The New England Journal of Medicine
e-mail icon  FREE NEJM E-TOC    HOME   |   SUBSCRIBE   |   CURRENT ISSUE   |   PAST ISSUES   |   COLLECTIONS   |    Advanced Search
Sign in | Get NEJM's E-Mail Table of Contents — Free | Subscribe
 
Original Article
PreviousPrevious
Volume 338:1352-1357 May 7, 1998 Number 19
NextNext

Hyperinsulinism and Hyperammonemia in Infants with Regulatory Mutations of the Glutamate Dehydrogenase Gene
Charles A. Stanley, M.D., Yen K. Lieu, B.S., Betty Y.L. Hsu, Ph.D., Alberto B. Burlina, M.D., Cheryl R. Greenberg, M.D., Nancy J. Hopwood, M.D., Kusiel Perlman, M.D., Barry H. Rich, M.D., Enrico Zammarchi, M.D., and Mortimer Poncz, M.D.

 

This Article
-Abstract
- PDF

Tools and Services
-Add to Personal Archive
-Add to Citation Manager
-Notify a Friend
-E-mail When Cited

More Information
-PubMed Citation
ABSTRACT

Background A new form of congenital hyperinsulinism characterized by hypoglycemia and hyperammonemia was described recently. We hypothesized that this syndrome of hyperinsulinism and hyperammonemia was caused by excessive activity of glutamate dehydrogenase, which oxidizes glutamate to {alpha}-ketoglutarate and which is a potential regulator of insulin secretion in pancreatic beta cells and of ureagenesis in the liver.

Methods We measured glutamate dehydrogenase activity in lymphoblasts from eight unrelated children with the hyperinsulinism–hyperammonemia syndrome: six with sporadic cases and two with familial cases. We identified mutations in the glutamate dehydrogenase gene by sequencing glutamate dehydrogenase complementary DNA prepared from lymphoblast messenger RNA. Site-directed mutagenesis was used to express the mutations in COS-7 cells.

Results The sensitivity of glutamate dehydrogenase to inhibition by guanosine 5'-triphosphate was a quarter of the normal level in the patients with sporadic hyperinsulinism–hyperammonemia syndrome and half the normal level in patients with familial cases and their affected relatives, findings consistent with overactivity of the enzyme. These differences in enzyme insensitivity correlated with differences in the severity of hypoglycemia in the two groups. All eight children were heterozygous for the wild-type allele and had a mutation in the proposed allosteric domain of the enzyme. Four different mutations were identified in the six patients with sporadic cases; the two patients with familial cases shared a fifth mutation. In two clones of COS-7 cells transfected with the mutant sequence from one patient, the sensitivity of the enzyme to guanosine 5'-triphosphate was reduced, findings similar to those in the child's lymphoblasts.

Conclusions The hyperinsulinism–hyperammonemia syndrome is caused by mutations in the glutamate dehydrogenase gene that impair the control of enzyme activity.


Congenital hyperinsulinism is the most common cause of recurrent hypoglycemia in early infancy.1 Affected children present with seizures or coma and are at high risk for permanent brain injury. Treatment consists of diazoxide, octreotide, or subtotal pancreatectomy. Evidence suggests that the majority of cases of congenital hyperinsulinism are caused by genetic defects in the regulation of insulin secretion by pancreatic beta cells.2 In some children, recessively inherited mutations have been demonstrated in the gene for the plasma membrane sulfonylurea receptor (SUR1) or its associated inwardly rectifying potassium channel (Kir6.2) of the beta cells.3,4,5,6,7 Other children have been described with milder, dominantly inherited forms of hyperinsulinism that are not linked to the sulfonylurea receptor locus8,9; a mutation in the glucokinase gene has been identified in one of these families.10 In addition, a third group of children has been described who have an unusual combination of congenital hyperinsulinism and hyperammonemia.11,12 Plasma ammonium concentrations in these children are persistently three to eight times normal. The hyperammonemia is not affected by changes in blood glucose concentrations and is not associated with a defect in any urea-cycle enzyme.

