FREE NEJM E-TOC    HOME   |   SUBSCRIBE   |   CURRENT ISSUE   |   PAST ISSUES   |   COLLECTIONS   |   Search Term  Advanced Search

Sign in | Get NEJM's E-Mail Table of Contents — Free | Subscribe

Previous Volume 338:1729-1732 June 11, 1998 Number 24 Next

PDF Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited PubMed Citation

Normal pubertal development and fertility depend on the intricate interplay of hypothalamic, pituitary, and gonadal factors. Crucial in this respect are normal secretory patterns of follicle-stimulating hormone and luteinizing hormone. These hormones stimulate the production of estrogen and ovulation in women and the production of testosterone and spermatogenesis in men. Secreted from common gonadotroph cells, the hormones are heterodimers composed of a common -subunit and a specific -subunit, each encoded by a separate gene. Specificity of action depends on the recognition of these hormones by specific receptors on the surface of gonadal cells.

Various genetic defects of the hypothalamic–pituitary–gonadal axis that cause hypogonadism have been identified.¹ At the level of the hypothalamus, secretion of gonadotropin-releasing hormone is disturbed by mutations in the KAL gene,² leading to Kallmann's syndrome, and in the DAX-1 gene,³ causing X-linked adrenal hypoplasia and hypogonadotropic hypogonadism. At the pituitary level, mutations in the gene for the -subunit of luteinizing hormone⁴ cause hypogonadotropic hypogonadism, and at the gonadal level, loss-of-function mutations in the genes that encode the receptors for follicle-stimulating hormone and luteinizing hormone cause hypergonadotropic hypogonadism.^5,6 Specifically, mutations in the gene for luteinizing hormone receptors result in Leydig-cell hypoplasia and undermasculinization in genetic males,^5,7,8 whereas mutations in the gene for follicle-stimulating hormone receptors cause primary gonadal failure and hypergonadotropic hypogonadism in genetic females.⁶

Two female patients with follicle-stimulating hormone deficiency caused by mutations in the gene for the -subunit of follicle-stimulating hormone have been described. One presented with primary amenorrhea and infertility,⁹ and the other with delayed puberty.¹⁰ In this report, we describe a man with impaired secretion of follicle-stimulating hormone caused by a homozygous mutation in the gene for the -subunit of follicle-stimulating hormone, as well as two asymptomatic heterozygous male members of his family.

Methods

Subjects

The proband was referred to our center at the age of 18 years for evaluation of delayed puberty. He reported normal erections and ejaculatory orgasms. He had a prepubertal physique and underdeveloped muscles. He was 178 cm tall (69th percentile) and weighed 59 kg. He had pubic hair (Tanner stage 4), scant axillary hair, and no facial hair. No breast tissue was palpated. The scrotum was thin, and two small, soft testicles (testicular volume, 1 to 2 ml) were palpated. There was no family history of consanguinity, infertility, or delayed puberty.

Laboratory studies revealed low serum testosterone and follicle-stimulating hormone concentrations and high serum luteinizing hormone concentrations (Table 1). Serum thyrotropin, prolactin, and cortisol concentrations were normal. Chromosomal analysis revealed a 46,XY karyotype. After intravenous administration of 100 µg of gonadotropin-releasing hormone, the patient's serum luteinizing hormone concentration increased from 24.5 mIU per milliliter to 66.6, 73.3, 74.5, and 70.2 mIU per milliliter at 15, 30, 45, and 60 minutes, respectively. Serum follicle-stimulating hormone concentrations were less than 0.5 mIU per milliliter before and after the administration of gonadotropin-releasing hormone. Semen analysis on two occasions showed white ejaculates (2.5 and 2.9 ml) with no sperm. Bone age was 16 years, and the findings on magnetic resonance imaging of the brain and pituitary were normal.

View this table: [in this window] [in a new window]   Table 1. Serum Hormone Values in a Man with Follicle-Stimulating Hormone Deficiency Caused by a Mutation in the Gene for the b-Subunit of Follicle-Stimulating Hormone.

