| |||||||||||||||||||||||||||||||
Case Report
A 43-year-old homosexual man who had been cared for at our institution because of HIV infection since September 1985 was negative for hepatitis B virus core antigen and antibody to hepatitis C virus. Serologic tests for Epstein–Barr virus (EBV), toxoplasma, and cytomegalovirus suggested past infection. In September 1988, immune thrombocytopenia developed and zidovudine therapy was started. On October 24, 1989, the patient was still asymptomatic and had a CD4 cell count of 392 per cubic millimeter. On December 10, 1989, he was admitted to the hospital because of a two-week history of fever, arthralgia, and a cervical mass. At admission, his temperature was 39.8°C, and physical examination revealed a large, tender, retromandibular unilateral adenopathy (3 cm by 4 cm). Livedo reticularis was present, but the skin was otherwise normal. The spleen was palpable 6 cm below the left costal margin. The patient reported diffuse arthralgia involving his knees, elbows, and shoulders without arthritis. The hematocrit was 39.6 percent; the white-cell count was 4200 per cubic millimeter, with 58 percent neutrophils and 22 percent lymphocytes. The platelet count was 135,000 per cubic millimeter. The serum aspartate aminotransferase concentration was 11 U per liter, the lactic dehydrogenase concentration was 164 U per liter, and the protein concentration was 6.9 g per deciliter (albumin, 3.5 g per deciliter; globulin, 1.7 g per deciliter). A chest film revealed no abnormalities. A computed tomographic scan of the abdomen revealed enlargement of the liver (diameter, 19 cm) and spleen (16 cm). The patient was unsuccessfully treated with broad-spectrum antibiotics for 17 days.
Four weeks after the symptoms began, fever was still present, the patient had lost 6 kg in weight, and there was progression of the cervical adenopathy to a large subcutaneous mass associated with homolateral adenopathies. The white-cell count had dropped to 2900 per cubic millimeter, and the hematocrit to 23 percent. A biopsy of one small adenopathic node was performed. One week later, a second biopsy of the cervical mass and a bone marrow biopsy were performed. Eight weeks after the symptoms began, a spontaneous regression of the mass and fever was noted and the only finding on physical examination was persistent mild splenomegaly, which resolved during week 10. Six months later, in July 1990, large-B-cell non-Hodgkin's lymphoma localized to the right quadriceps muscle developed. Complete remission was achieved after six cycles of combination chemotherapy. In December 1997, triple-antiretroviral therapy was begun and the patient remained asymptomatic without a relapse of non-Hodgkin's lymphoma or the development of Kaposi's sarcoma (Table 1).
|
Histopathological, Immunohistochemical, and in Situ Hybridization Studies
Tissues from the lymph node and the cervical mass were obtained by surgical biopsy. Sections were stained with hematoxylin and eosin and Giemsa stain for pathological examination. Paraffin-embedded sections were examined for intracytoplasmic immunoglobulins with monoclonal antibodies to kappa and lambda light chains (Zymed, Biosoft, Paris) and polyclonal antibodies to alpha, gamma, and mu heavy chains (Dako, Trappes, France). Immunoperoxidase reactions were performed with commercial kits (Dakopatts, Copenhagen, Denmark). Immunophenotyping was performed on frozen sections to detect the expression of surface immunoglobulins and T-cell antigens CD3, CD4, and CD8 (Becton Dickinson, Le Pont de Claix, France).
Frozen and paraffin-embedded sections were examined for EBV latent membrane protein 1 with CS1, CS2, CS3, and CS4, monoclonal antibodies that recognize this protein. Paraffin-embedded sections were also tested for EBV by in situ hybridization with a probe specific for an EBV-encoded RNA transcript (EBER-1) labeled with fluorescein isothiocyanate, according to the manufacturer's recommendations (Dako).
Amplification and Southern Blotting
Frozen samples from the cervical mass were available for analysis of clonality and molecular detection of HHV-8 DNA sequences with the polymerase chain reaction (PCR). Consensus primers were used for PCR amplification of the variable (V), diversity (D), and joining (J) exons of immunoglobulin and T-cell receptors. For immunoglobulin heavy-chain genes, V–D–J rearrangements were amplified by two sets of PCR, and for T-cell–receptor 
genes, the procedure included three reactions with three mixtures of primers, as previously described.15 PCR products were analyzed by polyacrylamide-gel electrophoresis, with ethidium bromide staining.