We hypothesized that the hyperinsulinism–hyperammonemia syndrome was caused by a single inborn error of metabolism shared by the pancreas and the liver. A defect in the mitochondrial enzyme glutamate dehydrogenase appeared to be likely (Figure 1). Leucine, an amino acid that stimulates the release of insulin, acts by allosterically activating glutamate dehydrogenase to increase the rate of glutamate oxidation in the beta cells.14,16,17 High concentrations of glutamate are needed for the synthesis of N-acetylglutamate, an essential activator of carbamoyl-phosphate synthetase, the first step in the conversion of ammonium to urea.18,19 Therefore, the hyperinsulinism–hyperammonemia syndrome could be caused by excessive activity of glutamate dehydrogenase, since this would simultaneously increase the release of insulin by pancreatic beta cells and impair the detoxification of ammonia in the liver. We performed enzymatic and molecular studies in eight families in an effort to prove this hypothesis of an abnormality in glutamate enzyme activity as the cause of the syndrome.


View larger version (7K):
[in this window]
[in a new window]
 
Figure 1. Glutamate Dehydrogenase (GDH) and the Regulation of Insulin Secretion and Hepatic Ureagenesis.

Increases in the rate of oxidation of fuels such as glucose or glutamate stimulate the secretion of insulin by increasing the ratio of ATP to adenosine 5'-diphosphate (ADP), which in turn causes closure of potassium channels and ultimately leads to the depolarization of beta cells, calcium influx, and the release of stored insulin granules.13 Leucine stimulates insulin secretion indirectly by allosterically activating glutamate dehydrogenase (GDH) and increasing the oxidation of glutamate by means of the tricarboxylic acid cycle.14,15,16,17 Diazoxide and tolbutamide have direct effects on the sulfonylurea receptor (SUR) and inwardly rectifying potassium channel (Kir6.2). In the liver, glutamate governs the synthesis of N -acetylglutamate, a required allosteric effector of carbamoyl-phosphate synthetase (CPS)18,19; the oxidation of glutamate by glutamate dehydrogenase also provides free ammonia derived from the {alpha}-amino nitrogen of amino acids. GTP denotes guanosine 5'-triphosphate.

 
Methods

Study Subjects

We studied eight unrelated children, ranging in age from 3 months to 10 years, with the hyperinsulinism–hyperammonemia syndrome. Patients 1 through 6 (five boys and one girl) had sporadic cases, because they had no affected relatives. They were from the United States, Mexico, Italy, and Canada. Two other boys (Patients 7 and 8), one from Italy and one from Canada, were classified as having familial cases, because other family members had hyperammonemia and hypoglycemia. These included the mother of Patient 7 and the mother, a maternal aunt and her daughter, and the maternal grandfather of Patient 8. The mode of inheritance in these families appeared to be autosomal dominant. Clinical descriptions of Patients 1, 2, and 7 have been reported previously.11,12

All the children presented with episodes of symptomatic hypoglycemia during the first year of life. The patients with sporadic cases all responded to treatment with diazoxide (Figure 1); they required either continuous treatment with diazoxide or subtotal pancreatectomy to prevent hypoglycemia. The patients with familial cases appeared to have milder hypoglycemia; Patient 8 was treated with diazoxide, but Patient 7 was treated with only a low-protein diet. The affected relatives of these two patients had not been treated. None of the affected subjects, whose plasma ammonium concentrations ranged from 112 to 280 µg per deciliter (80 to 200 µmol per liter; normal, <50 µg per deciliter [40 µmol per liter]) had symptoms of hyperammonemia, such as lethargy or coma.

The study protocol was approved by the institutional review board of Children's Hospital of Philadelphia, and informed consent was obtained from all subjects or their parents or guardians.

Enzymatic and DNA Studies

Peripheral-blood samples were obtained from the patients, 5 affected and 16 unaffected family members, and 10 unrelated normal subjects. Lymphocytes isolated from peripheral blood were transformed with Epstein–Barr virus to establish lymphoblast cultures. The activity of glutamate dehydrogenase in lymphoblast homogenates and the effects of added adenosine 5'-diphosphate (ADP) or guanosine 5'-triphosphate (GTP) were determined spectrophotometrically in triplicate.20 In some cases, lymphoblast homogenates were subjected to dialysis overnight in the presence of 10 mM potassium phosphate, pH 7.1, to eliminate possible effects of adherent allosteric regulators. Protein was measured according to the method of Lowry et al.21