 
The proband's 17-year-old brother was 179 cm tall with Tanner stage 5 pubic hair. His testicular volume was 25 ml bilaterally. He had normal libido, with normal erections and ejaculations. His serum follicle-stimulating hormone, luteinizing hormone, and testosterone concentrations were 3.3 mIU per milliliter, 5.7 mIU per milliliter, and 1020 ng per deciliter (35.4 nmol per liter), respectively.

The father, who was 41 years old, had normal libido and sexual function. His pubic hair was Tanner stage 5, and his testicular volume was 25 ml bilaterally. His serum follicle-stimulating hormone, luteinizing hormone, and testosterone concentrations were 3.9 mIU per milliliter, 4.7 mIU per milliliter, and 990 ng per deciliter (34.3 nmol per liter), respectively. The mother's age at menarche was 12.5 years. She had given birth to three children: the brothers described above and a three-year-old girl from a second marriage. She had chronic autoimmune thyroiditis, which was treated with thyroxine.

The study protocol was reviewed and approved by the hospital review committee, and informed consent was obtained from all the subjects.

DNA Analysis

DNA was extracted from peripheral-blood leukocytes by standard methods. All three exons of the gene for the -subunit of follicle-stimulating hormone were amplified by a polymerase-chain-reaction (PCR) assay with the use of primer pairs designed to amplify the exons and the exon–intron junctions on the basis of the gene sequence.¹³ The primers used were FSH-1-F 5'AATTTGAGAAGGTAAAGGAG3' and FSH-1-R 5'GCATAAATTTCCTACACAAC3' for exon 1, FSH-2-F 5'GGCTTCATTGTTTGCTTCC3' and FSH-2-R 5'AAACCCCGGTAATACAGAC3' for exon 2, and FSH-3-F 5'AACTTCCACAATACCATAACC3' and FSH-3-R 5'CAGACTTTTTGAATATCTTGG3' for exon 3. FSH-3-R2 5'ACAGTACAATCAGTGCTGTCG3' was used instead of FSH-3-R for analyses of single-strand conformation polymorphisms and restriction analyses.

The PCR assay was performed with 2.5 mM magnesium chloride, 0.2 mM deoxynucleoside triphosphate, 0.5 µM of each primer, and 1 unit of Taq polymerase (MBI Fermentas, Vilnius, Lithuania) with the manufacturer's buffer. Cycling conditions were as follows: one minute at 94°C, one minute at the annealing temperature, and one minute at 72°C for 30 cycles, followed by five minutes at 72°C. Annealing temperatures were 45°C for the first exon and 55°C or 52°C for the second and third exons. PCR products were purified with the Quiaquick gel-extraction kit (Quiagen, Hilden, Germany), and 3 µg of DNA from three separate PCR reactions (1 µg of DNA from each) were combined and subjected to sequencing with the use of DNA sequencer ABI 310 (Perkin Elmer, Foster City, Calif.) on both strands. Analysis of single-strand conformation polymorphisms was performed as previously described.¹⁴

For restriction analysis, TspRI (New England Biolabs, Beverly, Mass.) was used as recommended by the manufacturer. Products were separated on 4 percent agarose gels (3 percent NuSieve GTG and 1 percent SeaKem LE [FMC Bioproducts, Rockland, Me.]) in parallel with a 1-kb-ladder marker (Boehringer Mannheim, Mannheim, Germany) and visualized by staining with ethidium bromide (Sigma, St. Louis).

Results

No changes in sequence were found in exons 1 and 2 of the patient's gene for the -subunit of follicle-stimulating hormone. Sequencing of exon 3 revealed that the patient was homozygous for a deletion of the second and third nucleotides (thymidine and guanine) in codon 61 (Figure 1A). This mutation would be expected to lead to a frame shift in transcription so that the -subunit of follicle-stimulating hormone would contain the first 60 amino acids of the third exon and 26 amino acids in a frame shift until the stop codon (TGA) was reached; the last 51 amino acids of the -subunit would be missing.

