Background Synovial sarcomas account for up to 10 percent ofsoft-tissue sarcomas and include two major histologic subtypes,biphasic and monophasic, defined respectively by the presenceand absence of glandular epithelial differentiation in a backgroundof spindle tumor cells. A characteristic SYT–SSX fusiongene resulting from the chromosomal translocation t(X;18)(p11;q11)is detectable in almost all synovial sarcomas. The translocationfuses the SYT gene from chromosome 18 to either of two highlyhomologous genes at Xp11, SSX1 or SSX2.SYT–SSX1 and SYT–SSX2are thought to function as aberrant transcriptional regulators.We attempted to determine the influence of the two alternativeforms of the SYT–SSX fusion gene on tumor morphology andclinical outcome in patients with this sarcoma.
Methods We analyzed SYT–SSX fusion transcripts in 45 synovialsarcomas (33 monophasic and 12 biphasic) by the reverse-transcriptasepolymerase chain reaction and compared the results with relevantclinical and pathological data.
Results The SYT–SSX1 and SYT–SSX2 fusion transcriptswere detected in 29 (64 percent) and 16 (36 percent) of thetumors, respectively. There was a significant relation (P =0.003) between histologic subtype (monophasic vs. biphasic)and SSX1 or SSX2 involvement in the fusion transcript: all 12biphasic synovial sarcomas had an SYT–SSX1 fusion transcript,and all 16 tumors that were positive for SYT–SSX2 weremonophasic. Kaplan–Meier analysis of 39 patients withlocalized tumors showed that the 15 patients with SYT–SSX2had significantly better metastasis-free survival than the 24patients with SYT–SSX1 (P = 0.03 by multivariate analysis;relative risk, 3.0). There were no significant correlationsbetween the type of SYT–SSX transcript and age, sex, tumorlocation and size, whether there were metastases at diagnosis,or whether patients underwent chemotherapy. Histologic subtypealone was not prognostically important.
Conclusions The type of SYT–SSX fusion transcript correlateswith both the histologic subtype and the clinical behavior ofsynovial sarcoma. SYT–SSX fusion transcripts are a definingdiagnostic marker of synovial sarcomas and may also yield importantindependent prognostic information.
Synovial sarcomas, which account for 5 to 10 percent of soft-tissuesarcomas, typically arise in the para-articular regions in adolescentsand young adults. These tumors occur in two major forms, biphasicand monophasic.1 Biphasic synovial sarcomas contain both epithelialcells arranged in glandular structures and spindle cells, whereasmonophasic types are entirely composed of spindle cells.
Cytogenetic studies of synovial sarcomas have revealed a characteristicchromosomal translocation, t(X;18)(p11;q11), in more than 90percent of both biphasic and monophasic tumors.2 The presenceof this translocation as the sole cytogenetic abnormality inat least some tumors suggests that it is the primary causalevent in synovial sarcoma. Cloning of the translocation breakpointsshowed that t(X;18) results in the fusion of two novel genes,designated SYT (at 18q11) and SSX (at Xp11).3 It soon becameapparent that the Xp11 breakpoint actually involves either oftwo closely related genes, SSX1 and SSX2,4,5 located in thevicinity of ornithine aminotransferase–like (OATL) pseudogenes1 and 2, respectively. The SSX1 and SSX2 genes are presumablyderived from a relatively recent duplication event and encodeproteins with considerable homology (81 percent). Recently,additional related SSX genes, apparently not involved by t(X;18),have been identified in Xp11.6,7
Like other chromosomal translocations in sarcomas, t(X;18) resultsin the formation of a chimeric protein that probably deregulatesthe transcription and, hence, the expression of specific targetgenes.8,9 Consistent with the intracellular site of transcriptionalregulators, SYT, SSX, and SYT–SSX are nuclear proteins.10,11Moreover, the amino-terminal regions of both SSX1 and SSX2 containa repressor domain that inhibits transcription.10 In the chimerictranscript of synovial sarcoma this repressor domain, encodedby the 5' portion of SSX1 and SSX2, is replaced by all but the3' end of SYT, a ubiquitously expressed gene encoding a regionthat can function as a transcriptional activation domain.10SYT and the SSX proteins probably regulate transcription primarilythrough interactions between proteins because they seem to lackDNA-binding domains. In the current working model of the molecularpathogenesis of synovial sarcoma, t(X;18) subverts normal transcriptionalregulation by directing SYT-mediated transcriptional activationto targets presumably recognized by the carboxy end of SSX andnormally inhibited by the latter's amino-terminal transcriptionalrepressor domain. The genes normally repressed by SSX1 and SSX2,and presumably aberrantly activated by the SYT–SSX geneproduct, are unknown.
