FREE NEJM E-TOC    HOME   |   SUBSCRIBE   |   CURRENT ISSUE   |   PAST ISSUES   |   COLLECTIONS   |   Search Term  Advanced Search

Sign in | Get NEJM's E-Mail Table of Contents — Free | Subscribe

Previous Volume 338:1577-1584 May 28, 1998 Number 22 Next

Abstract PDF Letters Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited PubMed Citation

ABSTRACT

Background Familial hypercholesterolemia leads to premature ischemic heart disease and is often caused by mutations in the gene for the low-density lipoprotein receptor. Mutations in the apolipoprotein B gene, which encodes a ligand for this receptor, may also result in this phenotype.

Methods We studied the genotypes of 9255 women and men from the general population, 948 patients with ischemic heart disease, and 36 patients with familial hypercholesterolemia, all from Denmark, for three mutations in the apolipoprotein B gene: Arg3500Gln, Arg3531Cys, and Arg3500Trp.

Results The prevalence of heterozygotes in the general population was 0.08 percent (95 percent confidence interval, 0.03 to 0.16 percent) for both the Arg3500Gln and the Arg3531Cys mutations, and 0.00 percent (95 percent confidence interval, 0.00 to 0.18 percent) for the Arg3500Trp mutation. Among carriers of the Arg3500Gln mutation, cholesterol levels were significantly higher than among noncarriers in the general population — by 100 mg per deciliter (2.6 mmol per liter) among carriers in the general population, 154 mg per deciliter (4.0 mmol per liter) among patients with ischemic heart disease, and 172 mg per deciliter (4.5 mmol per liter) among patients with familial hypercholesterolemia. Heterozygous carriers of the Arg3500Gln mutation were significantly more common among patients with ischemic heart disease (odds ratio, 7.0; 95 percent confidence interval, 2.2 to 22; P=0.003) and patients with familial hypercholesterolemia (odds ratio, 78; 95 percent confidence interval, 16 to 388; P=0.001) than in the general population. Heterozygous carriers of the Arg3531Cys mutation in the general population did not have higher-than-normal plasma cholesterol levels or an increased risk of ischemic heart disease (odds ratio; 1.4; 95 percent confidence interval, 0.2 to 11; P=0.54).

Conclusions The Arg3500Gln mutation in the apolipoprotein B gene, which is responsible for familial defective apolipoprotein B-100 and is present in approximately 1 in 1000 persons in Denmark, causes severe hypercholesterolemia and increases the risk of ischemic heart disease.

Despite intensive research in this field,^{7,8,9,10,11,12,13,14,15} only three such mutations in APOB have been identified: Arg3500Gln, which is responsible for familial defective apolipoprotein B-100^7,10; Arg3531Cys⁸; and Arg3500Trp.⁹ However, since familial defective apolipoprotein B-100 has with few exceptions been identified only among patients with hyperlipidemia or familial hypercholesterolemia^11,12,13 and not in the general population, the estimate of the frequency of this mutation in the adult general population is only approximate, the effect of the mutation on cholesterol levels is probably overestimated, and the risk of ischemic heart disease associated with this mutation is not known. Neither the frequencies of Arg3531Cys^8,14,15 and Arg3500Trp⁹ in the general population nor their effect on hyperlipidemia and the risk of ischemic heart disease is known.

From a practical point of view, in order to be of clinical value for screening, a mutation in APOB must be both relatively frequent and associated with hypercholesterolemia, and thus with an increased risk of ischemic heart disease. We studied the three mutations in APOB to see whether they fulfill these criteria.

Methods

Subjects

To obtain subjects from the general population, we recruited 5121 women and 4134 men who had participated in the Copenhagen City Heart Study from 1991 through 1994.^16,17,18 We screened participants for manifestations of ischemic heart disease by reviewing all hospital admissions and diagnoses entered in the Danish National Hospital Discharge Register. The diagnoses were based on the International Classification of Diseases, eighth revision (ischemic heart disease codes 410 through 414).

Patients with ischemic heart disease were identified among 992 consecutive female and male patients from the greater Copenhagen area who were referred for coronary angiography from 1991 through 1993.^16,17 All patients were evaluated by experienced cardiologists at Rigshospitalet, National University Hospital, Copenhagen. Among these, 948 patients (248 women and 700 men) had ischemic heart disease with characteristic symptoms of stable angina according to the guidelines of the European Society of Cardiology¹⁹ on the basis of the location, character, and duration of pain and the relation of pain to exercise, plus at least one of the following: severe stenosis on coronary angiography (70 percent stenosis of at least one coronary artery or 50 percent stenosis of the left main coronary artery), a previous myocardial infarction, or a positive exercise electrocardiography test.

Thirty-six apparently unrelated patients (4 women and 32 men) with a clinical diagnosis of familial hypercholesterolemia were selected from a larger population of patients attending the lipid clinic at Rigshospitalet. The diagnosis was based on the following criteria: a plasma total cholesterol level above 309 mg per deciliter (8.0 mmol per liter) and a plasma LDL cholesterol level above 232 mg per deciliter (6.0 mmol per liter), tendinous xanthomas in the patient or a first-degree relative, and a history of hypercholesterolemia, ischemic heart disease, or both in a first-degree relative before the age of 60 years.

In all groups, more than 99 percent were white and nearly 99 percent were of Danish descent. All the participants gave informed consent. The studies were approved by the relevant ethics committees.