View larger version (50K): [in this window] [in a new window]   Figure 1. Characterization of the Mutation in the Gene for the -Subunit of Follicle-Stimulating Hormone in a Man with Hypogonadism. Sequence analysis of exon 3 of the gene for the -subunit, amplified from the patient's DNA and compared with control DNA (Panel A), revealed a deletion of two base pairs (TG) in codon 61 (arrows). An autoradiograph of single-strand conformation polymorphism (Panel B) shows that the patient's DNA (lane 4) migrated both faster than control DNA (lane 1) and as a single band, indicating homozygosity. DNA from his mother (lane 2), father (lane 3), and brother (lane 5) migrated as two bands, indicating heterozygosity. Panel C shows the results of restriction analysis of exon 3 with TspRI. Uncut DNA (lane 1) migrates as a single band in an ethidium bromide–stained agarose gel. Control DNA (lane 4) is cut into three fragments of 123, 52, and 43 bp because there are two TspRI sites within the gene. The codon 61 TG deletion in the patient's DNA (lane 2) eliminates the TspRI site located 123 bp from the 5' end of the gene, so that the DNA is cut into only two fragments of 175 and 43 bp. Note the heterozygous pattern of the father's DNA (lane 3). Lane 5 contains a 1-kb ladder. The lower five bands are 220, 201, 154, 134, and 75 bp.

 
To verify the source of the mutation, PCR products of exon 3 from the patient, his brother, and his parents were analyzed for single-strand conformation polymorphism. As expected from the sequencing results, the patient's DNA migrated as a single band, indicating homozygosity, whereas DNA from his parents and brother migrated as two bands, indicating heterozygosity (Figure 1B). The deletion of two base pairs in codon 61 was predicted to eliminate one of the two TspRI restriction sites in exon 3. As expected, the amplified PCR fragment of exon 3 from the patient was digested by TspRI into two fragments (Figure 1C).

Discussion

Normal adolescent development begins with an increased amplitude of pulsatile gonadotropin-releasing hormone leading to increased secretion of luteinizing hormone and follicle-stimulating hormone. In men, follicle-stimulating hormone supports the growth and proliferation of seminiferous tubules and spermatogenesis, whereas luteinizing hormone mainly affects the production of testosterone by testicular Leydig cells.

We report a case of secondary hypogonadism associated with an isolated deficiency of follicle-stimulating hormone in a young man. The hormonal deficiency was due to a two-nucleotide deletion in the coding sequence for the -subunit of follicle-stimulating hormone, resulting in a truncated polypeptide lacking the last 51 amino acids at the C-terminal end of the subunit. Layman et al. recently described a teenage girl with delayed puberty, hypogonadism, and isolated follicle-stimulating hormone deficiency due to compound heterozygous mutations in the gene for the -subunit, including the deletion of thymidine and guanine in codon 61, as noted in our patient.¹⁰ In the study by Layman et al., transfection of the patient's -subunit DNA and -subunit DNA resulted in the production of follicle-stimulating hormone with no immunoreactive or biologic activity.

The severe deficiency of follicle-stimulating hormone in our patient provided an opportunity to evaluate this hormone's action on male sexual maturation and fertility. The patient had bilaterally descended small, soft testes; clinical evidence of androgen deficiency; high serum luteinizing hormone concentrations and low serum total and free testosterone concentrations; high-normal serum sex hormone–binding globulin concentrations; low serum inhibin B concentrations; and azoospermia on two occasions.