Whether the precise location of the X chromosome breakpointcorrelates with the morphology of synovial sarcoma has beendebated for some time. Results of fluorescence in situ hybridization(FISH) from three independent groups suggested a relation betweenthe two histologic subtypes of synovial sarcoma and breakpointsin the OATL1 or OATL2 region, now known respectively to containthe SSX1 and SSX2 genes.12,13,14 However, another group failedto confirm these findings.5,15,16 Moreover, no studies havecompared the effects of SSX1 and SSX2 in t(X;18) on clinicaloutcome. To address these issues, we compared the type of SYT–SSXfusion, as determined by the reverse-transcriptase polymerasechain reaction (RT-PCR), with relevant clinicopathological datain 45 patients with synovial sarcoma.
Methods
Patients and Tumors
The study included 45 patients with histologically verifiedsynovial sarcoma, treated at Memorial Sloan-Kettering CancerCenter between 1982 and 1997, who were enrolled exclusivelyon the basis of the availability of frozen tumor for molecularanalysis. Partial clinical and molecular data on 34 patientswere included in a previous report.17 There were 25 male and20 female patients. The age at diagnosis ranged from 13 to 70years (mean, 33). Thirty-four primary tumors were located inthe extremities (33 in the lower extremity including the buttocksand groin, and 1 in the upper extremity) and 11 in the centralaxis (Table 1). The size of the tumor, represented by the largesttumor dimension in the resected specimen, ranged from 2 to 21cm (mean, 9.5). At the time of diagnosis, 39 patients had localizeddisease and 6 patients had distant metastases.
Table 1. Clinical, Histologic, and Molecular Characteristics of the Study Patients.
The tumor samples studied were obtained from primary tumor in29 cases, metastatic deposits in 12, and locally recurrent tumorin 4. The histopathological findings were reviewed by two physicianswho were unaware of the results of molecular genetic analyses.All tumors had morphologic and immunohistochemical featuresconsistent with synovial sarcoma. Tumors were classified asbiphasic on the basis of architectural evidence of epithelialdifferentiation, such as glandular structures. All tumors wereconsidered high grade, and all were deep-seated. All primarytumors were surgically treated with curative intent. Negativesurgical margins were achieved in 44 patients, and 1 patienthad a microscopically positive margin. Radiation therapy wasgiven to 19 patients (external radiation in 10 patients andbrachytherapy in 9 patients).
Chemotherapy including doxorubicin, ifosfamide, or both18 wasadministered to 21 patients. The postoperative follow-up periodranged from 2 to 180 months (mean, 40; median, 26). Extendedfollow-up data (>60 months) were available on seven patients.These included four patients with SYT–SSX1, two of whomwere alive with disease at 144 and 180 months (Patients 31 and9, respectively) and two of whom had no apparent disease at61 and 78 months (Patients 10 and 25), and three patients withSYT–SSX2, of whom two were alive with disease at 172 and180 months (Patients 7 and 2) and one had died of the diseaseat 62 months (Patient 8).
RT-PCR Analysis
Total RNA was isolated from snap-frozen tumor samples accordingto the acid–guanidinium–phenol–chloroformmethod, then 1 µg was reverse-transcribed with SuperscriptII reverse transcriptase (GIBCO BRL, Gaithersburg, Md.) andrandom hexamers. The resulting complementary DNA was subjectedto PCR amplification with the forward primer 5'CAACAGCAAGATGCATACCA3'for SYT3 and one of the following reverse primers: 5'CACTTGCTATGCACCTGATG3'(consensus) for SSX,3 5'GGTGCAGTTGTTTCCCATCG3' for SSX1,4 5'GGCACAGCTCTTTCCCATCA3'for SSX2,4 or 5'CCCCTTTTGGGTCCAGATATCA3' for SSX3. The amplificationconditions consisted of denaturation at 95°C for 1 minute,annealing at 60°C for 1 minute, and extension at 72°Cfor 1 minute for 35 cycles, with a final period of extensionat 72°C for 10 minutes. The products were separated by electrophoresisin agarose gels and visualized with ethidium bromide.
We identified the amplified fragments on the basis of theirsize on agarose gels and confirmed the results if necessaryby blotting the PCR products onto nylon membranes and hybridizingthem with internal and junction-specific probes, or by sequencingwith the dideoxy chain-termination method modified for fluorescent-basedDNA sequencing with a DNA sequencer (model 373, Applied Biosystems,Foster City, Calif.). As an internal control for PCR and forquality assessment of the tumor RNAs, a 247-bp portion of theubiquitously expressed phosphoglycerate kinase transcript wasamplified with primers 5'CAGTTTGGAGCTCCTGGAAG3' and 5'TGCAAATCCAGGGTGCAGTG3'under identical PCR conditions. Negative controls included reactionslacking RNA and reactions lacking reverse transcriptase.