DNA Analyses

The Arg3500Gln and Arg3531Cys mutations are caused by the substitution of adenine for guanine at position 10,699 of complementary DNA²⁰ and thymine for cytosine at position 10,791, respectively, in exon 26 of the APOB gene.^7,8 The presence of either mutation was determined in pooled samples²¹ by the polymerase chain reaction (PCR): there was a common band of 334 bp and a mutation-specific band of 167 bp in the case of Arg3500Gln and 111 bp in the case of Arg3531Cys.

Three primers were used in the PCR for the detection of Arg3500Gln (5'GACCACAAGCTTAGCTTGG3', 1 µmol per liter; 5'GGGTGGCTTTGCTTGTATG3', 0.025 µmol per liter; and 5'TGCAGCTTCACTGAACACT3', 1 µmol per liter) and Arg3531Cys (5'GACCACAAGCTTAGCTTGG3', 0.025 µmol per liter; 5'GGGTGGCTTTGCTTGTATG3', 1 µmol per liter; and 5'GAGAAGCCACACTCAAAT3', 1 µmol per liter); mutations in allele-specific primers are printed in italic, and mismatches in primers are underlined. Annealing temperatures for the two procedures were 48°C and 55°C, respectively, and all reactions were performed in a total volume of 50 µl, with the concentrations of primers as indicated, 1 U of Taq polymerase, 200 µmol of each deoxynucleoside triphosphate per liter, 1.5 mmol of magnesium chloride per liter, 1x buffer (200 mM TRIS–hydrochloride, pH 8.4, and 500 mM potassium chloride), and 0.1 to 0.2 µg of DNA. When a mutation was identified in a pooled sample, DNA from each of the 20 subjects in the sample was again subjected to PCR, followed by digestion with MspI²² or NsiI, to confirm the diagnosis and to determine zygosity. The Arg3500Trp mutation is caused by the substitution of thymine for cytosine at position 10,698²⁰ in exon 26 of the APOB gene.⁹ Two primers were used in the PCR (5'GTGTCAGTGGCAAAAACCACA3', 1 µmol per liter; and 5'CAGAGGGAATATATGCGTTGG3', 1 µmol per liter), and the annealing temperature was 57°C. The other reagents and conditions of the PCR were as described above. All patients with familial hypercholesterolemia or ischemic heart disease, as well as the 2021 subjects from the general population who had plasma cholesterol and apolipoprotein B levels above the 70th percentile for age and sex, were screened for the Arg3500Trp mutation. PCR, followed by digestion with Hsp92II, revealed common bands of 108 bp and 314 bp and a mutation-specific band of 206 bp.

Other Analyses

Colorimetric and turbidimetric assays were used to measure plasma levels of total cholesterol, high-density lipoprotein (HDL) cholesterol, triglycerides, and apolipoproteins B and AI (all Boehringer Mannheim, Mannheim, Germany) and lipoprotein(a) (DAKO, Glostrup, Denmark); LDL cholesterol levels were calculated with the equation of Friedewald et al.²³

Statistical Analysis

Prevalence estimates of the three mutations were expressed as percentages with exact binomial 95 percent confidence intervals.²⁴ Remaining data were analyzed with the SPSS program.²⁵ To examine the effect of the Arg3500Gln and Arg3531Cys mutations on the phenotype in carriers identified in the general population, we converted values for continuous variables for carriers to their respective percentiles¹¹ and compared them with the values for the general population as a whole, using z-scores, as described previously.^21,26 In the general-population sample, phenotypes of subjects who were heterozygous for either Arg3500Gln or Arg3531Cys were compared by the Mann–Whitney U test with an exact two-tailed probability. Categorical variables were compared by Fisher's exact test. We calculated the absolute increase in a given variable in heterozygotes by subtracting the 50th percentile value for age and sex in the general population from the value for the individual subject; the median increases or decreases were compared by the Mann–Whitney U test with an exact two-tailed probability. The ability of the presence of the mutations to predict ischemic heart disease and familial hypercholesterolemia was expressed as an odds ratio with approximated 95 percent confidence intervals; Fisher's exact test was used as the test of independence. All P values were two-sided. A P value of less than 0.05 was considered to indicate statistical significance.

Results

Frequencies of APOB Mutations

The Arg3500Gln and Arg3531Cys mutations were each identified in 7 of the 9255 subjects in the general population (carrier frequency, 0.08 percent). All 14 subjects were heterozygous for the mutations. Five patients with ischemic heart disease and two patients with familial hypercholesterolemia were heterozygous for the Arg3500Gln mutation, and one patient with ischemic heart disease was heterozygous for the Arg3531Cys mutation. The Arg3500Trp mutation was not identified among the 2021 subjects with hypercholesterolemia in the general population, the 948 patients with ischemic heart disease, or the 36 patients with familial hypercholesterolemia.

Phenotypic Characteristics of Heterozygous Carriers of APOB Mutations in the General Population

The characteristics of the 22 heterozygous carriers of Arg3500Gln or Arg3531Cys are shown in Table 1. Figure 1 shows the age-adjusted and sex-adjusted percentiles of lipid, lipoprotein, and apolipoprotein values for heterozygous subjects in the general population. Subjects who were heterozygous for Arg3500Gln had significantly higher plasma cholesterol levels (mean percentile, 93rd; 95 percent confidence interval, 84th to 100th), LDL cholesterol levels (mean percentile, 95th; 95 percent confidence interval, 89th to 100th), and apolipoprotein B levels (mean percentile, 95th; 95 percent confidence interval, 88th to 100th) than either the general population as a whole (P<0.001 for all comparisons) or carriers of the Arg3531Cys mutation (P=0.001, P=0.001, and P=0.003, respectively). Although the percentiles for HDL cholesterol (P=0.09) and apolipoprotein AI (P=0.10) tended to be lower among Arg3500Gln heterozygotes than in the general population, the percentiles for triglycerides, lipoprotein(a), and age (Figure 1) as well as the mean fibrinogen levels, glucose levels, body-mass index, and ratio of waist to hip circumference (data not shown) in this group were not significantly different from values in the general population.

