Background Epstein–Barr virus (EBV) is associated withvarious malignant and benign lymphoproliferative disorders.It also efficiently transforms human B lymphocytes in vitro.The latent membrane protein 1 (LMP1) of EBV-infected cells playsa central part in this process by mimicking members of the familyof tumor necrosis factor (TNF) receptors, thereby transmittinggrowth signals from the cell membrane to the nucleus throughcytoplasmic TNF-receptor–associated factors (TRAFs). Isought evidence of LMP1-mediated signal transduction throughTRAFs in tumor tissue from patients with post-transplantationlymphoproliferative disease and non-Hodgkin's lymphomas relatedto the acquired immunodeficiency syndrome (AIDS).
Methods The association of LMP1 with TRAF-1 or TRAF-3 in tumortissue was studied with double-immunofluorescence microscopyand immunoprecipitation assays. Evidence of LMP1–TRAFsignaling was sought with an electrophoretic mobility shiftassay for the nuclear factor-B (NF-B) transcription factor.
Results Tumors from eight patients with post-transplantationlymphoproliferative disease, two patients with AIDS-associatednon-Hodgkin's lymphoma, and three patients with endemic Burkitt'slymphoma were analyzed. Tumors from six of the patients withpost-transplantation lymphoproliferative disease were positivefor EBV and expressed LMP1; two samples were EBV-negative. Tumorsfrom both patients with AIDS-associated non-Hodgkin's lymphomawere EBV-positive and expressed LMP1, whereas tumors from allthree patients with Burkitt's tumors were positive for EBV butnegative for LMP1. Double-immunofluorescence microscopy showedthat LMP1 localized with and immunoprecipitated with TRAF-1and TRAF-3 in all eight of the EBV-positive, LMP1-positive samples.An electrophoretic mobility shift assay revealed activated NF-Bin all eight EBV-positive, LMP1-positive samples as well, butnot in either of the EBV-negative, LMP1-negative samples orin the three EBV-positive, LMP1-negative samples.
Conclusions LMP1-mediated signaling through the TRAF systemhas a role in the pathogenesis of the EBV-positive lymphomasthat arise in immunosuppressed patients.
Epstein–Barr virus (EBV) is a human herpesvirus linkedto endemic (African) Burkitt's lymphoma, post-transplantationlymphoproliferative disease, and non-Hodgkin's lymphoma associatedwith the acquired immunodeficiency syndrome (AIDS). In vitro,EBV efficiently transforms B lymphocytes, causing them to proliferatecontinually.1 EBV-infected cells express only nine viral proteins,and they mediate the transforming role of EBV in B lymphocytes.One of these proteins, latent membrane protein 1 (LMP1), haspotent transforming effects in cell culture and animal models2,3,4,5,6,7,8,9,10,11,12and is essential for the in vitro transformation of B cellsby EBV.13
LMP1 is a viral analogue of the family of tumor necrosis factor(TNF) receptors in human cells. These receptors are embeddedin the cell membrane, with one end facing the external milieuand the other the interior of the cell. Like the cellular TNFreceptors, LMP1 has a cytoplasmic tail that binds to intracellularproteins called TNF-receptor–associated factors (TRAFs).These LMP1-bound proteins activate the nuclear factor-B (NF-B)transcription factor, thereby causing the cell to proliferate(Figure 1A, Figure 1B, Figure 1C, and Figure 1D).14,15,16,17Cellular members of the TNF-receptor family are important mediatorsof lymphocyte growth and activation. Two representatives ofthis family, CD30 and CD40, are expressed by Hodgkin's and non-Hodgkin'slymphomas and may be important in the pathogenesis of thesediseases. It is plausible that LMP1 exerts its growth-promotingeffects on human B lymphocytes by aggregating in the plasmamembrane in association with members of the TRAF family. Inthis way, it would mimic an activated TNF-receptor–TRAFcomplex.
Figure 1. The Role of Epstein–Barr Virus Latent Membrane Protein 1 in Activating Cell Growth in Post-Transplantation Lymphoproliferative Disease and AIDS-Related Non-Hodgkin's Lymphoma.
The Epstein–Barr virus latent membrane protein 1 (LMP1), which is expressed in post-transplantation lymphoproliferative disease and AIDS-associated non-Hodgkin's lymphoma, aggregates in the plasma membrane of the cell (Panel A) and is a viral homologue of the family of cellular tumor necrosis factor (TNF) receptors. LMP1 binds members of the TNF-receptor–associated factor (TRAF) family (Panel B), which then activate the NF-B transcription factor (Panel C). IB is an inhibitory protein, which, when degraded, allows NF-B nuclear translocation and activation. In vitro experimental evidence indicates that LMP1 probably stimulates cell growth through its association with TRAF molecules by mimicking an activated TNF-receptor complex in the plasma membrane of the cell. Double-immunofluorescence microscopy and immunoprecipitation were used in studies of post-transplantation lymphoproliferative disease and AIDS-associated non-Hodgkin's lymphoma to determine whether LMP1 forms aggregates in association with TRAF molecules (1 in Panel D). In addition, an electrophoretic mobility shift assay was used to determine whether the NF-B transcription factor was activated in the tumors (2 in Panel D).