The complementary DNA (cDNA) for glutamate dehydrogenase was prepared from lymphoblast polyA messenger RNA and amplified by the polymerase chain reaction (PCR) for automated fluorescence sequencing (Applied Biosystems). The forward primers spanned nucleotides 137 to 155, 363 to 380, 721 to 741, and 1241 to 1261, and the reverse primers spanned nucleotides 450 to 432, 902 to 883, 1380 to 1360, and 1730 to 1710.22 Exons 11 and 12 of the gene for glutamate dehydrogenase (GLUD 1), together with portions of their adjacent introns,23 were also amplified by PCR from lymphoblast genomic DNA for sequence analysis and restriction-endonuclease analysis. For exon 11, the forward primer was TGTAGTGTCTGTTCAAGAGAG and the reverse primer was ACACACATGTCACGCACTTAC. For exon 12, the forward primer was ACAGGGACACAAAGCAGGTC and the reverse primer was ACAGTCTGGCGGCTGAGATAG.

Site-directed mutagenesis was used to construct a pcDNA3 plasmid (Invitrogen) capable of expressing in COS-7 cells the mutation identified in Patient 1: a change from histidine to tyrosine at position 454 of the enzyme (His454Tyr). Full-length normal human glutamate dehydrogenase cDNA was obtained through the courtesy of Dr. Roberta Colman (Department of Chemistry, University of Delaware). The corresponding nucleotide substitution of thymidine for cytosine at position 1532 was incorporated with two rounds of overlapping PCR with a pair of internal primers containing the mutant base. After confirmation that the orientation and sequence were correct, the His454Tyr mutant glutamate dehydrogenase pcDNA3 was transfected into COS-7 cells with Lipofectin (BRL) and clones were selected with G418 (Geneticin, BRL). Aliquots of G418-resistant cells were grown in a 96-well plate, and the subclones were tested to determine whether they had increased expression of glutamate dehydrogenase and whether the sensitivity of the enzyme to GTP was altered. Cells transfected with the pcDNA3 vector alone were used as controls. Student's t-test was used to compare the results of these studies in the various groups of subjects.

Results

Enzymatic Activity of Glutamate Dehydrogenase

The activity and allosteric responses of glutamate dehydrogenase in lymphoblasts from the patients are shown in Table 1. The activity of the enzyme in the patients with sporadic cases of the hyperinsulinemia–hyperammonemia syndrome was not inhibited by GTP, as shown by the fact that the half-maximal inhibitory concentration (IC50) for this effector was nearly four times as high as in the normal subjects. Enzyme activity in the subjects with the clinically milder familial cases was also less sensitive to inhibition by GTP, but the IC50 was only twice the normal value.

View this table:
[in this window]
[in a new window]
 
Table 1. Activity and Allosteric Responsiveness of Glutamate Dehydrogenase in Lymphoblasts from Children with Sporadic or Familial Hyperinsulinism–Hyperammonemia Syndrome, Their Affected Relatives, and Normal Subjects.

 
Basal and maximal ADP-stimulated glutamate dehydrogenase activities were similar in the patients with sporadic hyperinsulinism–hyperammonemia and the normal subjects. In the patients with familial cases, basal enzyme activity was 38 percent of normal, although maximally stimulated glutamate dehydrogenase activity was only slightly less than normal (P = 0.07). The sensitivity to stimulation with ADP was similar in the three groups. The pattern of differences among the three groups was similar after dialysis of the lymphoblast homogenates, thus ruling out the possibility that the abnormalities were caused by binding of the effector molecules to the enzyme (data not shown). These results are compatible with the presence of intrinsic abnormalities in glutamate dehydrogenase in both groups of patients. Lymphoblast glutamate dehydrogenase from the unaffected parents and siblings of both groups of patients had normal responses to GTP. These results suggested that the defect in glutamate dehydrogenase is dominantly expressed and that the sporadic cases represented spontaneous mutations.