View this table: [in this window] [in a new window]   Table 1. Characteristics of the Subjects Who Were Heterozygous for Arg3500Gln or Arg3531Cys.

 

View larger version (13K): [in this window] [in a new window]   Figure 1. Mean Percentiles for Plasma Lipids, Lipoproteins, Apolipoproteins, and Age in Heterozygous Carriers of Arg3500Gln or Arg3531Cys in the General Population. Mean values and 95 percent confidence intervals are given relative to age-matched and sex-matched subjects (for lipids, lipoproteins, and apolipoproteins) or sex-matched subjects (for age) in the total general-population sample. Comparisons of heterozygous carriers of either mutation with the total sample were made with the z-test.21,26 Comparisons between carriers were made with the Mann–Whitney U test. LDL denotes low-density lipoprotein, and HDL high-density lipoprotein.

 
Subjects from the general population who were heterozygous for the Arg3500Gln mutation had a significantly increased frequency of ischemic heart disease (odds ratio, 13; 95 percent confidence interval, 3 to 56; P=0.005), hypertension (odds ratio, 10; 95 percent confidence interval, 2 to 51; P=0.005), and peripheral arterial disease (odds ratio, 10; 95 percent confidence interval, 2 to 43; P=0.01) as compared with noncarriers in the general population, whereas sex distribution, smoking habits, frequencies of xanthelasma and arcus corneae, diabetes mellitus, and ischemic stroke were similar in the two groups (data not shown).

There were no significant differences in any of the above-mentioned variables, continuous or categorical, between carriers of Arg3531Cys in the general population sample and noncarriers (Figure 1, Table 1, and data not shown).

Phenotypic Characteristics of Heterozygous Carriers of APOB Mutations in the General Population and of the Patients

Heterozygous carriers of the Arg3500Gln mutation in the general population had higher median plasma cholesterol, LDL cholesterol, and apolipoprotein B levels, by 100 mg per deciliter (2.6 mmol per liter), 82 mg per deciliter (2.1 mmol per liter), and 43 mg per deciliter, respectively, than mutation noncarriers of the same age and sex (Table 2). Median plasma cholesterol levels were even higher in patients with ischemic heart disease or familial hypercholesterolemia who had the mutation than in carriers in the general population (P=0.03). A similar trend was observed for LDL cholesterol levels (P=0.16).

View this table: [in this window] [in a new window]   Table 2. Effect of the Arg3500Gln and Arg3531Cys Mutations on Cholesterol, LDL Cholesterol, and Apolipoprotein B Levels in Heterozygous Carriers.

 
There was no such increase in plasma cholesterol, LDL cholesterol, or apolipoprotein B levels in carriers of Arg3531Cys in the general population (Table 2). However, the one patient with ischemic heart disease with this mutation had increases in plasma cholesterol and LDL cholesterol that were similar to those of carriers of Arg3500Gln.

APOB Mutations and the Risk of Ischemic Heart Disease and Familial Hypercholesterolemia

The Arg3500Gln mutation was significantly more frequent among patients with ischemic heart disease than in the general population (odds ratio, 7.0; 95 percent confidence interval, 2.2 to 22; P=0.003) (Table 3) and, as mentioned above, was also significantly more common among patients with ischemic heart disease in the general-population sample than in those without ischemic heart disease in the general population. The odds ratio for familial hypercholesterolemia for the same mutation was also significant (odds ratio, 78; 95 percent confidence interval, 16 to 388; P=0.001) (Table 3).

View this table: [in this window] [in a new window]   Table 3. Frequencies of and Odds Ratios for Ischemic Heart Disease and Familial Hypercholesterolemia among Subjects Heterozygous for Arg3500Gln, Arg3500Trp, or Arg3531Cys.

 
The Arg3531Cys mutation was not more frequent among patients with ischemic heart disease than in the general population sample (odds ratio, 1.4; 95 percent confidence interval, 0.2 to 11; P=0.54) (Table 3) and was not identified among subjects with ischemic heart disease in the general-population sample or among patients with familial hypercholesterolemia.

Discussion

Among Danes, as among most other white populations, the frequency of clinically diagnosed heterozygous familial hypercholesterolemia is about 0.2 percent.^6,27 Approximately 6 percent of patients with clinical familial hypercholesterolemia are carriers of the Arg3500Gln mutation (Table 3),¹¹ which is responsible for familial defective apolipoprotein B-100,¹⁰ whereas the rest have different LDL-receptor mutations.⁶ Our data indicate that Arg3500Gln occurs at a frequency of 0.08 percent (approximately 1 in 1000) in a general population of whites, and is associated with considerably higher than normal plasma cholesterol levels (by 100 mg per deciliter), and an increased risk of ischemic heart disease (odds ratio, 7.0). In contrast, the Arg3531Cys mutation, which is just as common, is not in itself associated with hypercholesterolemia or an increased risk of ischemic heart disease.