Despite knowledge of the in vitro transforming and biochemicalproperties of LMP1, there is no direct evidence that LMP1 contributesto the malignant phenotype of lymphoproliferative diseases.In fact, the role of EBV in the development and maintenanceof these diseases is controversial, partly because LMP1 is notexpressed in all types of EBV-associated neoplasms.1 LMP1 istypically found in post-transplantation lymphoproliferativedisease, AIDS-related non-Hodgkin's lymphoma, and Hodgkin'sdisease, but not in endemic Burkitt's lymphoma, even thoughBurkitt's tumors nearly always carry the EBV genome.18,19,20,21Burkitt's tumors also contain chromosomal translocations thatconstitutively activate the MYC gene on chromosome 8. The consistentassociation of EBV with Burkitt's lymphoma and the lack of expressionof LMP1 suggest that EBV stimulates B lymphocytes early in thedisease, whereas continued effects of EBV are not necessaryto maintain the malignant phenotype. Activation of MYC may obviatethe need for EBV proteins to sustain the transformed state.
Post-transplantation lymphoproliferative disease comprises aheterogeneous group of EBV-associated lymphoproliferative disordersthat occur in patients who receive immunosuppressive therapyafter solid-organ or bone marrow transplantation. Pathologically,the tumors range from a polymorphic proliferation of B lymphocytesto monoclonal high-grade malignant lymphoma. From studies ofBurkitt's lymphoma, one might expect that LMP1 may no longerbe expressed in monoclonal cases of post-transplantation lymphoproliferativedisease. Actually, these monoclonal cases can have Burkitt-likeMYC translocations and also abundantly express LMP1,22 suggestingthat LMP1 is necessary for the malignant phenotype of post-transplantationlymphoproliferative disease.
In this study, I investigated the physical association of LMP1with TRAF molecules in tumor specimens from representative casesof post-transplantation lymphoproliferative disease and EBV-positiveAIDS-associated non-Hodgkin's lymphoma (Figure 1A, Figure 1B,Figure 1C, and Figure 1D). In each case, I also determined whetherthe NF-B transcription factor was activated in the tumors. Thefinding of LMP1 in association with TRAF molecules and activatedNF-B in post-transplantation lymphoproliferative disease andAIDS-associated non-Hodgkin's lymphoma tumors is evidence thatLMP1 signaling contributes to the transformed phenotype of EBV-associatedtumors in vivo.
Methods
Tumor Tissue, Cells, and Cell Culture
Specimens from eight patients with post-transplantation lymphoproliferativedisease, which had been analyzed previously,22 and from twopatients with AIDS-associated non-Hodgkin's lymphoma were studied.Tumor tissue was obtained from fresh biopsy specimens that wereflash-frozen in liquid nitrogen at the time of collection. Threefrozen biopsy specimens of Burkitt's tumor were generously providedby African physicians over a span of several years. Controlcell lines were grown in continuous cultures at 37°C in5 percent carbon dioxide in RPMI-1640 medium supplemented with10 percent fetal-calf serum (BioWhittaker, Walkersville, Md.).IB4 is an EBV-infected cord-blood B lymphoblastoid cell linethat does not allow viral replication. BJAB is an EBV-negativehuman B lymphoma cell line.
Antibodies and Antiserum
The S12 monoclonal antibody recognizes the C-terminal portionof LMP1 and was kindly provided by Elliott Kieff (Harvard MedicalSchool, Boston). The CS1, CS2, CS3, and CS4 anti-LMP1 monoclonalantibodies were from Dako (Carpinteria, Calif.). Antiserum tothe TRAF molecules was obtained from Santa Cruz Biotech (SantaCruz, Calif.). Rabbit anti-TRAF1 antiserum (N19) was used forimmunofluorescence staining and immunoprecipitation, and rabbitanti-TRAF1 antiserum (S19) was used for Western immunoblotting.Rabbit anti-TRAF2 antiserum (C20 and N19) was used for immunofluorescencestaining and Western immunoblotting. Antiserum N19 anti-TRAF1and N19 anti-TRAF2 have distinct specificities and do not cross-react.The rabbit anti-TRAF3 antibody H20 was used for immunofluorescencestaining, immunoprecipitation, and Western immunoblotting. Normalgoat and rabbit serum was purchased from Sigma Chemical (St.Louis). Goat antimouse antibodies (H and L) or goat antirabbitsecondary antibodies conjugated with Oregon green 488 and Texasred X were obtained from Molecular Probes (Eugene, Oreg.).
Western Immunoblotting
Proteins were solubilized from fresh or frozen tissue in samplebuffer (62.5 mM TRIS–hydrochloride, pH 6.8; 2 percentsodium dodecyl sulfate, 10 percent glycerol, and 5 percent 2-mercaptoethanol)at 95°C for 10 minutes. The lysates were cleared by microcentrifugationfor five minutes, and the supernatants were collected for separationby discontinuous sodium dodecyl sulfate–polyacrylamide-gelelectrophoresis according to standard procedures.8 After separation,proteins were transferred to nitrocellulose and the membraneswere probed with a biotin-conjugated anti-LMP1 (S12) monoclonalantibody, washed, and then probed with 125I-labeled streptavidin(Amersham, Arlington Heights, Ill.). After a final washing,the reactive protein bands were detected by autoradiographywith Kodak XAR-5 film (Eastman Kodak, Rochester, N.Y.).