Mutation Analysis of Glutamate Dehydrogenase

Each of the eight patients with the hyperinsulinism–hyperammonemia syndrome was found to have a change in a single nucleotide that was predicted to alter 1 of 4 amino acids between residues 446 and 454 of the 505-amino-acid mature glutamate dehydrogenase (Table 2 and Figure 2). Among the six patients with sporadic cases, four different mutations were found. The two patients with familial cases shared a fifth mutation, although there was no evidence that they were related. No other mutations were found in any of the patients when the rest of the cDNA coding region for the enzyme was sequenced.

View this table:
[in this window]
[in a new window]
 
Table 2. Mutations Identified in the Glutamate Dehydrogenase Gene in Eight Children with the Hyperinsulinism–Hyperammonemia Syndrome.

 

View larger version (5K):
[in this window]
[in a new window]
 
Figure 2. Location of Mutations in the Glutamate Dehydrogenase Gene in Patients with Sporadic and Familial Cases of the Hyperinsulinism–Hyperammonemia Syndrome.

Shown are the regions encoded by the 13 exons, the leader peptide, and the catalytic and allosteric domains of the enzyme. The mutations in both groups of patients are clustered in an area of 10 amino acid residues in the allosteric domain encoded by exons 11 and 12. Solid symbols indicate clinically more severe mutations in the sporadic cases, and the stippled symbol a clinically milder mutation in the familial cases.

 
Each of the five mutations eliminated a restriction-endonuclease digestion site or created a new site, thus making it possible to distinguish readily wild-type and mutant alleles in PCR products from either the cDNA or genomic DNA for glutamate dehydrogenase. All eight patients were heterozygous, with one mutant and one wild-type allele, a pattern consistent with the dominant expression of the mutations. None of the mutations were found on restriction-endonuclease analysis of genomic DNA from 55 normal subjects, suggesting that none of the mutations represented a common silent polymorphism. Similar analyses of genomic DNA from the mothers and fathers of the six patients with sporadic cases showed that none had their child's mutation, confirming that the mutation in these children was spontaneous.

Restriction-enzyme analysis of the PCR products of the cDNA for glutamate dehydrogenase or exon 12 genomic DNA in the parents and other relatives of Patients 7 and 8 showed that all seven affected relatives were heterozygous for the Ser448Pro mutation and the wild-type allele and that none of the six unaffected relatives who were studied had the mutation.

Expression of Glutamate Dehydrogenase Mutations in COS-7 Cells

The glutamate dehydrogenase activity of two clones of COS-7 cells transfected with the His454Tyr mutation (from Patient 1) was 57 and 35 nmol per minute per milligram of protein, as compared with a value of 24 nmol per minute per milligram of protein in cells transfected with vector alone. The enzyme in these two clones was less sensitive to GTP-induced inhibition than was the endogenous glutamate dehydrogenase in the control COS-7 cells (estimated IC50, 200 nmol per liter) (Figure 3) or in normal human lymphoblasts. These results confirmed that the His454Tyr mutation resulted in decreased sensitivity to GTP-induced inhibition in a manner similar to that found in the patient's lymphoblasts.


View larger version (5K):
[in this window]
[in a new window]
 
Figure 3. Sensitivity of Mutant Glutamate Dehydrogenase to Inhibition by Guanosine 5'-Triphosphate.

Two clones of COS-7 cells with the His454Tyr mutation (solid symbols) and control cells transfected with vector alone (open symbols) were incubated with various concentrations of guanosine 5'-triphosphate. The mean residual enzyme activity was significantly greater in cells containing the mutant glutamate dehydrogenase than in the control cells for both concentrations of guanosine 5'-triphosphate: at 300 nM guanosine 5'-triphosphate, the mean (±SE) activity of the mutant enzyme was 80±3 percent, and the mean activity of the normal enzyme was 37±7 percent (P = 0.002); at 500 nM guanosine 5'-triphosphate, the respective values were 61±10 percent and 20±5 percent (P = 0.004). Values are the means of four experiments for the mutant enzyme; for the normal enzyme, means and 95 percent confidence intervals for seven experiments are shown.

 
Discussion

The results of these studies indicate that the hyperinsulinism–hyperammonemia syndrome is associated with dominantly expressed mutations of mitochondrial glutamate dehydrogenase, which is encoded by the GLUD1 gene on chromosome 10. In all affected patients who were tested, glutamate dehydrogenase had reduced sensitivity to inhibition by GTP. This defect would be expected to result in abnormally high rates of glutamate oxidation, leading to excessive insulin secretion and impaired detoxification of ammonia by the liver (Figure 1).