There have been several reports of males with isolated follicle-stimulating hormone deficiency diagnosed by biochemical methods. Some of the patients had associated disorders, such as cryptorchidism, hypospadias, omphalocele, deafness, the olfactory–genital dysplasia syndrome, chromosomal alterations, or short stature.^15,16,17 Others had a normal habitus without any malformations or chromosomal alterations.¹⁸ In all male patients previously described, basal serum luteinizing hormone and testosterone concentrations were normal. The variable phenotypes and other disorders may represent additional disorders or a partial rather than total deficiency of follicle-stimulating hormone. It is also conceivable that another mutation in the coding or regulatory sequences of the gene for the -subunit of follicle-stimulating hormone leads to low serum follicle-stimulating hormone concentrations or to undetectable yet partially bioactive hormone, resulting in a different phenotype. Mutations in the gene for the follicle-stimulating hormone receptor also lead to various degrees of oligospermia and normal-to-elevated serum luteinizing hormone concentrations, representing different phenotypes with the same genotype.¹⁹

The low serum total and free testosterone concentrations and high serum luteinizing hormone concentrations in our patient are curious findings. Leydig cells do not have follicle-stimulating hormone receptors, and the low serum testosterone concentrations are therefore not readily explained. Supernatants of Sertoli cells incubated with follicle-stimulating hormone stimulate testosterone secretion by Leydig cells and testicular explants from rats,^20,21 hamsters,²² and humans.^23,24 These findings suggest that our patient's low serum testosterone concentrations may have been due to the absence of a Leydig-cell–stimulating substance that is normally produced by Sertoli cells when they are stimulated by follicle-stimulating hormone. The patient's serum luteinizing hormone concentration was high because of the impaired testosterone secretion. His low serum inhibin B concentrations were probably due to Sertoli-cell hypofunction.²⁵

The prevalence of mutations in the gene for the -subunit of follicle-stimulating hormone remains to be determined. Ours is the third report of the same mutation in the -subunit gene; the other two reports involved women, one from the United Kingdom⁹ and the other from the United States.¹⁰ Our finding of the same mutation in two additional nonconsanguineous subjects, our patient's parents, suggests that this mutation may be more prevalent than previously suspected.

Source Information

From the Pediatric Diagnostic and Therapeutic Center (M.P., Y.S.), the Endocrine Clinic (J.E.A.), and the Genetic Institute (R.P.), Soroka Medical Center and Faculty of Health, Ben Gurion University of the Negev, Beer Sheva, Israel.

Address reprint requests to Prof. Phillip at Schneider Children's Medical Center of Israel, 14 Kaplan St., Petah-Tikva 49202, Israel.