Arg3500Gln

The frequency of Arg3500Gln was slightly lower in our study than in studies of patients with familial hypercholesterolemia or type IIa hyperlipidemia.^11,13 In probands in the general population sample, the average effect of this substitution on plasma cholesterol and LDL cholesterol levels after correction for the effect of age and sex was substantial: the respective levels were 100 and 82 mg per deciliter higher than in the general population. These values were similar to those reported in carriers identified among patients with moderate hypercholesterolemia from the United States, Canada, and Austria,²⁸ though lower than the value of 116 mg per deciliter (3 mmol per liter) for both variables reported earlier, which were measured in 135 carriers identified mainly among patients with hypercholesterolemia from eight countries.¹³ This finding is in keeping with further results of our study, which suggest that the effect of this mutation on cholesterol levels was overestimated among patients with ischemic heart disease and familial hypercholesterolemia — most likely reflecting the fact that high cholesterol levels are a risk factor for ischemic heart disease as well as one of the clinical criteria used in the diagnosis of familial hypercholesterolemia. Thus, as a consequence of the study design, carriers identified in a group of patients with ischemic heart disease and familial hypercholesterolemia may have higher cholesterol levels than carriers identified in the general population.

We also found that the risk of ischemic heart disease in carriers of Arg3500Gln was seven times that of subjects in the general population as a whole. This finding was substantiated by the finding of a greatly increased risk of ischemic heart disease in Arg3500Gln carriers (odds ratio, 13), when the frequencies of this mutation in subjects with ischemic heart disease and those without it in the general-population sample were compared. In addition, carriers had an increased risk of peripheral arterial disease (odds ratio, 10) and hypertension (odds ratio, 10) when carriers and noncarriers in the general population were compared. A possible explanation of the increased risk of hypertension in carriers could be the presence of widespread atherosclerosis.

Arg3531Cys

The Arg3531Cys mutation has previously been identified in eight subjects,^8,14,15 six of whom had hypercholesterolemia. However, all eight carriers were identified among either patients with hyperlipidemia who were attending lipid clinics^8,15 or patients with coronary artery disease¹⁴; therefore, the presence of hyperlipidemia could be a consequence of the study design. In support of this theory is the fact that there was an absence of simple cosegregation of this mutation with the hypercholesterolemia in two of the studies^8,15; no family data were available in the third study.¹⁴ The one patient in our study who had ischemic heart disease and the Arg3531Cys mutation, a 77-year-old man, was the only one of eight carriers who also had hypercholesterolemia. He did not have a family history of either hypercholesterolemia or premature ischemic heart disease. It therefore seems likely that this patient may have had another cause of hypercholesterolemia. Taken together, the absence of simple cosegregation in families, the absence of a family history in our patient with coronary artery disease, and the complete absence of hypercholesterolemia in any carriers in the general population in our study suggest that this mutation is not sufficient to cause hypercholesterolemia.

Although a previous study suggested a borderline overrepresentation of the Arg3531Cys mutation in patients with coronary artery disease as compared with healthy controls,¹⁵ our results suggest that this mutation, in keeping with the absence of an association with hypercholesterolemia, is also not associated with an increased risk of ischemic heart disease. However, it is possible that this mutation, when present with other factors such as hypertension, low HDL cholesterol levels, the apolipoprotein E 4 allele, and hypertriglyceridemia or factors affecting the binding of apolipoprotein B to the LDL receptor, slightly increases susceptibility to hypercholesterolemia and ischemic heart disease.

Arg3500Trp

The Arg3500Trp mutation has been identified in 2 of 907 subjects with hyperlipidemia who were attending a lipid clinic.⁹ We did not identify this mutation among 36 patients with familial hypercholesterolemia, 948 patients with ischemic heart disease, or 2021 subjects in the general population with cholesterol and apolipoprotein B levels above the 70th percentile for age and sex. This implies that in Denmark this mutation is not a common cause of either hypercholesterolemia or ischemic heart disease.

A potential limitation of our study was that all the subjects from the general population were 20 years of age or older; any effect of the mutations on early mortality would therefore bias the results toward a lower prevalence of a given mutation and thus perhaps lead to an underestimate of the odds ratio for ischemic heart disease. Such an effect does not seem very likely for the Arg3500Gln mutation, since the frequency of 0.08 percent in this study is very similar to the frequency of 5 in 5000 reported in Danish newborns.²⁹ Given that the other two mutations studied have a similar⁹ or much less severe^8,14 effect on apolipoprotein B dysfunction in vitro than the Arg3500Gln mutation and that neither segregates with cholesterol levels in families, an effect on early mortality of these mutations seems very unlikely.

In most white populations, the estimated frequency of Arg3500Gln ranges from 1 in 500 to 1 in 1000 and has been associated with hypercholesterolemia in studies both in vitro and in vivo.^11,13 The generalizability of our data on Arg3531Cys and Arg3500Trp to other white populations is not completely clear. The available data suggest that the frequency of Arg3531Cys is similar to that in the general population in our study and that this mutation is not associated with hypercholesterolemia, whereas Arg3500Trp is probably very rare and also not associated with hypercholesterolemia.^{8,9,11,14,15,30}

Most studies searching for new mutations in the APOB gene potentially associated with hypercholesterolemia have concentrated on screening the presumed receptor-binding region^8,9,14,15,30 in patients with hyperlipidemia and have used either reduced binding to the LDL receptor or other in vitro measures of apolipoprotein B dysfunction as an indicator of probable hypercholesterolemia in vivo. With the use of these methods only three such rare mutations have been identified, and these are the ones we studied. It is possible that mutations contributing to defective binding of apolipoprotein B may lie elsewhere in the gene or that there are common genetic variations in APOB that have only relatively small effects on cholesterol levels and are not detectable by these methods.

In conclusion, our results suggest that the Arg3500Gln mutation is at present the only known APOB mutation worth screening for in white patients with hypercholesterolemia or ischemic heart disease and their relatives.