Immunofluorescence Microscopy
The sections were fixed in methanol–acetone (3:1 vol/vol)at -20°C for 5 to 10 minutes. After fixation, the slideswere briefly washed in phosphate-buffered saline and then blockedwith 10 percent (vol/vol) normal goat serum for 20 minutes andstained with monoclonal antibodies for LMP1 and rabbit antiserumfor TRAF1, TRAF2, or TRAF3 as follows. All antibody dilutionswere in 10 percent normal goat serum in phosphate-buffered saline.The tissue sections were incubated for one hour with S12 (anti-LMP)hybridoma supernatant (dilution, 1:100) and one of the following:400 ng of N19 (anti-TRAF1) per milliliter, 400 ng of H20 (anti-TRAF3)per milliliter, 400 ng of C20 (anti-TRAF2) per milliliter, or400 ng of N19 (anti-TRAF2) per milliliter. The samples werethen washed three times in phosphate-buffered saline for 10minutes. The secondary antibodies Oregon green 488 goat antimouseIgG (H and L) and Texas red X goat antirabbit IgG (H and L)were incubated at a concentration of 2 µg per milliliterwith the sections for 30 minutes followed by three 10-minutewashes in phosphate-buffered saline. The stained sections wereair-dried, mounted in ProLong Antifade (Molecular Probes) accordingto the manufacturer's directions, and photographed on a microscope(model ES800, Nikon, New York) equipped with an epifluorescentsystem for detecting fluorescein isothiocyanate, Texas red,or a combination of the two.
Electrophoretic Mobility Shift Assay
Nuclear extracts were prepared from cultured cells or tissuesas described previously.16 The protein content was determinedby the Bradford assay (Bio-Rad Laboratories, Hercules, Calif.).A probe was generated from a pair of complementary oligonucleotidescontaining a specific binding site for the NF-B transcriptionfactor: 5'AGCTTGGGGACTTTCCACTAGTACG3' and 5'AATTCGTACTAGTGGAAAGTCCCCA3'.The oligonucleotides were designed so that, when annealed, thedouble-stranded probe DNA contained single-stranded 5' ends.The probe was labeled by filling in the single-stranded 5' endswith the Klenow fragment in the presence of [32P]deoxy-ATP.Complementary oligonucleotides were annealed by heating to 95°Cfor five minutes, then allowed to cool on the benchtop. Thelabeled probe was isolated, and binding reactions and electrophoresiswere performed as described previously.16 Autoradiography wasperformed on the dried gel. The specificity of the shifted bandwas determined by comparison with appropriate positive and negativecontrols and by using excess cold oligonucleotide to competewith the radiolabeled probe, thereby leaving no visible shiftedband on the autoradiograph.
DNA Amplification
A pair of oligonucleotide primers 5'GTTCGCGTTGCTAGGCCACC3' and5'AGGACCACTTTATACCAGGG3' were used for DNA amplification thatflank part of the BamW repeat sequence of the EBV nuclear antigen2 gene, resulting in a product of 100 bp. DNA was amplifiedfor 30 to 40 rounds in a DNA thermal cycler (model 2400, Perkin–ElmerCetus, Norwalk, Conn.; or Rapidcycler, Idaho Technology, Boise,Idaho) according to the manufacturer's recommendations. Forthe Perkin–Elmer thermal cycler, the amplification consistedof denaturation for 60 seconds at 94°C, primer annealingfor 90 seconds at 56°C, and extension for 90 seconds at72°C; for the Rapidcycler, amplification consisted of denaturationfor 5 seconds at 94°C, annealing for 10 seconds at 56°C,and extension for 15 seconds at 72°C. The amplificationproducts were separated by agarose-gel electrophoresis (NuSieve,FMC Bioproducts, Rockland, Me.) and analyzed by ethidium bromidestaining for the appropriate size DNA band. EBV-positive andEBV-negative control cell lines were also amplified.
Results
The morphologic findings, clonality, cytogenetic characteristics,and pattern of EBV gene expression in samples of tumor fromeight patients with post-transplantation lymphoproliferativedisease22 and two patients with AIDS-associated non-Hodgkin'slymphoma are shown in Table 1. Two of the 10 specimens —both from patients with post-transplantation lymphoproliferativediseases — were EBV-negative.22 The other specimens wereEBV-positive and expressed the LMP1 protein on immunofluorescencemicroscopy and Western immunoblotting (data not shown). Allthree specimens of endemic Burkitt's lymphoma were EBV-positiveby the polymerase chain reaction, but in none was LMP1 proteindetectable by immunofluorescence microscopy or Western immunoblotting.In these three lymphomas, MYC gene rearrangements were foundby Southern blotting (unpublished observations).
Table 1. Characteristics of Patients with Post-Transplantation Lymphoproliferative Disease and Patients with AIDS-Associated Non-Hodgkin's Lymphoma.