The two groups of patients with hyperinsulinism and hyperammonemia had different degrees of impaired responsiveness to GTP inhibition that correlated with differences in the clinical phenotype. The patients with familial cases, in whom enzyme activity was more sensitive to inhibition by GTP than in the patients with sporadic cases, had less severe hypoglycemia. The lower basal enzyme activity in the patients with familial cases may also have contributed to their less severe hypoglycemia. Whether this difference reflects lower intrinsic activity of the enzyme, an altered allosteric effect, or lesser amounts of enzyme protein is not known.

The five mutations in glutamate dehydrogenase identified in these patients were all within exons 11 and 12 of GLUD1.23 The tertiary structure of mammalian glutamate dehydrogenase has not been determined, but sequence comparisons with the nonallosteric glutamate dehydrogenase of prokaryotes and photoaffinity studies of bovine glutamate dehydrogenase suggest that the GTP allosteric domain of the mammalian enzyme is near the region encoded by these exons.24,25,26 This suggestion is consistent with our observation that the mutations in the patients with sporadic cases impaired enzyme sensitivity to GTP-induced inhibition but did not affect basal or ADP-stimulated enzyme activity. All the mutations identified lie within a sequence of 15 amino acids that has been suggested to contain the GTP binding site.26 Whether the mutations alter responses to other allosteric effectors of glutamate dehydrogenase, such as leucine or palmitoyl–coenzyme A,27,28 is not known.

Since mature glutamate dehydrogenase is a hexamer of six identical subunits, the enzyme in patients with the hyperinsulinism–hyperammonemia syndrome is likely to be composed of a mixture of heterohexamers containing, on average, equal numbers of mutant and wild-type subunits. Protein–protein interactions between these subunits may be an important factor in the dominant effects of the mutations. The glutamate dehydrogenase with the His454Tyr mutation had impaired sensitivity to GTP when transfected into COS-7 cells, a finding similar to those in lymphoblasts from the heterozygous patients.

The existence of the hyperinsulinism–hyperammonemia syndrome highlights the importance of glutamate dehydrogenase in the regulation of insulin secretion15,16,29 and indicates that the enzyme has an important role in regulating hepatic ureagenesis.18 Partial deficiency of glutamate dehydrogenase has been reported in some patients with cerebellar degeneration,30 suggesting that the enzyme is important in brain function. Further studies of glutamate dehydrogenase in beta cells, liver, and brain may provide explanations for three features in patients with the hyperinsulinism–hyperammonemia syndrome that remain a puzzle: sensitivity to leucine or protein-induced hypoglycemia, the ability to ingest protein loads without worsening hyperammonemia, and the apparent absence of central nervous system symptoms due to hyperammonemia.11,12

In conclusion, the hyperinsulinism–hyperammonemia syndrome is a distinctive genetic disorder of insulin secretion caused by mutations in the gene for glutamate dehydrogenase. The disorder should be considered as part of the differential diagnosis in children with hyperinsulinism who respond to diazoxide; it can be recognized by the finding of a high plasma ammonium concentration in association with insulin-induced hypoglycemia.

Supported in part by grants from the National Institutes of Health (RR-00240) and the American Diabetes Association.

We are indebted to Drs. Lester Baker, Paul Thornton, Franz Matschinsky, Catherine Stolle, Gerard T. Berry, and Marc Yudkoff for helpful discussions; to Dr. Roberta Colman for her advice; to Drs. Heather Dean and John Christodoulo and Louise A. Dilling for helping to acquire samples; to Dr. Ramesh Basani for many contributions to this work; and to Linda Liszewski and Lev Grunstein for assisting with the mutation analysis.


