V): Implications for Glucose Homeostasis and Diabetes Therapy. Diabetes
51: 1240-1246
[Abstract][Full Text]
Tanizawa, Y., Nakai, K., Sasaki, T., Anno, T., Ohta, Y., Inoue, H., Matsuo, K., Koga, M., Furukawa, S., Oka, Y.
(2002). Unregulated Elevation of Glutamate Dehydrogenase Activity Induces Glutamine-Stimulated Insulin Secretion: Identification and Characterization of a GLUD1 Gene Mutation and Insulin Secretion Studies With MIN6 Cells Overexpressing the Mutant Glutamate Dehydrogenase . Diabetes
51: 712-717
[Abstract][Full Text]
Sadeghi-Nejad, A., Graeme-Cook, F. M.
(2001). Case 39-2001- A Newborn Girl with Seizures and Persistent Hypoglycemia. NEJM
345: 1833-1839
[Full Text]
Young, V. R., Ajami, A. M.
(2001). Glutamine: The Emperor or His Clothes?. J. Nutr.
131: 2449S-2459
[Abstract][Full Text]
Kelly, A., Ng, D., Ferry, R. J. Jr., Grimberg, A., Koo-McCoy, S., Thornton, P. S., Stanley, C. A.
(2001). Acute Insulin Responses to Leucine in Children with the Hyperinsulinism/Hyperammonemia Syndrome. J. Clin. Endocrinol. Metab.
86: 3724-3728
[Abstract][Full Text]
MacMullen, C., Fang, J., Hsu, B. Y. L., Kelly, A., de Lonlay-Debeney, P., Saudubray, J.-M., Ganguly, A., Smith, T. J., Stanley, C. A.
(2001). Hyperinsulinism/Hyperammonemia Syndrome in Children with Regulatory Mutations in the Inhibitory Guanosine Triphosphate-Binding Domain of Glutamate Dehydrogenase. J. Clin. Endocrinol. Metab.
86: 1782-1787
[Abstract][Full Text]
Ronner, P., Naumann, C. M., Friel, E.
(2001). Effects of Glucose and Amino Acids on Free ADP in {beta}HC9 Insulin-Secreting Cells. Diabetes
50: 291-300
[Abstract][Full Text]
Grimberg, A., Ferry, R.J. Jr., Kelly, A., Koo-McCoy, S., Polonsky, K., Glaser, B., Permutt, M.A., Aguilar-Bryan, L., Stafford, D., Thornton, P.S., Baker, L., Stanley, C. A.
(2001). Dysregulation of Insulin Secretion in Children With Congenital Hyperinsulinism due to Sulfonylurea Receptor Mutations. Diabetes
50: 322-328
[Abstract][Full Text]
Straub, S. G., Cosgrove, K. E., Ämmälä, C., Shepherd, R. M., O'Brien, R. E., Barnes, P. D., Kuchinski, N.'a., Chapman, J. C., Schaeppi, M., Glaser, B., Lindley, K. J., Sharp, G. W.G., Aynsley-Green, A., Dunne, M. J.
(2001). Hyperinsulinism of Infancy: The Regulated Release of Insulin by KATP Channel--Independent Pathways. Diabetes
50: 329-339
[Abstract][Full Text]
Munns, C F J, Batch, J A
(2001). Hyperinsulinism and Beckwith-Wiedemann syndrome. Arch. Dis. Child. Fetal Neonatal Ed.
84: 67F-69
[Full Text]
Thomas, P. M.
(2000). Neonatal Insulin Secretion and Persistent Hyperinsulinemia of Infancy. NeoReviews
1: e210-214
[Full Text]
Huijmans, J. G. M., Duran, M., de Klerk, J. B. C., Rovers, M. J., Scholte, H. R.
(2000). Functional Hyperactivity of Hepatic Glutamate Dehydrogenase as a Cause of the Hyperinsulinism/Hyperammonemia Syndrome: Effect of Treatment. Pediatrics
106: 596-600
[Abstract][Full Text]
Adzick, N. S., Nance, M. L.