Two methods were used to examine tumor specimens for interactionsbetween LMP1 and TRAF molecules: double-immunofluorescence microscopyand immunoprecipitation. Tissue from all eight of the LMP1-positivespecimens was examined to establish whether LMP1 was found withantibodies against either TRAF-1 or TRAF-3 on double-immunofluorescencemicroscopy (LMP1 associates with both TRAF-1 and TRAF-3 in vitro16).In every case, LMP1 was found with TRAF-1 (Figure 2A, Figure 2B,and Figure 2C) and TRAF-3 (Figure 3A, Figure 3B, and Figure 3C)in plasma-membrane aggregates. This result indicates thatthe two TRAF signaling molecules associate with membrane aggregatesof LMP1 in post-transplantation lymphoproliferative diseaseand in AIDS-associated non-Hodgkin's lymphoma.
Figure 2. Localization of Latent Membrane Protein 1 with TNF-Receptor–Associated Factor 1 in Tumor Samples from a Patient with Post-Transplantation Lymphoproliferative Disease (x1000).
Briefly, frozen tumor specimens were sectioned (thickness, 1 to 2 µm), fixed in methanol–acetone (3:1), and stained with a monoclonal antibody specific for latent membrane protein 1 (LMP1) or polyclonal rabbit antiserum to TNF-receptor–associated factor 1 (TRAF-1). Panel A shows the pattern of LMP1 staining (green fluorescence), Panel B the pattern of TRAF-1 staining (red fluorescence), and Panel C the dual staining of LMP1 and TRAF-1 (yellow fluorescence). LMP1 typically forms patches that aggregate into a large cap in the membrane; TRAF-1 has adopted the same distribution pattern as LMP1.
Figure 3. Localization of Latent Membrane Protein 1 with TNF-Receptor–Associated Factor 3 in Tumor Samples from a Patient with Post-Transplantation Lymphoproliferative Disease (x1000).
Briefly, frozen tumor specimens were sectioned (thickness, 1 to 2 µm), fixed in methanol–acetone (3:1), and stained with a monoclonal antibody specific for latent membrane protein 1 (LMP1) or polyclonal rabbit antiserum to TNF-receptor–associated factor 3 (TRAF-3). Panel A shows the pattern of LMP1 staining (green fluorescence), Panel B the pattern of TRAF-3 staining (red fluorescence), and Panel C the dual staining of LMP1 and TRAF-3 (yellow fluorescence). LMP1 typically forms patches that aggregate into a large cap in the membrane; TRAF-3, like TRAF-1, has adopted the same distribution pattern as LMP1.
To confirm these findings, an immunoprecipitation assay wasperformed. If LMP1 is physically associated with TRAF-1 andTRAF-3 molecules in these tumors, then immunoprecipitation withspecific antiserum to TRAF-1 or TRAF-3 should also precipitateLMP1. Antibodies against TRAF-1, TRAF-3, or LMP1 were used topromote immunoprecipitation of their specific target molecules.The presence of LMP1 in the immunoprecipitates was analyzedby Western immunoblotting. Figure 4 shows a representative experimentwith a specimen from a patient with post-transplantation lymphoproliferativedisease in which 10 percent of the total LMP1 in the tumor lysatewas immunoprecipitated with either anti-TRAF-1 or anti-TRAF-3antibodies. The findings were similar for all four of the samplesfrom patients with post-transplantation lymphoproliferativedisease that were tested in this way and for both samples fromthe patients with AIDS-associated non-Hodgkin's lymphoma.
Figure 4. Immunoprecipitation of Latent Membrane Protein 1 with TNF-Receptor–Associated Factors 1 and 3 from Tumor Tissue from a Patient with Post-Transplantation Lymphoproliferative Disease.
Protein lysates from tumor tissue were prepared and immunoprecipitated with antibodies against TNF-receptor–associated factor (TRAF) or latent membrane protein 1 (LMP1) and analyzed for LMP1 by Western immunoblotting. Lane 1 shows an LMP1-positive control containing 20 percent of the amount of lysate used for the immunoprecipitation assays shown in the other lanes. Lane 2 shows the LMP1 that was immunoprecipitated with the anti–TRAF-1 antibody. Lane 3 shows the LMP1 that was immunoprecipitated with the anti–TRAF-3 antibody. Lane 4 shows the LMP1 that was immunoprecipitated with the anti-LMP1 antibody. No LMP1 was detected when nonimmune normal mouse serum (lane 5) or rabbit serum (lane 6) was used in the immunoprecipitation assay.
The immunoprecipitation of LMP1 with anti-TRAF-1 or anti-TRAF-3antiserum confirms that the LMP1 transforming protein is physicallyassociated with these TRAF signaling molecules in the lymphoproliferativedisorders under investigation. Since in vitro studies have shownthat LMP1 mimics an activated TNF-receptor complex by aggregatingwith TRAF molecules,14 my findings suggest that the same mechanismcontributes to abnormal cell growth in post-transplantationlymphoproliferative disease and AIDS-associated non-Hodgkin'slymphoma.