Source Information

From the Divisions of Endocrinology (C.A.S., Y.K.L., B.Y.L.H.) and Hematology (M.P.), Children's Hospital of Philadelphia, University of Pennsylvania School of Medicine, Philadelphia; the Department of Pediatrics, University of Padua, Padua, Italy (A.B.B.); the Section of Genetics and Metabolism, Department of Pediatrics and Child Health, University of Manitoba, Winnipeg, Canada (C.R.G.); the Endocrinology Division, C.S. Mott Children's Hospital, University of Michigan School of Medicine, Ann Arbor (N.J.H.); the Division of Endocrinology, Hospital for Sick Children, University of Toronto School of Medicine, Toronto (K.P.); the Section of Endocrinology, Chicago Children's Hospital, University of Chicago Pritzker School of Medicine, Chicago (B.H.R.); and the Department of Pediatrics, University of Florence, Florence, Italy (E.Z.).

Address reprint requests to Dr. Stanley at the Division of Endocrinology, Children's Hospital of Philadelphia, 34th St. and Civic Center Blvd., Philadelphia, PA 19104.

References

  1. Stanley CA. Hyperinsulinism in infants and children. Pediatr Clin North Am 1997;44:363-374. [CrossRef][Medline]
  2. Thornton PS, Sumner AE, Ruchelli ED, Spielman RS, Baker L, Stanley CA. Familial and sporadic hyperinsulinism: histopathologic findings and segregation analysis support a single autosomal recessive disorder. J Pediatr 1991;119:721-724. [CrossRef][Medline]
  3. Nestorowicz A, Wilson BA, Schoor KP, et al. Mutations in the sulfonylurea receptor gene are associated with familial hyperinsulinism in Ashkenazi Jews. Hum Mol Genet 1996;5:1813-1822. [Free Full Text]
  4. Thomas PM, Cote GJ, Wohllk N, et al. Mutations in the sulfonylurea receptor gene in familial persistent hyperinsulinemic hypoglycemia of infancy. Science 1995;268:426-429. [Free Full Text]
  5. Permutt MA, Nestorowicz A, Glaser B. Familial hyperinsulinism: an inherited disorder of spontaneous hypoglycemia in neonates and infants. Diabetes Rev 1996;4:347-55.
  6. Dunne MJ, Kane C, Shepherd RM, et al. Familial persistent hyperinsulinemic hypoglycemia of infancy and mutations in the sulfonylurea receptor. N Engl J Med 1997;336:703-706. [Free Full Text]
  7. Thomas P, Ye YY, Lightner E. Mutation of the pancreatic islet inward rectifier Kir6.2 also leads to familial persistent hyperinsulinemic hypoglycemia of infancy. Hum Mol Genet 1996;5:1809-1812. [Free Full Text]
  8. Thornton PS, Satin-Smith M, Herold K, et al. Familial hyperinsulinism with apparent autosomal dominant inheritance: clinical and genetic differences from the autosomal recessive variant. J Pediatr 1998;132:9-14. [CrossRef][Medline]
  9. Kukuvitis A, Deal C, Arbour L, Polychronakos C. An autosomal dominant form of familial persistent hyperinsulinemic hypoglycemia of infancy, not linked to the sulfonylurea receptor locus. J Clin Endocrinol Metab 1997;82:1192-1194. [Free Full Text]
  10. Glaser B, Kesavan P, Heyman M, et al. Familial hyperinsulinism caused by an activating glucokinase mutation. N Engl J Med 1998;338:226-230. [Free Full Text]
  11. Weinzimer SA, Stanley CA, Berry GT, Yudkoff M, Tuchman M, Thornton PS. A syndrome of congenital hyperinsulinism and hyperammonemia. J Pediatr 1997;130:661-664. [CrossRef][Medline]
  12. Zammarchi E, Filippi L, Novembre E, Donati MA. Biochemical evaluation of a patient with a familial form of leucine-sensitive hypoglycemia and concomitant hyperammonemia. Metabolism 1996;45:957-960. [CrossRef][Medline]
  13. Matschinsky FM, Sweet IR. Annotated questions and answers about glucose metabolism and insulin secretion of {beta}-cells. Diabetes Rev 1996;4:130-44.