References

1. Jameson JL. Inherited disorders of the gonadotropin hormones. Mol Cell Endocrinol 1996;125:143-149. [CrossRef][Medline]
2. Hardelin JP, Levilliers J, Blanchard S, et al. Heterogeneity in the mutations responsible for X chromosome-linked Kallmann syndrome. Hum Mol Genet 1993;2:373-377. [Free Full Text]
3. Muscatelli F, Strom TM, Walker AP, et al. Mutations in the DAX-1 gene give rise to both X-linked adrenal hypoplasia congenita and hypogonadotropic hypogonadism. Nature 1994;372:672-676. [CrossRef][Medline]
4. Weiss J, Axelrod L, Whitcomb RW, Harris PE, Crowley WF, Jameson JL. Hypogonadism caused by a single amino acid substitution in the subunit of luteinizing hormone. N Engl J Med 1992;326:179-183. [Medline]
5. Laue L, Wu SM, Kudo M, et al. A nonsense mutation of the human luteinizing hormone receptor gene in Leydig cell hypoplasia. Hum Mol Genet 1995;4:1429-1433. [Free Full Text]
6. Aittomaki K, Lucena JL, Pakarinen P, et al. Mutation in the follicle-stimulating hormone receptor gene causes hereditary hypergonadotropic ovarian failure. Cell 1995;82:959-968. [CrossRef][Medline]
7. Kremer H, Kraaij R, Toledo SP, et al. Male pseudohermaphroditism due to a homozygous missense mutation of the luteinizing hormone receptor gene. Nat Genet 1995;9:160-164. [CrossRef][Medline]
8. Latronico AC, Anasti J, Arnhold IJP, et al. Testicular and ovarian resistance to luteinizing hormone caused by inactivating mutations of the luteinizing hormone-receptor gene. N Engl J Med 1996;334:507-512. [Free Full Text]
9. Matthews CH, Borgato S, Beck-Peccoz P, et al. Primary amenorrhoea and infertility due to a mutation in the beta-subunit of follicle-stimulating hormone. Nat Genet 1993;5:83-86. [CrossRef][Medline]
10. Layman LC, Lee E-J, Peak DB, et al. Delayed puberty and hypogonadism caused by mutations in the follicle-stimulating hormone -subunit gene. N Engl J Med 1997;337:607-611. [Free Full Text]
11. Manni A, Pardridge WM, Cefalu W, et al. Bioavailability of albumin-bound testosterone. J Clin Endocrinol Metab 1985;61:705-710. [Free Full Text]
12. Somjen D, Tordjman K, Kohen F, et al. Combined FSH and LH response to TRH in patients with clinically non-functioning pituitary adenomas. Clin Endocrinol (Oxf) 1997;46:555-562. [CrossRef][Medline]
13. Jameson JL, Becker CB, Lindell CM, Habener JF. Human follicle-stimulating hormone beta-subunit gene encodes multiple messenger ribonucleic acids. Mol Endocrinol 1988;2:806-815. [Free Full Text]
14. Parvari R, Moses S, Shen J, Hershkovitz E, Lerner A, Chen Y-T. A single-base deletion in the 3'-coding region of glycogen-debranching enzyme is prevalent in glycogen storage disease type IIIa in a population of North African Jewish patients. Eur J Hum Genet 1997;5:266-270. [CrossRef][Medline]
15. Mozaffarian GA, Higley M, Paulsen CA. Clinical studies in an adult male patient with "isolated follicle stimulating hormone (FSH) deficiency." J Androl 1983;4:393-398. [Free Full Text]
16. Kjessler B, Lundberg PO. Dysfunction of the neuroendocrine system in nine males with aspermia. Fertil Steril 1974;25:1007-1017. [Medline]
17. Rabinowitz D, Cohen MM, Rosenmann E, et al. Chromatin-positive Klinefelter's syndrome with undetectable peripheral FSH levels. Am J Med 1975;59:584-590. [CrossRef][Medline]
18. Al-Ansari AA, Khalil TH, Kelani Y, Mortimer CH. Isolated follicle-stimulating hormone deficiency in men: successful long-term gonadotropin therapy. Fertil Steril 1984;42:618-626. [Medline]
19. Tapanainen JS, Aittomaki K, Min J, Vaskivuo T, Huhtaniemi IT. Men homozygous for an inactivating mutation of the follicle-stimulating hormone (FSH) receptor gene present variable suppression of spermatogenesis and fertility. Nat Genet 1997;15:205-206. [CrossRef][Medline]
20. Wu N, Murono EP. A Sertoli cell-secreted paracrine factor(s) stimulates proliferation and inhibits steroidogenesis of rat Leydig cells. Mol Cell Endocrinol 1994;106:99-109. [CrossRef][Medline]
21. Lecerf L, Rouiller-Fabre V, Levacher C, Gautier C, Saez JM, Habert R. Stimulatory effect of follicle-stimulating hormone on basal and luteinizing hormone-stimulated testosterone secretions by the fetal rat testis in vitro. Endocrinology 1993;133:2313-2318. [Free Full Text]
22. Sinha Hikim AP, Chandrashekar V, Bartke A, Russell LD. Sentinelsof Leydig cell structural and functional changes in golden hamsters in early testicular regression and recrudescence. Int J Androl 1993;16:324-342. [Medline]
23. Carreau S. Paracrine control of human Leydig cell and Sertoli cell functions. Folia Histochem Cytobiol 1996;34:111-119. [Medline]
24. Rivarola MA, Belgorosky A, Berensztein E, de Davila MT. Human prepubertal testicular cells in culture: steroidogenic capacity, paracrine and hormone control. J Steroid Biochem Mol Biol 1995;53:119-125. [CrossRef][Medline]
25. Anawalt BD, Bebb RA, Matsumoto AM, et al. Serum inhibin B levels reflect Sertoli cell function in normal men and men with testicular dysfunction. J Clin Endocrinol Metab 1996;81:3341-3345. [Abstract]