(2000). Pediatric Surgery- First of Two Parts. NEJM
342: 1651-1657
[Full Text]
Young, V. R., Ajami, A. M.
(2000). Glutamate: An Amino Acid of Particular Distinction. J. Nutr.
130: 892-892
[Abstract][Full Text]
Shepherd, R. M, Cosgrove, K. E, O'Brien, R. E, Barnes, P. D, Ämmälä, C., Dunne, M. J
(2000). Hyperinsulinism of infancy: towards an understanding of unregulated insulin release. Arch. Dis. Child. Fetal Neonatal Ed.
82: 87F-97
[Abstract][Full Text]
Aynsley-Green, A, Hussain, K, Hall, J, Saudubray, J M, Nihoul-Fékété, C, De Lonlay-Debeney, P, Brunelle, F, Otonkoski, T, Thornton, P, Lindley, K J
(2000). Practical management of hyperinsulinism in infancy. Arch. Dis. Child. Fetal Neonatal Ed.
82: 98F-107
[Abstract][Full Text]
Rahier, J, Guiot, Y, Sempoux, C
(2000). Persistent hyperinsulinaemic hypoglycaemia of infancy: a heterogeneous syndrome unrelated to nesidioblastosis. Arch. Dis. Child. Fetal Neonatal Ed.
82: 108F-112
[Full Text]
MacFarlane, W. M., Chapman, J. C., Shepherd, R. M., Hashmi, M. N., Kamimura, N., Cosgrove, K. E., O'Brien, R. E., Barnes, P. D., Hart, A. W., Docherty, H. M., Lindley, K. J., Aynsley-Green, A., James, R. F. L., Docherty, K., Dunne, M. J.
(1999). Engineering a Glucose-responsive Human Insulin-secreting Cell Line from Islets of Langerhans Isolated from a Patient with Persistent Hyperinsulinemic Hypoglycemia of Infancy. J. Biol. Chem.
274: 34059-34066
[Abstract][Full Text]
ABRAHAM, M. R., JAHANGIR, A., ALEKSEEV, A. E., TERZIC, A.
(1999). Channelopathies of inwardly rectifying potassium channels. FASEB J.
13: 1901-1910
[Abstract][Full Text]
Nissim, I., Brosnan, M. E., Yudkoff, M., Nissim, I., Brosnan, J. T.
(1999). Studies of Hepatic Glutamine Metabolism in the Perfused Rat Liver with 15N-Labeled Glutamine. J. Biol. Chem.
274: 28958-28965
[Abstract][Full Text]
Marx, S. J.
(1999). CLINICAL REVIEW 109: Contrasting Paradigms for Hereditary Hyperfunction of Endocrine Cells. J. Clin. Endocrinol. Metab.
84: 3001-3009
[Full Text]
Levitt Katz, L. E., Ferry, R. J. Jr., Stanley, C. A., Collett-Solberg, P. F., Baker, L., Cohen, P.
(1999). Suppression of Insulin Oversecretion by Subcutaneous Recombinant Human Insulin-Like Growth Factor I in Children with Congenital Hyperinsulinism Due to Defective {beta}-Cell Sulfonylurea Receptor. J. Clin. Endocrinol. Metab.
84: 3117-3124
[Abstract][Full Text]
de Lonlay-Debeney, P., Poggi-Travert, F., Fournet, J.-C., Sempoux, C., Vici, C. D., Brunelle, F., Touati, G., Rahier, J., Junien, C., Nihoul-Fekete, C., Robert, J.-J., Saudubray, J.-M.
(1999). Clinical Features of 52 Neonates with Hyperinsulinism. NEJM
340: 1169-1175
[Abstract][Full Text]
Stanley, C. A., Baker, L.
(1999). The Causes of Neonatal Hypoglycemia. NEJM
340: 1200-1201
[Full Text]