  14. Gylfe E. Comparison of the effects of leucines, non-metabolizable leucine analogues and other insulin secretagogues on the activity of glutamate dehydrogenase. Acta Diabetol Lat 1976;13:20-24. [Medline]
  15. Sener A, Malaisse-Lagae F, Malaisse WJ. Stimulation of pancreatic islet metabolism and insulin release by a nonmetabolizable amino acid. Proc Natl Acad Sci U S A 1981;78:5460-5464. [Free Full Text]
  16. Fahien LA, MacDonald MJ, Kmiotek EH, Mertz RJ, Fahien CM. Regulation of insulin release by factors that also modify glutamate dehydrogenase. J Biol Chem 1988;263:13610-13614. [Free Full Text]
  17. Sener A, Malaisse WJ. L-leucine and a nonmetabolized analogue activate pancreatic islet glutamate dehydrogenase. Nature 1980;288:187-189. [CrossRef][Medline]
  18. Brusilow SW, Horwich AL. Urea cycle enzymes. In: Scriver CR, Beaudet AL, Sly WS, Valle D, eds. The metabolic and molecular bases of inherited disease. 7th ed. Vol. 1. New York: McGraw-Hill, 1995:1187-232.
  19. Stewart PM, Walser M. Short term regulation of ureagenesis. J Biol Chem 1980;255:5270-5280. [Free Full Text]
  20. Wrzeszczynski KO, Colman RF. Activation of bovine liver glutamate dehydrogenase by covalent reaction of adenosine 5'-O-[S-(4-bromo-2,3-dioxobutyl)thiophosphate] with arginine-459 at an ADP regulatory site. Biochemistry 1994;33:11544-11553. [CrossRef][Medline]
  21. Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein measurement with the Folin phenol reagent. J Biol Chem 1951;193:265-275. [Free Full Text]
  22. Nakatani Y, Schneider M, Banner C, Freese E. Complete nucleotide sequence of human glutamate dehydrogenase cDNA. Nucleic Acids Res 1988;16:6237-6237. [Free Full Text]
  23. Michaelidis TM, Tzimagiorgis G, Moschonas NK, Papamatheakis J. The human glutamate dehydrogenase gene family: gene organization and structural characterization. Genomics 1993;16:150-160. [CrossRef][Medline]
  24. Brunhuber NMW, Blanchard JS. The biochemistry and enzymology of amino acid dehydrogenases. Crit Rev Biochem Mol Biol 1994;29:415-467. [Medline]
  25. Teller JK, Baker PJ, Britton KL, Engel PC, Rice DW, Stillman TJ. Correlation of intron-exon organisation with the three-dimensional structure in glutamate dehydrogenase. Biochim Biophys Acta 1995;1247:231-238. [CrossRef][Medline]
  26. Cho SW, Ahn JY, Lee J, Choi SY. Identification of a peptide of the guanosine triphosphate binding site within brain glutamate dehydrogenase isoproteins using 8-azidoguanosine triphosphate. Biochemistry 1996;35:13907-13913. [CrossRef][Medline]
  27. Colman RF. Glutamate dehydrogenase (bovine liver). In: Kuby SA, ed. A study of enzymes. Vol. 2. Mechanism of enzyme action. Boca Raton, Fla.: CRC Press, 1991:173-92.
  28. Fahien LA, Kmiotek E. Regulation of glutamate dehydrogenase by palmitoyl-coenzyme A. Arch Biochem Biophys 1981;212:247-253. [CrossRef][Medline]
  29. Bryla J, Michalik M, Nelson J, Erecinska M. Regulation of the glutamate dehydrogenase activity in rat islets of Langerhans and its consequence on insulin release. Metabolism 1994;43:1187-1195. [CrossRef][Medline]
  30. Plaitakis A, Flessas P, Natsiou AB, Shashidharan P. Glutamate dehydrogenase deficiency in cerebellar degenerations: clinical, biochemical and molecular genetic aspects. Can J Neurol Sci 1993;20:Suppl 3:S109-S116.

 

This Article
-Abstract
- PDF

Tools and Services
-Add to Personal Archive
-Add to Citation Manager
-Notify a Friend
-E-mail When Cited

More Information
-PubMed Citation

This article has been cited by other articles:



HOME  |  SUBSCRIBE  |  SEARCH  |  CURRENT ISSUE  |  PAST ISSUES  |  COLLECTIONS  |  PRIVACY  |  HELP  |  beta.nejm.org

Comments and questions? Please contact us.

The New England Journal of Medicine is owned, published, and copyrighted © 2009 Massachusetts Medical Society. All rights reserved.