Supported by the Danish Heart Foundation and by Chief Physician Johan Boserup and Lise Boserup's Fund.

Source Information

From the Department of Clinical Biochemistry, Herlev University Hospital, University of Copenhagen, Herlev (A.T.-H., B.G.N.); and the Department of Medicine B, Division of Cardiology (R.S., H.M.), and the Copenhagen City Heart Study (A.T.-H., P.S., B.G.N.), Rigshospitalet, National University Hospital, University of Copenhagen, Copenhagen — both in Denmark.

Address reprint requests to Dr. Tybjærg-Hansen at the Department of Clinical Biochemistry 54M1, Herlev University Hospital, Herlev Ringvej 75, DK-2730 Herlev, Denmark.

References

1. Carleton RA, Dwyer J, Finberg L, et al. Report of the Expert Panel on Population Strategies for Blood Cholesterol Reduction: a statement from the National Cholesterol Education Program, National Heart, Lung, and Blood Institute, National Institutes of Health. Circulation 1991;83:2154-2232. [Free Full Text]
2. Pyörälä K, De Backer G, Graham I, Poole-Wilson P, Wood D. Prevention of coronary heart disease in clinical practice: recommendations of the Task Force of the European Society of Cardiology, European Atherosclerosis Society and European Society of Hypertension. Eur Heart J 1994;15:1300-1331. [Free Full Text]
3. Scandinavian Simvastatin Survival Study Group. Randomised trial of cholesterol lowering in 4444 patients with coronary heart disease: the Scandinavian Simvastatin Survival Study (4S). Lancet 1994;344:1383-1389. [CrossRef][Medline]
4. Shepherd J, Cobbe SM, Ford I, et al. Prevention of coronary heart disease with pravastatin in men with hypercholesterolemia. N Engl J Med 1995;333:1301-1307. [Free Full Text]
5. Sacks FM, Pfeffer MA, Moye LA, et al. The effect of pravastatin on coronary events after myocardial infarction in patients with average cholesterol levels. N Engl J Med 1996;335:1001-1009. [Free Full Text]
6. Goldstein JL, Hobbs HH, Brown MS. Familial hypercholesterolemia. In: Scriver CR, Beaudet AL, Sly WS, Valle D, eds. The metabolic and molecular bases of inherited disease. 7th ed. Vol. 2. New York: McGraw-Hill, 1995:1981-2030.
7. Soria LF, Ludwig EH, Clarke HRG, Vega GL, Grundy SM, McCarthy BJ. Association between a specific apolipoprotein B mutation and familial defective apolipoprotein B-100. Proc Natl Acad Sci U S A 1989;86:587-591. [Free Full Text]
8. Pullinger CR, Hennessy LK, Chatterton JE, et al. Familial ligand-defective apolipoprotein B: identification of a new mutation that decreases LDL receptor binding affinity. J Clin Invest 1995;95:1225-1234.
9. Gaffney D, Reid JM, Cameron IM, et al. Independent mutations at codon 3500 of the apolipoprotein B gene are associated with hyperlipidemia. Arterioscler Thromb Vasc Biol 1995;15:1025-1029. [Free Full Text]
10. Innerarity TL, Weisgraber KH, Arnold KS, et al. Familial defective apolipoprotein B-100: low density lipoproteins with abnormal receptor binding. Proc Natl Acad Sci U S A 1987;84:6919-6923. [Free Full Text]
11. Tybjærg-Hansen A, Humphries SE. Familial defective apolipoprotein B-100: a single mutation that causes hypercholesterolemia and premature coronary artery disease. Atherosclerosis 1992;96:91-107. [CrossRef][Medline]
12. Myant NB. Familial defective apolipoprotein B-100: a review, including some comparisons with familial hypercholesterolaemia. Atherosclerosis 1993;104:1-18. [CrossRef][Medline]
13. Tybjærg-Hansen A. Rare and common mutations in hyperlipidemia and atherosclerosis: with special reference to familial defective apolipoprotein B-100. Scand J Clin Lab Invest Suppl 1995;220:57-76. [Medline]
14. Ludwig EH, Hopkins PN, Allen A, et al. Association of genetic variations in apolipoprotein B with hypercholesterolemia, coronary artery disease, and receptor binding of low density lipoproteins. J Lipid Res 1997;38:1361-1373. [Abstract]
15. Wenham PR, Henderson BG, Penney MD, Ashby JP, Rae PWH, Walker SW. Familial ligand-defective apolipoprotein B-100: detection, biochemical features and haplotype analysis of the R3531C mutation in the UK. Atherosclerosis 1997;129:185-192. [CrossRef][Medline]
16. Wittrup HH, Tybjærg-Hansen A, Abildgaard S, Steffensen R, Schnohr P, Nordestgaard BG. A common substitution (Asn291Ser) in lipoprotein lipase is associated with increased risk of ischemic heart disease. J Clin Invest 1997;99:1606-1613. [Medline]
17. Agerholm-Larsen B, Nordestgaard BG, Steffensen R, Sørensen TIA, Jensen G, Tybjærg-Hansen A. ACE gene polymorphism: ischemic heart disease and longevity in 10,150 individuals: a case-referent and retrospective cohort study based on the Copenhagen City Heart Study. Circulation 1997;95:2358-2367. [Free Full Text]
18. Tybjærg-Hansen A, Agerholm-Larsen B, Humphries SE, Abild-gaard S, Schnohr P, Nordestgaard BG. A common mutation (G_-455A) in the -fibrinogen promoter is an independent predictor of plasma fibrinogen, but not of ischemic heart disease: a study of 9,127 individuals based on the Copenhagen City Heart Study. J Clin Invest 1997;99:3034-3039. [Medline]
19. Management of stable angina pectoris: recommendations of the Task Force of the European Society of Cardiology. Eur Heart J 1997;18:394-413. [Free Full Text]
20. Cladaras C, Hadzopoulou-Cladaras M, Nolte RT, Atkinson D, Zannis VI. The complete sequence and structural analysis of human apolipoprotein B-100: relationship between apoB-100 and apoB-48 forms. EMBO J 1986;5:3495-3507. [Medline]
21. Nordestgaard BG, Abildgaard S, Wittrup HH, Steffensen R, Jensen G, Tybjærg-Hansen A. Heterozygous lipoprotein lipase deficiency: frequency in the general population, effect on plasma lipid levels, and risk of ischemic heart disease. Circulation 1997;96:1737-1744. [Free Full Text]
22. Hansen PS, Rüdiger N, Tybjærg-Hansen A, Færgeman O, Greger-sen N. Detection of the apoB-3500 mutation (glutamine for arginine) by gene amplification and cleavage with MspI. J Lipid Res 1991;32:1229-1233. [Abstract]
23. Friedewald WT, Levy RI, Fredrickson DS. Estimation of the concentration of low-density lipoprotein cholesterol in plasma, without use of the preparative ultracentrifuge. Clin Chem 1972;18:499-502. [Abstract]
24. StatMate, version 1.0. San Diego, Calif.: GraphPad Software, 1995.
25. SPSS base 7.0 for Windows user's guide. Chicago: SPSS, 1996.
26. Armitage P, Berry G. Statistical methods in medical research. 2nd ed. Oxford, England: Blackwell Scientific, 1987:67-72, 506-7.
27. Andersen GE, Lous P, Friis-Hansen B. Screening for hyperlipoproteinemia in 10,000 Danish newborns: follow-up studies in 522 children with elevated cord serum VLDL-LDL-cholesterol. Acta Paediatr Scand 1979;68:541-545. [Medline]
28. Innerarity TL, Mahley RW, Weisgraber KH, et al. Familial defective apolipoprotein B-100: a mutation of apolipoprotein B that causes hypercholesterolemia. J Lipid Res 1990;31:1337-1349. [Abstract]
29. Hansen PS, Nørgaard-Petersen B, Meinertz H, et al. Incidence of the apolipoprotein B-3500 mutation in Denmark. Clin Chim Acta 1994;230:101-104. [CrossRef][Medline]
30. Talmud PJ, Tamplin OJ, Heath K, Gaffney D, Day INM, Humphries SE. Rapid testing for three mutations causing familial defective apolipoprotein B100 in 562 patients with familial hypercholesterolaemia. Atherosclerosis 1996;125:135-137. [CrossRef][Medline]