PDF Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited PubMed Citation

This article has been cited by other articles:

• Boukari, K., Meduri, G., Brailly-Tabard, S., Guibourdenche, J., Ciampi, M. L., Massin, N., Martinerie, L., Picard, J.-Y., Rey, R., Lombes, M., Young, J. (2009). Lack of Androgen Receptor Expression in Sertoli Cells Accounts for the Absence of Anti-Mullerian Hormone Repression during Early Human Testis Development. J. Clin. Endocrinol. Metab. 94: 1818-1825 [Abstract] [Full Text]  
• Allan, C. M., Lim, P., Robson, M., Spaliviero, J., Handelsman, D. J. (2009). Transgenic mutant D567G but not wild-type human FSH receptor overexpression provides FSH-independent and promiscuous glycoprotein hormone Sertoli cell signaling. Am. J. Physiol. Endocrinol. Metab. 296: E1022-E1028 [Abstract] [Full Text]  
• Madhukar, D., Rajender, S. (2009). Hormonal Treatment of Male Infertility: Promises and Pitfalls. J Androl 30: 95-112 [Abstract] [Full Text]  
• Grigorova, M., Punab, M., Ausmees, K., Laan, M. (2008). FSHB promoter polymorphism within evolutionary conserved element is associated with serum FSH level in men. Hum Reprod 23: 2160-2166 [Abstract] [Full Text]  
• Page, S. T., Amory, J. K., Bremner, W. J. (2008). Advances in Male Contraception. Endocr. Rev. 29: 465-493 [Abstract] [Full Text]  
• Lofrano-Porto, A., Barra, G. B., Giacomini, L. A., Nascimento, P. P., Latronico, A. C., Casulari, L. A., da Rocha Neves, F. d. A. (2007). Luteinizing Hormone Beta Mutation and Hypogonadism in Men and Women. NEJM 357: 897-904 [Abstract] [Full Text]  
• Raivio, T., Wikstrom, A. M, Dunkel, L. (2007). Treatment of gonadotropin-deficient boys with recombinant human FSH: long-term observation and outcome. Eur J Endocrinol 156: 105-111 [Abstract] [Full Text]  
• Matthiesson, K. L., McLachlan, R. I., O'Donnell, L., Frydenberg, M., Robertson, D. M., Stanton, P. G., Meachem, S. J. (2006). The Relative Roles of Follicle-Stimulating Hormone and Luteinizing Hormone in Maintaining Spermatogonial Maturation and Spermiation in Normal Men. J. Clin. Endocrinol. Metab. 91: 3962-3969 [Abstract] [Full Text]  
• Soriano-Guillen, L., Mitchell, V., Carel, J.-C., Barbet, P., Roger, M., Lahlou, N. (2006). Activating Mutations in the Luteinizing Hormone Receptor Gene: A Human Model of Non-Follicle-Stimulating Hormone-Dependent Inhibin Production and Germ Cell Maturation. J. Clin. Endocrinol. Metab. 91: 3041-3047 [Abstract] [Full Text]  
• Matthiesson, K. L., McLachlan, R. I. (2006). Male hormonal contraception: concept proven, product in sight?. Hum Reprod Update 12: 463-482 [Abstract] [Full Text]  
• Allan, C. M., Garcia, A., Spaliviero, J., Jimenez, M., Handelsman, D. J. (2006). Maintenance of Spermatogenesis by the Activated Human (Asp567Gly) FSH Receptor During Testicular Regression Due to Hormonal Withdrawal. Biol. Reprod. 74: 938-944 [Abstract] [Full Text]  
• Themmen, A. P N (2005). An update of the pathophysiology of human gonadotrophin subunit and receptor gene mutations and polymorphisms. Reproduction 130: 263-274 [Abstract] [Full Text]  