In vitro, a functional consequence of the binding of LMP1 toTRAF-1 is activation of the NF-B transcription factor. To testthe hypothesis that aggregates of LMP1 and TRAF have a similareffect in vivo, an electrophoretic mobility shift assay wasused to detect activated NF-B in the nucleus of tumor cells.There was enough material to perform these assays on LMP1-positivesamples from four patients with post-transplantation lymphoproliferativedisease and both patients with AIDS-associated non-Hodgkin'slymphoma, and on LMP1-negative samples from three patients withendemic Burkitt's lymphoma and two patients with post-transplantationlymphoproliferative disease (Figure 5A and Figure 5B). In allthe LMP1-positive samples, the electrophoretic mobility shiftassay showed activated NF-B, whereas samples of EBV-negative,LMP1-negative tissue from patients with post-transplantationlymphoproliferative disease and samples of EBV-positive, LMP1-negativetissue from patients with Burkitt's lymphoma did not have detectableactivated NF-B. In all samples showing activated NF-B, therewas complete correlation between aggregates of LMP1 and TRAFsignaling molecules in the plasma membrane and signs of activationof NF-B in the cell nucleus.
Figure 5. Activation of NF-B in Tumors Expressing Latent Membrane Protein 1 (Panel A), but Not in Tumors That Do Not Express the Protein (Panel B).
Nuclear lysates from tumors were prepared, and electrophoretic mobility shift assays were performed. In Panel A, lane 1 shows the negative control, a human B-cell line (BJAB) that is negative for Epstein–Barr virus (EBV). Lane 2 shows the positive control, the BJAB cell line transfected with latent membrane protein 1 (LMP1). Lane 3 shows an EBV-negative tumor sample that was also negative for LMP1 from a patient with post-transplantation lymphoproliferative disease (Patient 6 in Table 1). Lane 4 shows an EBV-positive, LMP1-positive tumor sample from a patient with post-transplantation lymphoproliferative disease (Patient 8 in Table 1). In Panel B, lane 1 shows the BJAB negative control. Lane 2 shows an EBV-positive (LMP1-positive) specimen from a patient with AIDS-associated non-Hodgkin's lymphoma (Patient 9 in Table 1). Lanes 3, 4, and 5 show EBV-positive, LMP1-negative tumor samples from three patients with endemic Burkitt's lymphoma.
Discussion
This study demonstrates an interaction between the EBV transformingprotein LMP1 and the TRAF-1 and TRAF-3 signal-transduction moleculesin post-transplantation lymphoproliferative disease and AIDS-associatednon-Hodgkin's lymphoma. This finding provides evidence thatLMP1 functions as a signaling protein in the cells of thesetumors. Additional support for this conclusion is provided bythe finding of activated NF-B in tumors in which LMP1 was boundto TRAF-1 and TRAF-3 and, conversely, the absence of activatedNF-B in tumors lacking LMP1. Evidence from genetic and biochemicalstudies of cell cultures indicates that LMP1 is a constitutivelyactivated viral analogue of the cellular TNF-receptor family.These investigations also show that LMP1 transduces an NF-Bactivation signal that is partially mediated through TRAF molecules.Through its potent growth-promoting effects, LMP1 has been postulatedto mediate cell transformation in EBV-associated cancers inhumans, although direct evidence of this effect has been lacking.13,14,15,16,17The frequent expression of LMP1 in tumor tissue from patientswith post-transplantation lymphoproliferative disease and AIDS-associatednon-Hodgkin's lymphoma supports the notion that LMP1 may contributeto the development of these diseases.
In contrast to the findings in specimens from patients withendemic Burkitt's lymphoma, all EBV-positive specimens frompatients with post-transplantation lymphoproliferative diseaseexpressed LMP1, including those with Burkitt-like lymphoma whohad MYC gene translocations.22 This suggests that in post-transplantationlymphoproliferative disease, LMP1 may be necessary for the proliferationof malignant cells, even after activation of cellular oncogenes.In AIDS-associated non-Hodgkin's lymphoma, less is known aboutthe pattern of LMP1 expression as it relates to cellular oncogeneactivation. Notably, Patient 9, who had AIDS-associated non-Hodgkin'slymphoma (Table 1), had both LMP1 and a MYC gene translocation,suggesting similarities in the pathogenesis of this kind oflymphoma and post-transplantation lymphoproliferative disease.
EBV was first identified in endemic Burkitt's lymphoma cellsmore than 30 years ago and has since been linked to severalmalignant diseases. Nevertheless, direct evidence of an EBV-mediatedsignaling process in these neoplasms has been elusive. Giventhe evidence that LMP1 signaling through aggregation with TRAFmolecules is essential for transformation in vitro, my findingssuggest that this pathway is also critical to the malignantphenotype in vivo. The presence of cellular (nonviral) membersof the TNF-receptor family, including CD30 and CD40, is characteristicof other types of lymphoma. TRAF-mediated signaling processesmay occur in a similar manner in these diseases and may be importantin the transformation process.
Supported by a grant (CA 73545) from the National Cancer Institute.
I am indebted to Elliott Kieff, M.D., Ph.D., for critical reviewof the data as well as for numerous helpful discussions; toColin Duckett, Ph.D., for invaluable assistance with the NF-Belectrophoretic mobility shift assays and critical review ofthe data; and to Melissa Cavaghan, M.D., for critical reviewof the manuscript.
Source Information
From the Marjorie B. Kovler Viral Oncology Laboratories, Department of Medicine, Section of Hematology/Oncology and Virology, University of Chicago, Chicago. Presented in part at the National AIDS Malignancy Conference, Bethesda, Md., April 22, 1997.