Abstract PDF Letters Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited PubMed Citation

Related Letters:

Association of Mutations in the Apolipoprotein B Gene with Hypercholesterolemia and the Risk of Ischemic Heart Disease
Gaffney D., Pullinger C., Kane J., Schaefer J. R., Herzum M., Maisch B., Tybjærg-Hansen A., Nordestgaard B. G.
Extract | Full Text  
N Engl J Med 1998; 339:1640-1642, Nov 26, 1998. Correspondence

This article has been cited by other articles:

• Lambrinoudaki, I., Kaparos, G., Papadimitriou, D., Sergentanis, T. N, Creatsa, M., Alexandrou, A., Logothetis, E., Christodoulakos, G., Kouskouni, E (2008). Methylenetetrahydrofolate reductase C677T polymorphism is associated with central adiposity and increased androgenicity in healthy postmenopausal women. Eur J Endocrinol 159: 233-241 [Abstract] [Full Text]  
• Frikke-Schmidt, R., Nordestgaard, B. G., Stene, M. C. A., Sethi, A. A., Remaley, A. T., Schnohr, P., Grande, P., Tybjaerg-Hansen, A. (2008). Association of Loss-of-Function Mutations in the ABCA1 Gene With High-Density Lipoprotein Cholesterol Levels and Risk of Ischemic Heart Disease. JAMA 299: 2524-2532 [Abstract] [Full Text]  
• Benn, M., Stene, M. C. A., Nordestgaard, B. G., Jensen, G. B., Steffensen, R., Tybjaerg-Hansen, A. (2008). Common and Rare Alleles in Apolipoprotein B Contribute to Plasma Levels of Low-Density Lipoprotein Cholesterol in the General Population. J. Clin. Endocrinol. Metab. 93: 1038-1045 [Abstract] [Full Text]  
• Benn, M., Nordestgaard, B. G., Jensen, G. B., Tybjaerg-Hansen, A. (2007). Improving Prediction of Ischemic Cardiovascular Disease in the General Population Using Apolipoprotein B: The Copenhagen City Heart Study. Arterioscler. Thromb. Vasc. Bio. 27: 661-670 [Abstract] [Full Text]  
• Smith, G. D., Gwinn, M., Ebrahim, S., Palmer, L. J, Khoury, M. J (2006). Make it HuGE: human genome epidemiology reviews, population health, and the IJE. Int J Epidemiol 35: 507-510 [Full Text]  
• Smith, G. D. (2006). Randomised by (your) god: robust inference from an observational study design. J. Epidemiol. Community Health 60: 382-388 [Full Text]  
• Wittrup, H. H., Andersen, R. V., Tybjaerg-Hansen, A., Jensen, G. B., Nordestgaard, B. G. (2006). Combined Analysis of Six Lipoprotein Lipase Genetic Variants on Triglycerides, High-Density Lipoprotein, and Ischemic Heart Disease: Cross-Sectional, Prospective, and Case-Control Studies from the Copenhagen City Heart Study. J. Clin. Endocrinol. Metab. 91: 1438-1445 [Abstract] [Full Text]  
• Benn, M., Nordestgaard, B. G., Jensen, J. S., Grande, P., Sillesen, H., Tybjaerg-Hansen, A. (2005). Polymorphism in APOB Associated with Increased Low-Density Lipoprotein Levels in Both Genders in the General Population. J. Clin. Endocrinol. Metab. 90: 5797-5803 [Abstract] [Full Text]  
• Benn, M., Nordestgaard, B. G., Jensen, J. S., Nilausen, K., Meinertz, H., Tybjaerg-Hansen, A. (2005). Mutation in Apolipoprotein B Associated with Hypobetalipoproteinemia Despite Decreased Binding to the Low Density Lipoprotein Receptor. J. Biol. Chem. 280: 21052-21060 [Abstract] [Full Text]  
• Crooke, R. M., Graham, M. J., Lemonidis, K. M., Whipple, C. P., Koo, S., Perera, R. J. (2005). An apolipoprotein B antisense oligonucleotide lowers LDL cholesterol in hyperlipidemic mice without causing hepatic steatosis. J. Lipid Res. 46: 872-884 [Abstract] [Full Text]  
• Tybjaerg-Hansen, A., Jensen, H. K., Benn, M., Steffensen, R., Jensen, G., Nordestgaard, B. G. (2005). Phenotype of Heterozygotes for Low-Density Lipoprotein Receptor Mutations Identified in Different Background Populations. Arterioscler. Thromb. Vasc. Bio. 25: 211-215 [Abstract] [Full Text]  