• Kumar, T R. (2005). What have we learned about gonadotropin function from gonadotropin subunit and receptor knockout mice?. Reproduction 130: 293-302 [Abstract] [Full Text]  
• Lamminen, T., Jokinen, P., Jiang, M., Pakarinen, P., Simonsen, H., Huhtaniemi, I. (2005). Human FSH{beta} subunit gene is highly conserved. Mol Hum Reprod 11: 601-605 [Abstract] [Full Text]  
• Valdes-Socin, H., Salvi, R., Daly, A. F., Gaillard, R. C., Quatresooz, P., Tebeu, P.-M., Pralong, F. P., Beckers, A. (2004). Hypogonadism in a Patient with a Mutation in the Luteinizing Hormone Beta-Subunit Gene. NEJM 351: 2619-2625 [Abstract] [Full Text]  
• Grover, A., Sairam, M. R., Smith, C. E., Hermo, L. (2004). Structural and Functional Modifications of Sertoli Cells in the Testis of Adult Follicle-Stimulating Hormone Receptor Knockout Mice. Biol. Reprod. 71: 117-129 [Abstract] [Full Text]  
• Abdennebi, L., Chun, E. Y., Jammes, H., Wei, D., Remy, J. J. (2003). Maintenance of Sexual Immaturity in Male Mice and Bucks by Immunization Against N-Terminal Peptides of the Follicle-Stimulating Hormone Receptor. Biol. Reprod. 68: 323-327 [Abstract] [Full Text]  
• Anderson, R. A., Baird, D. T. (2002). Male Contraception. Endocr. Rev. 23: 735-762 [Abstract] [Full Text]  
• Layman, L. C., Porto, A. L. A., Xie, J., da Motta, L. A. C. R., da Motta, L. D. C., Weiser, W., Sluss, P. M. (2002). FSH{beta} Gene Mutations in a Female with Partial Breast Development and a Male Sibling with Normal Puberty and Azoospermia. J. Clin. Endocrinol. Metab. 87: 3702-3707 [Abstract] [Full Text]  
• Achermann, J. C., Ozisik, G., Meeks, J. J., Jameson, J. L. (2002). Genetic Causes of Human Reproductive Disease. J. Clin. Endocrinol. Metab. 87: 2447-2454 [Full Text]  
• Kalantaridou, S. N., Chrousos, G. P. (2002). Monogenic Disorders of Puberty. J. Clin. Endocrinol. Metab. 87: 2481-2494 [Full Text]  
• Layman, L C (2002). Human gene mutations causing infertility. J. Med. Genet. 39: 153-161 [Abstract] [Full Text]  
• Plant, T. M., Marshall, G. R. (2001). The Functional Significance of FSH in Spermatogenesis and the Control of Its Secretion in Male Primates. Endocr. Rev. 22: 764-786 [Abstract] [Full Text]  
• Hayes, F. J., Pitteloud, N., DeCruz, S., Crowley, W. F. Jr., Boepple, P. A. (2001). Importance of Inhibin B in the Regulation of FSH Secretion in the Human Male. J. Clin. Endocrinol. Metab. 86: 5541-5546 [Abstract] [Full Text]  
• Krishnamurthy, H., Suresh Babu, P., Morales, C. R., Sairam, M. R. (2001). Delay in Sexual Maturity of the Follicle-Stimulating Hormone Receptor Knockout Male Mouse. Biol. Reprod. 65: 522-531 [Abstract] [Full Text]  
• Seminara, S. B., Crowley, W. F. Jr. (2001). Perspective: The Importance of Genetic Defects in Humans in Elucidating the Complexities of the Hypothalamic-Pituitary-Gonadal Axis. Endocrinology 142: 2173-2177 [Full Text]  
• Huhtaniemi, I., Bartke, A. (2001). Perspective: Male Reproduction. Endocrinology 142: 2178-2183 [Full Text]  
• Allan, C. M., Haywood, M., Swaraj, S., Spaliviero, J., Koch, A., Jimenez, M., Poutanen, M., Levallet, J., Huhtaniemi, I., Illingworth, P., Handelsman, D. J. (2001). A Novel Transgenic Model to Characterize the Specific Effects of Follicle-Stimulating Hormone on Gonadal Physiology in the Absence of Luteinizing Hormone Actions. Endocrinology 142: 2213-2220 [Abstract] [Full Text]  