Address reprint requests to Dr. Liebowitz at the University of Chicago Medical Center, Department of Medicine, Section of Hematology/Oncology, 5841 S. Maryland Ave., MC2115, Chicago, IL 60637.
References
Kieff E. Epstein-Barr virus and its replication. In: Fields BN, Knipe DM, Howley PM, eds. Fields virology. 3rd ed. Vol. 2. Philadelphia: Lippincott-Raven, 1996:2343-96.
Wang D, Liebowitz D, Kieff E. An EBV membrane protein expressed in immortalized lymphocytes transforms established rodent cells. Cell 1985;43:831-840. [CrossRef][Medline]
Wang D, Liebowitz D, Kieff E. The truncated form of the Epstein-Barr virus latent-infection membrane protein expressed in virus replication does not transform rodent fibroblasts. J Virol 1988;62:2337-2346. [Free Full Text]
Baichwal VR, Sugden B. Transformation of Balb 3T3 cells by the BNLF-1 gene of Epstein-Barr virus. Oncogene 1988;2:461-467. [Medline]
Dawson CW, Rickinson AB, Young LS. Epstein-Barr virus latent membrane protein inhibits human epithelial cell differentiation. Nature 1990;344:777-780. [CrossRef][Medline]
Wilson JB, Weinberg W, Johnson R, Yuspa S, Levine AJ. Expression of the BNLF-1 oncogene of Epstein-Barr virus in the skin of transgenic mice induces hyperplasia and aberrant expression of keratin 6. Cell 1990;61:1315-1327. [CrossRef][Medline]
Fahraeus R, Rymo L, Rhim JS, Klein G. Morphological transformation of human keratinocytes expressing the LMP gene of Epstein-Barr virus. Nature 1990;345:447-449. [CrossRef][Medline]
Wang D, Liebowitz D, Wang F, et al. Epstein-Barr virus latent infection membrane protein alters the human B-lymphocyte phenotype: deletion of the amino terminus abolishes activity. J Virol 1988;62:4173-4184. [Free Full Text]
Henderson S, Rowe M, Gregory C, et al. Induction of bcl-2 expression by Epstein-Barr virus latent membrane protein 1 protects infected B cells from programmed cell death. Cell 1991;65:1107-1115. [CrossRef][Medline]
Hammarskjold ML, Simurda MC. Epstein-Barr virus latent membrane protein transactivates the human immunodeficiency virus type 1 long terminal repeat through induction of NF-kappa B activity. J Virol 1992;66:6496-6501. [Free Full Text]
Laherty CD, Hu HM, Opipari AW, Wang F, Dixit VM. The Epstein-Barr virus LMP1 gene product induces A20 zinc finger protein expres-sion by activating nuclear factor kappa B. J Biol Chem 1992;267:24157-24160. [Free Full Text]
Rowe M, Peng-Pilon M, Huen DS, et al. Upregulation of bcl-2 by the Epstein-Barr virus latent membrane protein LMP1: a B-cell-specific response that is delayed relative to NF-kappa B activation and to induction of cell surface markers. J Virol 1994;68:5602-5612. [Free Full Text]
Kaye KM, Izumi KM, Kieff E. Epstein-Barr virus latent membrane protein 1 is essential for B-lymphocyte growth transformation. Proc Natl Acad Sci U S A 1993;90:9150-9154. [Free Full Text]
Mosialos G, Birkenbach M, Yalamanchili R, VanArsdale T, Ware C, Kieff E. The Epstein-Barr virus transforming protein LMP1 engages signaling proteins for the tumor necrosis factor receptor family. Cell 1995;80:389-399. [CrossRef][Medline]
Kaye KM, Devergne O, Harada JN, et al. Tumor necrosis factor receptor associated factor 2 is a mediator of NF-B activation by latent infection membrane protein 1, the Epstein-Barr virus transforming protein. Proc Natl Acad Sci U S A 1996;93:11085-11090. [Free Full Text]
Devergne O, Hatzivassiliou E, Izumi KM, et al. Association of TRAF1, TRAF2, and TRAF3 with an Epstein-Barr virus LMP1 domain important for B-lymphocyte transformation: role in NF-B activation. Mol Cell Biol 1996;16:7098-7108. [Abstract]
Liebowitz D, Mannick J, Takada K, Kieff E. Phenotypes of Epstein-Barr virus LMP1 deletion mutants indicate transmembrane and amino-terminal cytoplasmic domains necessary for effects in B-lymphoma cells. J Virol 1992;66:4612-4616. [Free Full Text]
Liebowitz D, Kieff E. Epstein-Barr virus. In: Roizman B, Whitley RJ, Lopez C, eds. The human herpesviruses. New York: Raven Press, 1993:107-72.