• Keavney, B., Palmer, A., Parish, S., Clark, S., Youngman, L., Danesh, J., McKenzie, C., Delepine, M., Lathrop, M., Peto, R., Collins, R., for the International Studies of Infarct Survival, (2004). Lipid-related genes and myocardial infarction in 4685 cases and 3460 controls: discrepancies between genotype, blood lipid concentrations, and coronary disease risk. Int J Epidemiol 33: 1002-1013 [Abstract] [Full Text]  
• Austin, M. A., Hutter, C. M., Zimmern, R. L., Humphries, S. E. (2004). Genetic Causes of Monogenic Heterozygous Familial Hypercholesterolemia: A HuGE Prevalence Review. Am J Epidemiol 160: 407-420 [Abstract] [Full Text]  
• Austin, M. A., Hutter, C. M., Zimmern, R. L., Humphries, S. E. (2004). Familial Hypercholesterolemia and Coronary Heart Disease: A HuGE Association Review. Am J Epidemiol 160: 421-429 [Abstract] [Full Text]  
• Smith, G. D., Ebrahim, S. (2004). Mendelian randomization: prospects, potentials, and limitations. Int J Epidemiol 33: 30-42 [Full Text]  
• Bojesen, S. E., Juul, K., Schnohr, P., Tybjaerg-Hansen, A., Nordestgaard, B.o. G. (2003). Platelet glycoprotein IIb/IIIa PlA2/PlA2 homozygosity associated with risk of ischemic cardiovascular disease and myocardial infarction in young men: The Copenhagen City Heart Study. J Am Coll Cardiol 42: 661-667 [Abstract] [Full Text]  
• Sethi, A. A., Nordestgaard, B. G., Gronholdt, M.-L. M., Steffensen, R., Jensen, G., Tybjaerg-Hansen, A. (2003). Angiotensinogen Single Nucleotide Polymorphisms, Elevated Blood Pressure, and Risk of Cardiovascular Disease. Hypertension 41: 1202-1211 [Abstract] [Full Text]  
• Day, I. N M, Wilson, D. I (2001). Science, medicine, and the future: Genetics and cardiovascular risk. BMJ 323: 1409-1412 [Full Text]  
• Francke, S., Manraj, M., Lacquemant, C., Lecoeur, C., Lepretre, F., Passa, P., Hebe, A., Corset, L., Yan, S. L. K., Lahmidi, S., Jankee, S., Gunness, T. K., Ramjuttun, U. S., Balgobin, V., Dina, C., Froguel, P. (2001). A genome-wide scan for coronary heart disease suggests in Indo-Mauritians a susceptibility locus on chromosome 16p13 and replicates linkage with the metabolic syndrome on 3q27. Hum Mol Genet 10: 2751-2765 [Abstract] [Full Text]  
• DAHL, M., TYBJOERG-HANSEN, A., VESTBO, J., LANGE, P., NORDESTGAARD, B. G. (2001). Elevated Plasma Fibrinogen Associated with Reduced Pulmonary Function and Increased Risk of Chronic Obstructive Pulmonary Disease. Am. J. Respir. Crit. Care Med. 164: 1008-1011 [Abstract] [Full Text]  
• Day, I. N., Gu, D., Ganderton, R. H, Spanakis, E., Ye, S. (2001). Epidemiology and the genetic basis of disease. Int J Epidemiol 30: 661-667 [Full Text]  
• Horvath, A., Savov, A., Kirov, S., Karshelova, E., Paskaleva, I., Goudev, A., Ganev, V. (2001). High frequency of the ApoB-100 R3500Q mutation in Bulgarian hypercholesterolaemic subjects. J. Med. Genet. 38: 536-540 [Full Text]  
• Sethi, A. A., Tybjaerg-Hansen, A., Gronholdt, M.-L. M., Steffensen, R., Schnohr, P., Nordestgaard, B. G. (2001). Angiotensinogen Mutations and Risk for Ischemic Heart Disease, Myocardial Infarction, and Ischemic Cerebrovascular Disease: Six Case-Control Studies from the Copenhagen City Heart Study. ANN INTERN MED 134: 941-954 [Abstract] [Full Text]  
• Sethi, A. A., Nordestgaard, B. G., Agerholm-Larsen, B., Frandsen, E., Jensen, G., Tybjarg-Hansen, A. (2001). Angiotensinogen Polymorphisms and Elevated Blood Pressure in the General Population : The Copenhagen City Heart Study. Hypertension 37: 875-881 [Abstract] [Full Text]  
• Frikke-Schmidt, R., Nordestgaard, B.G., Thudium, D., Moes Gronholdt, M.-L., Tybjarg-Hansen, A. (2001). APOE genotype predicts AD and other dementia but not ischemic cerebrovascular disease. Neurology 56: 194-200 [Abstract] [Full Text]  