• Zhang, F.-P., Poutanen, M., Wilbertz, J., Huhtaniemi, I. (2001). Normal Prenatal but Arrested Postnatal Sexual Development of Luteinizing Hormone Receptor Knockout (LuRKO) Mice. Mol. Endocrinol. 15: 172-183 [Abstract] [Full Text]  
• Hiro'oka, T., Maassen, D., Berger, P., Boime, I. (2000). Disulfide Bond Mutations in Follicle-Stimulating Hormone Result in Uncoupling of Biological Activity from Intracellular Behavior. Endocrinology 141: 4751-4756 [Abstract] [Full Text]  
• Danilovich, N., Babu, P. S., Xing, W., Gerdes, M., Krishnamurthy, H., Sairam, M. R. (2000). Estrogen Deficiency, Obesity, and Skeletal Abnormalities in Follicle-Stimulating Hormone Receptor Knockout (FORKO) Female Mice. Endocrinology 141: 4295-4308 [Abstract] [Full Text]  
• Themmen, A. P. N., Huhtaniemi, I. T. (2000). Mutations of Gonadotropins and Gonadotropin Receptors: Elucidating the Physiology and Pathophysiology of Pituitary-Gonadal Function. Endocr. Rev. 21: 551-583 [Abstract] [Full Text]  
• Young, J., Couzinet, B., Chanson, P., Brailly, S., Loumaye, E., Schaison, G. (2000). Effects of Human Recombinant Luteinizing Hormone and Follicle-Stimulating Hormone in Patients with Acquired Hypogonadotropic Hypogonadism: Study of Sertoli and Leydig Cell Secretions and Interactions. J. Clin. Endocrinol. Metab. 85: 3239-3244 [Abstract] [Full Text]  
• Krishnamurthy, H., Danilovich, N., Morales, C. R., Sairam, M. R. (2000). Qualitative and Quantitative Decline in Spermatogenesis of the Follicle-Stimulating Hormone Receptor Knockout (FORKO) Mouse. Biol. Reprod. 62: 1146-1159 [Abstract] [Full Text]  
• de Kretser, D. M., Baker, H. W. G. (1999). Infertility in Men: Recent Advances and Continuing Controversies. J. Clin. Endocrinol. Metab. 84: 3443-3450 [Full Text]  
• Achermann, J. C., Jameson, J. L. (1999). Fertility and Infertility: Genetic Contributions from the Hypothalamic-Pituitary- Gonadal Axis. Mol. Endocrinol. 13: 812-818 [Full Text]  
• Liu, P. Y., Turner, L., Rushford, D., McDonald, J., Baker, H.W.G., Conway, A. J., Handelsman, D. J. (1999). Efficacy and safety of recombinant human follicle stimulating hormone (Gonal-F) with urinary human chorionic gonadotrophin for induction of spermatogenesis and fertility in gonadotrophin-deficient men. Hum Reprod 14: 1540-1545 [Abstract] [Full Text]  
• Simoni, M., Gromoll, J., Höppner, W., Kamischke, A., Krafft, T., Stähle, D., Nieschlag, E. (1999). Mutational Analysis of the Follicle-Stimulating Hormone (FSH) Receptor in Normal and Infertile Men: Identification and Characterization of Two Discrete FSH Receptor Isoforms. J. Clin. Endocrinol. Metab. 84: 751-755 [Abstract] [Full Text]  
• Dierich, A., Sairam, M. R., Monaco, L., Fimia, G. M., Gansmuller, A., LeMeur, M., Sassone-Corsi, P. (1998). Impairing follicle-stimulating hormone (FSH) signaling in vivo: Targeted disruption of the FSH receptor leads to aberrant gametogenesis and hormonal imbalance. Proc. Natl. Acad. Sci. USA 95: 13612-13617 [Abstract] [Full Text]