Rowe DT, Rowe M, Evan GI, Wallace LE, Farrell PJ, Rickinson AB. Restricted expression of EBV latent genes and T-lymphocyte-detected membrane antigen in Burkitt's lymphoma cells. EMBO J 1986;5:2599-2607. [Medline]
Hatzubai A, Anafi M, Masucci MG, et al. Down-regulation of the EBV-encoded membrane protein (LMP) in Burkitt lymphomas. Int J Cancer 1987;40:358-364. [Medline]
Gregory CD, Rowe M, Rickinson AB. Different Epstein-Barr virus-B cell interactions in phenotypically distinct clones of a Burkitt's lymphoma cell line. J Gen Virol 1990;71:1481-1495. [Free Full Text]
Liebowitz D, LeBeau MM, Olopade OI. Evidence for signal transduction through the TNF receptor pathway in post-transplant lymphoproliferative disorders. J Acquir Immune Defic Syndr Hum Retrovirol 1997;14:A51-A51.abstract
Zou, P., Kawada, J., Pesnicak, L., Cohen, J. I.
(2007). Bortezomib Induces Apoptosis of Epstein-Barr Virus (EBV)-Transformed B Cells and Prolongs Survival of Mice Inoculated with EBV-Transformed B Cells. J. Virol.
81: 10029-10036
[Abstract][Full Text]
An, F.-Q., Compitello, N., Horwitz, E., Sramkoski, M., Knudsen, E. S., Renne, R.
(2005). The Latency-associated Nuclear Antigen of Kaposi's Sarcoma-associated Herpesvirus Modulates Cellular Gene Expression and Protects Lymphoid Cells from p16 INK4A-induced Cell Cycle Arrest. J. Biol. Chem.
280: 3862-3874
[Abstract][Full Text]
Chimenti, C., Russo, A., Pieroni, M., Calabrese, F., Verardo, R., Thiene, G., Russo, M. A., Maseri, A., Frustaci, A.
(2004). Intramyocyte Detection of Epstein-Barr Virus Genome by Laser Capture Microdissection in Patients With Inflammatory Cardiomyopathy. Circulation
110: 3534-3539
[Abstract][Full Text]
Purdue, M. P., Bassani, D. G., Klar, N. S., Sloan, M., Kreiger, N., The Canadian Cancer Registries Epidemiology Resear,
(2004). Dietary Factors and Risk of Non-Hodgkin Lymphoma by Histologic Subtype: A Case-Control Analysis. Cancer Epidemiol. Biomarkers Prev.
13: 1665-1676
[Abstract][Full Text]
Mathur, R. V., Kudesia, G., Suvarna, K., McKane, W.
(2004). Fulminant post-transplant lymphoproliferative disorder presenting with lactic acidosis and acute liver failure. Nephrol Dial Transplant
19: 1918-1920
[Full Text]
Katano, H., Pesnicak, L., Cohen, J. I.
(2004). Simvastatin induces apoptosis of Epstein-Barr virus (EBV)-transformed lymphoblastoid cell lines and delays development of EBV lymphomas. Proc. Natl. Acad. Sci. USA
101: 4960-4965
[Abstract][Full Text]
Thompson, M. P., Kurzrock, R.
(2004). Epstein-Barr Virus and Cancer. Clin. Cancer Res.
10: 803-821
[Abstract][Full Text]
Aljurf, M. D., Owaidah, T. W., Ezzat, A., Ibrahim, E., Tbakhi, A.
(2003). Antigen- and/or immune-driven lymphoproliferative disorders. Ann Oncol
14: 1595-1606
[Full Text]
Andreone, P., Gramenzi, A., Lorenzini, S., Biselli, M., Cursaro, C., Pileri, S., Bernardi, M.
(2003). Posttransplantation Lymphoproliferative Disorders. Arch Intern Med
163: 1997-2004
[Abstract][Full Text]
Siegler, G, Kremmer, E, Gonnella, R, Niedobitek, G
(2003). Epstein-Barr virus encoded latent membrane protein 1 (LMP1) and TNF receptor associated factors (TRAF): colocalisation of LMP1 and TRAF1 in primary EBV infection and in EBV associated Hodgkin lymphoma. Mol. Pathol.
56: 156-161
[Abstract][Full Text]
Otieno, M. W., Banura, C., Katongole-Mbidde, E., Johnson, J. L., Ghannoum, M., Dowlati, A., Renne, R., Arts, E., Whalen, C., Lederman, M. M., Remick, S. C.
(2002). Therapeutic Challenges of AIDS-Related Non-Hodgkin's Lymphoma in the United States and East Africa. JNCI J Natl Cancer Inst
94: 718-732
[Abstract][Full Text]
Swinnen, L. J.
(2000). Post-transplant Lymphoproliferative Disorders: Implications for Acquired Immunodeficiency Syndrome-Associated Malignancies. J Natl Cancer Inst Monogr
2000: 38-43
[Abstract][Full Text]
Mamzer-Bruneel, M-F., Lome, C., Morelon, E., Levy, V., Bourquelot, P., Jacobs, F., Gessain, A., Mac Intyre, E., Brousse, N., Kreis, H., Hermine, O.
(2000). Durable Remission After Aggressive Chemotherapy for Very Late Post-Kidney Transplant Lymphoproliferation: A Report of 16 Cases Observed in a Single Center. JCO
18: 3622-3632
[Abstract][Full Text]
Keller, S. A., Schattner, E. J., Cesarman, E.
(2000). Inhibition of NF-kappa B induces apoptosis of KSHV-infected primary effusion lymphoma cells. Blood
96: 2537-2542
[Abstract][Full Text]
Cohen, J. I.