To identify HHV-8 sequences, DNA was extracted from the cervical-mass–biopsy specimen with the primer set for KS330233, as described by Chang et al.,1 and subjected to electrophoresis in agarose gel. The PCR products were then transferred to nylon membrane and hybridized with the specific internal oligoprobe 5'GGAACTTGATCTATATACCAC3' and labeled with phosphorus-32.
Serologic Tests for HHV-8
Serum samples obtained 4, 7, and 14 months and 5 weeks before the onset of clinical symptoms and 2 weeks, 8 months, and 7 years after the onset were available for serologic tests. Antibodies to the latent nuclear antigen were measured by immunofluorescence on the BCP-1 cell line as described previously,9,11 except that a serum dilution of 1:50 was used for the initial screening. The latent nuclear protein encoded by open reading frame 73 of HHV-8 is the main component of the latent nuclear antigen,16 and antibodies to a recombinant carboxy-terminal fragment of this protein16 were measured by enzyme-linked immunosorbent assay (ELISA). We also measured antibodies to a recombinant "lytic cycle" protein, encoded by open reading frame 65 and associated with the viral capsid,11 and a control antigen (recombinant dihydrofolate reductase protein, the fusion partner of the two recombinant HHV-8 proteins).11,16 For the ELISA, serum samples were diluted 1:100 and the assay was carried out as previously described.11
Antibodies to lytic structural HHV-8 antigens were also measured by an immunofluorescence assay with a B-cell line (ISI-1) that harbors HHV-8 in the absence of EBV DNA and was established in April 1996 from a primary effusion lymphoma related to the acquired immunodeficiency syndrome (AIDS). Ten million cells were incubated with 3 mM butyrate in 20 ml of RPMI 1640 medium supplemented with 20 percent heat-inactivated fetal-calf serum and antibiotics for 48 hours. The cells were centrifuged at 4000xg twice for 10 minutes, the resulting pellet was gently suspended in phosphate-buffered saline at a final density of 100,000 cells in 2 µl, and droplets were placed on slides. The slides were air-dried and fixed in acetone at 5°C for 15 minutes. For the immunofluorescence assay, serum diluted in phosphate-buffered saline (dilution, 1:10 to 1:500) was incubated with the cell smears for 30 minutes, rinsed three times with phosphate-buffered saline, and stained with fluorescein isothiocyanate–conjugated mouse antihuman IgG at a dilution of 1:100 with Evan's blue counterstain (Sanofi Diagnostics Pasteur, Paris). The smears were examined independently by two persons who had no knowledge of the subjects. Serum from patients with Kaposi's sarcoma and serum from the patient with AIDS and primary effusion lymphoma whose cells had been used to establish the ISI-1 cell line were used as positive controls. The positive controls did not stain nuclei from a T-cell line (MOLT4) without the HHV-8 or EBV genomes or Hep2 cells, a human epidermoid carcinoma cell line used for the detection of antinuclear autoantibodies (data not shown). Serum from healthy blood donors was used as a negative control.
Results
The architecture of the cervical lymph node was still recognizable. The most striking feature was an intense lymphoid and vascular hyperplasia associated with large sheets of plasma cells in the interfollicular area and hypocellular germinal centers. The second biopsy revealed similar lesions associated with foci of Kaposi's sarcoma (Figure 1A, Figure 1B, Figure 1C, and Figure 1D). Bone marrow biopsy disclosed moderate plasmacytosis. Polytypic cytoplasmic immunoglobulins were present in the lymph-node specimen, with the expression of both kappa and lambda light chains, suggesting polyclonal plasmacytosis. T cells were located in both T-cell zones and follicular zones, and the levels of CD4+ and CD8+ T cells were similar. Neither EBV latent membrane protein 1 nor EBV-encoded RNA transcripts were detected in these specimens. PCR analysis of the clonality of the B-cell population revealed a heterogeneous pattern of the immunoglobulin heavy-chain V–D–J sequence, with no individualized band, corresponding to polyclonal B-cell populations. Similarly, PCR analysis of the recombinations of V–J of T-cell–receptor genes showed the polyclonal nature of the T-cell populations (data not shown).