• Dahl, M., Nordestgaard, B. G., Lange, P., Vestbo, J., Tybjarg-Hansen, A. (2001). Molecular Diagnosis of Intermediate and Severe {{alpha}}1-Antitrypsin Deficiency: MZ Individuals with Chronic Obstructive Pulmonary Disease May Have Lower Lung Function Than MM Individuals. Clin. Chem. 47: 56-62 [Abstract] [Full Text]  
• Agerholm-Larsen, B., Tybjarg-Hansen, A., Schnohr, P., Steffensen, R., Nordestgaard, B. G. (2000). Common Cholesteryl Ester Transfer Protein Mutations, Decreased HDL Cholesterol, and Possible Decreased Risk of Ischemic Heart Disease : The Copenhagen City Heart Study. Circulation 102: 2197-2203 [Abstract] [Full Text]  
• Pietzsch, J., Lattke, P., Julius, U. (2000). Oxidation of Apolipoprotein B-100 in Circulating LDL Is Related to LDL Residence Time : In Vivo Insights From Stable-Isotope Studies. Arterioscler. Thromb. Vasc. Bio. 20 : e63-e67 [Abstract] [Full Text]  
• Rabes, J.-P., Varret, M., Devillers, M., Aegerter, P., Villeger, L., Krempf, M., Junien, C., Catherine Boileau, (2000). R3531C Mutation in the Apolipoprotein B Gene Is Not Sufficient to Cause Hypercholesterolemia. Arterioscler. Thromb. Vasc. Bio. 20 : e76-e82 [Abstract] [Full Text]  
• Agerholm-Larsen, B., Nordestgaard, B. G., Steffensen, R., Jensen, G., Tybjarg-Hansen, A. (2000). Elevated HDL Cholesterol Is a Risk Factor for Ischemic Heart Disease in White Women When Caused by a Common Mutation in the Cholesteryl Ester Transfer Protein Gene. Circulation 101: 1907-1912 [Abstract] [Full Text]  
• Frikke-Schmidt, R., Tybjaerg-Hansen, A., Steffensen, R., Jensen, G., Nordestgaard, B.o. G. (2000). Apolipoprotein E genotype: epsilon32 women are protected while epsilon43 and epsilon44 men are susceptible to ischemic heart disease: The Copenhagen City Heart Study. J Am Coll Cardiol 35: 1192-1199 [Abstract] [Full Text]  
• Raungaard, B., Heath, F., Hansen, P. S., Brorholt-Petersen, J. U., Jensen, H. K., Fargeman, O. (2000). Flow Cytometric Assessment of LDL Ligand Function for Detection of Heterozygous Familial Defective Apolipoprotein B-100. Clin. Chem. 46: 224-233 [Abstract] [Full Text]  
• von Ahsen, N., Oellerich, M., Armstrong, V. W., Schutz, E. (1999). Application of a Thermodynamic Nearest-Neighbor Model to Estimate Nucleic Acid Stability and Optimize Probe Design: Prediction of Melting Points of Multiple Mutations of Apolipoprotein B-3500 and Factor V with a Hybridization Probe Genotyping Assay on the LightCycler. Clin. Chem. 45: 2094-2101 [Abstract] [Full Text]  
• Wittrup, H. H., Tybjærg-Hansen, A., Steffensen, R., Deeb, S. S., Brunzell, J. D., Jensen, G., Nordestgaard, B. G. (1999). Mutations in the lipoprotein lipase Gene Associated With Ischemic Heart Disease in Men : The Copenhagen City Heart Study. Arterioscler. Thromb. Vasc. Bio. 19: 1535-1540 [Abstract] [Full Text]  
• Frossard, P. M., Obineche, E. N., Lestringant, G. G. (1999). Association of an Apolipoprotein B Gene Marker With Essential Hypertension. Hypertension 33: 1052-1056 [Abstract] [Full Text]  
• Pullinger, C. R., Gaffney, D., Gutierrez, M. M., Malloy, M. J., Schumaker, V. N., Packard, C. J., Kane, J. P. (1999). The apolipoprotein B R3531C mutation: characteristics of 24 subjects from 9 kindreds. J. Lipid Res. 40: 318-327 [Abstract] [Full Text]  
• Gaffney, D., Pullinger, C., Kane, J., Schaefer, J. R., Herzum, M., Maisch, B., Tybjarg-Hansen, A., Nordestgaard, B. G. (1998). Association of Mutations in the Apolipoprotein B Gene with Hypercholesterolemia and the Risk of Ischemic Heart Disease. NEJM 339: 1640-1642 [Full Text]  
• (1998). Genetic Mutation Responsible for Elevated Lipid Level. Journal Watch Cardiology 1998: 4-4 [Full Text]