(2000). Epstein-Barr Virus Infection. NEJM
343: 481-492
[Full Text]
Webster-Cyriaque, J., Middeldorp, J., Raab-Traub, N.
(2000). Hairy Leukoplakia: an Unusual Combination of Transforming and Permissive Epstein-Barr Virus Infections. J. Virol.
74: 7610-7618
[Abstract][Full Text]
Groves, F. D., Linet, M. S., Travis, L. B., Devesa, S. S.
(2000). Cancer Surveillance Series: Non-Hodgkin's Lymphoma Incidence by Histologic Subtype in the United States From 1978 Through 1995. JNCI J Natl Cancer Inst
92: 1240-1251
[Abstract][Full Text]
Kadin, M. E.
(2000). Regulation of CD30 Antigen Expression and Its Potential Significance for Human Disease. Am. J. Pathol.
156: 1479-1484
[Full Text]
Herbein, G., O'brien, W. A.
(2000). Tumor Necrosis Factor (TNF)-{alpha} and TNF Receptors in Viral Pathogenesis. Exp. Biol. Med.
223: 241-257
[Abstract][Full Text]
Engel, M, Essop, M F, Close, P, Hartley, P, Pallesen, G, Sinclair-Smith, C
(2000). Improved prognosis of Epstein-Barr virus associated childhood Hodgkin's lymphoma: study of 47 South African cases. J. Clin. Pathol.
53: 182-186
[Abstract][Full Text]
Furman, R. R., Asgary, Z., Mascarenhas, J. O., Liou2, H.-C., Schattner, E. J.
(2000). Modulation of NF-{kappa}B Activity and Apoptosis in Chronic Lymphocytic Leukemia B Cells. J. Immunol.
164: 2200-2206
[Abstract][Full Text]
Levine, S. M., Angel, L., Anzueto, A., Susanto, I., Peters, J. I., Sako, E. Y., Bryan, C. L.
(1999). A Low Incidence of Posttransplant Lymphoproliferative Disorder in 109 Lung Transplant Recipients. Chest
116: 1273-1277
[Abstract][Full Text]
Curtis, R. E., Travis, L. B., Rowlings, P. A., Socie, G., Kingma, D. W., Banks, P. M., Jaffe, E. S., Sale, G. E., Horowitz, M. M., Witherspoon, R. P., Shriner, D. A., Weisdorf, D. J., Kolb, H.-J., Sullivan, K. M., Sobocinski, K. A., Gale, R. P., Hoover, R. N., Fraumeni, J. F. Jr, Deeg, H. J.
(1999). Risk of Lymphoproliferative Disorders After Bone Marrow Transplantation: A Multi-Institutional Study. Blood
94: 2208-2216
[Abstract][Full Text]
Menet, A., Speth, C., Larcher, C., Prodinger, W. M., Schwendinger, M. G., Chan, P., Jäger, M., Schwarzmann, F., Recheis, H., Fontaine, M., Dierich, M. P.
(1999). Epstein-Barr Virus Infection of Human Astrocyte Cell Lines. J. Virol.
73: 7722-7733
[Abstract][Full Text]
Chan, C.-C., Shen, D. F., Whitcup, S. M., Nussenblatt, R. B., LeHoang, P., Roberge, F. G., Cassoux, N., Herbort, C., Zhuang, Z.
(1999). Detection of Human Herpesvirus-8 and Epstein-Barr Virus DNA in Primary Intraocular Lymphomas. Blood
93: 2749-2751
[Full Text]
Carbone, A., Gloghini, A., Larocca, L. M., Antinori, A., Falini, B., Tirelli, U., Dalla-Favera, R., Gaidano, G.
(1999). Human Immunodeficiency Virus-Associated Hodgkin's Disease Derives From Post-Germinal Center B Cells. Blood
93: 2319-2326
[Abstract][Full Text]
Durkop, H., Foss, H.-D., Demel, G., Klotzbach, H., Hahn, C., Stein, H.
(1999). Tumor Necrosis Factor Receptor-Associated Factor 1 Is Overexpressed in Reed-Sternberg Cells of Hodgkin's Disease and Epstein-Barr Virus-Transformed Lymphoid Cells. Blood
93: 617-623
[Abstract][Full Text]
Arch, R. H., Gedrich, R. W., Thompson, C. B.
(1998). Tumor necrosis factor receptor-associated factors (TRAFs)---a family of adapter proteins that regulates life and death. Genes Dev.
12: 2821-2830
[Full Text]
Rickinson, A.B.
(1998). Epstein-Barr Virus in Action in Vivo. NEJM
338: 1461-1463
[Full Text]
Majewski, M., Korecka, M., Kossev, P., Li, S., Goldman, J., Moore, J., Silberstein, L. E., Nowell, P. C., Schuler, W., Shaw, L. M., Wasik, M. A.
(2000). The immunosuppressive macrolide RAD inhibits growth of human Epstein-Barr virus-transformed B lymphocytes in vitro and in vivo: A potential approach to prevention and treatment of posttransplant lymphoproliferative disorders. Proc. Natl. Acad. Sci. USA
97: 4285-4290
[Abstract][Full Text]
B (NF-
Previous