|
|
|
|
HHV-8, a newly identified herpesvirus, is closely associated in HIV-infected patients with three proliferative disorders: Kaposi's sarcoma,1,2,3 primary effusion lymphoma,4 and HIV-associated multicentric Castleman's disease.5 The consistent detection of the virus in these lesions suggests that HHV-8 is necessary in the pathogenic process of these diseases. Although some viral genes are homologues of cellular genes involved in cell proliferation (viral interleukin-6 and G-protein–coupled receptor)17,18 and transformation (viral Bcl-2 and viral cyclin),16,19,20 the direct transforming capacity of this virus remains uncertain.21
Serologic studies have shown that HHV-8 is probably not ubiquitous. A low seroprevalence was found in the general population in the United States and United Kingdom, contrasting with the higher prevalence in Mediterranean and East African populations. Seroconversion has been retrospectively documented in cohorts of homosexual men, and epidemiologic studies have suggested that HHV-8 infection could be sexually transmitted. However, whether primary infection with HHV-8 causes a self-limited disease remains unknown. A few cases of benign lymphadenopathy with germinal-center hyperplasia and increased vascularity in which HHV-8 DNA sequences were detected have been reported in HIV-negative young adults5,7 and HIV-positive young adults.1,7 In these cases, an association with primary HHV-8 infection could not be demonstrated in the absence of serologic data.
In our patient, the sudden onset of a clinical syndrome of fever, arthralgia, cervical lymphadenopathy, and splenomegaly suggested an acute infectious disease. Unusual features were the prolonged duration of the fever, the secondary development of leukopenia and anemia, and the pseudotumoral aspect of the cervical mass. Retrospective analysis of stored serum revealed seroconversion to HHV-8 within the four months preceding the onset of the clinical symptoms. These data support the hypothesis of a recent primary infection with HHV-8. Pathological examination of the cervical mass and lymph nodes revealed angiolymphoid hyperplasia, intense plasmacytosis, and foci of Kaposi's sarcoma. All these features have previously been reported in association with HHV-8 infection in HIV-infected patients.22 However, in our patient, these lesions as well as all clinical symptoms resolved spontaneously within two months and had not recurred after eight years.
In this patient, primary infection with HHV-8 was associated with transient fever, arthralgia, cervical lymphadenopathy, splenomegaly, and cytopenia. However, the severity of the illness was most likely related to the associated HIV infection and is not what might be expected in a primary infection in the absence of HIV infection. The pathological features of the lymph node suggest that HHV-8 can induce vascular hyperplasia and intense activation and proliferation of B cells. The spontaneous resolution of the lesion suggests that persistent dysregulation of cellular cytokines, continued activation of some HHV-8 viral genes, or an oncogenic event is necessary for the development of HHV-8–associated tumors.
We are indebted to Robin Nancel and the Laboratoire Photo Hématologie for photographic assistance.
Source Information
From the Departments of Immunology and Hematology (E.O., J.-P.C.) and Pathology (D.C.-H.) and the Laboratories of Virology (V.B., F.A.) and Molecular Hematology (L.G., F.S.), Hôpital Saint-Louis, Paris; and the Department of Medical Microbiology and Genitourinary Medicine, University of Liverpool, Liverpool, United Kingdom (T.F.S., J.S.).
Address reprint requests to Dr. Oksenhendler at the Service d'Immuno-Hématologie, Hôpital Saint-Louis, 1 Ave. Claude Vellefaux, 75010 Paris, France.
References
| |||||||||||||||||||||||||||||||
This article has been cited by other articles:
HOME | SUBSCRIBE | SEARCH | CURRENT ISSUE | PAST ISSUES | COLLECTIONS | PRIVACY | TERMS OF USE | HELP | beta.nejm.org Comments and questions? Please contact us. The New England Journal of Medicine is owned, published, and copyrighted © 2010 Massachusetts Medical Society. All rights reserved. |
Previous