Statistical Analysis
Survival curves were estimated according to the method of Kaplanand Meier from the date of primary-tumor surgery to the timeof metastatic recurrence or death.19 The differences in survivalcurves were examined with the log-rank test. Multivariate analysiswas performed by Cox proportional-hazards analysis. To arriveat a parsimonious multivariate model, covariates were selectedwith a stepwise regression model using backward elimination.Associations between variables were studied with Fisher's exacttest. All P values are two-sided.
Results
Of the 45 synovial sarcomas, 29 (64 percent) had a SYT–SSX1fusion transcript and 16 (36 percent) contained a SYT–SSX2fusion transcript (Figure 1). Representative histologic sectionsfrom two patients are shown in Figure 2A and Figure 2B. Becausethe SSX1 primer we used might misprime from SSX3, all tumorspositive for SYT–SSX1 were also analyzed with SYT andan SSX3-specific reverse primer. None of these samples containedan SYT–SSX3 fusion transcript.
Figure 1. Analysis of SYT–SSX Fusion Transcripts in Synovial Sarcoma.
We performed RT-PCR on total RNA from five patients with synovial sarcoma, using the SYT, SSX (consensus), SSX1, and SSX2 primers. The PCR products were then separated by electrophoresis on an agarose gel. The size of the specific SYT–SSX product is 585 bp, and the SYT–SSX1 and SYT–SSX2 products are both 331 bp. Tumors from Patients 53 and 63 contain the SYT–SSX1 fusion transcript. Tumors from Patients 44, 64, and 65 contain the SYT–SSX2 fusion transcript. Fainter nonspecific RT-PCR products are seen with the SYT and SSX primers in Patients 53 and 63.
Figure 2. Monophasic and Biphasic Synovial Sarcoma.
Panel A shows monophasic synovial sarcoma from Patient 47 (hematoxylin and eosin, x100). Panel B shows biphasic synovial sarcoma from Patient 11 immunostained with cytokeratin antibody to highlight the epithelial cells lining the gland-like spaces (x40). Both tumors expressed SYT–SSX1.
The results of all analyses of fusion transcripts and the clinicopathologicalfeatures of the 45 patients are summarized in Table 1. Therewere 12 biphasic and 33 monophasic tumors. All 12 biphasic synovialsarcomas had a SYT–SSX1 fusion transcript, whereas 17monophasic synovial sarcomas contained an SYT–SSX1 fusiontranscript and 16 had an SYT–SSX2 fusion transcript. Therewas a statistically significant (P = 0.003) relation betweenthe histologic subtype and the presence of SSX1 or SSX2 in thefusion transcript. There were no significant correlations betweenthe type of transcript and age, sex, tumor location or size,or whether there were metastases at diagnosis (Table 2).
Table 2. Comparison of Fusion Types and Clinicopathological Features.
The overall survival rate at five years for all 45 patientswas 55 percent. In the study group as a whole, the presenceof metastases at diagnosis was the only significant factor relatedto overall survival (P = 0.001 by multivariate analysis). Furtheranalysis was performed on the 39 patients who had localizedtumor at diagnosis. In this subgroup, the 15 patients with tumorscontaining the SYT–SSX2 fusion transcript had a significantlylonger metastasis-free survival than the 24 patients with tumorscontaining an SYT–SSX1 fusion transcript (P = 0.03 bymultivariate analysis; relative risk, 3.0; 95 percent confidenceinterval, 1.1 to 8.0) (Figure 3). In the multivariate analysis,the type of fusion transcript emerged as the only variable associatedwith metastasis-free survival (Table 3). There was also a trendtoward better overall survival in patients with localized tumorscontaining the SYT–SSX2 fusion transcript (P = 0.11 bymultivariate analysis) (data not shown). The histologic subtypedid not affect survival in any subgroup of patients.
Figure 3. Metastasis-free Survival in Patients with Localized Tumors.
Metastasis-free survival was significantly longer among those with the SYT–SSX2 fusion transcript than among those with SYT–SSX1 (P = 0.03 by multivariate analysis).
Table 3. Analysis of Factors Predicting Metastasis-free Survival in Patients with Localized Synovial Sarcoma.
Because some patients were treated before the widespread useof ifosfamide, one of the few effective agents against synovialsarcoma,20,21 we examined the distribution of ifosfamide-treatedpatients in the SYT–SSX1 and SYT–SSX2 groups. Amongthe 29 patients in the SYT–SSX1 group, 10 had receivedifosfamide, as compared with 2 of 14 patients in the SYT–SSX2group (Table 2). This difference was not statistically significant(P =0.16 by Fisher's exact test), suggesting that the survivaladvantage for the SYT–SSX2 group was not related to treatmentwith this agent. Not surprisingly, adjuvant chemotherapy, withor without ifosfamide, had no significant effect on outcomesin this historical cohort of patients who did not undergo randomizationfor adjuvant chemotherapy.
Discussion
Specific chromosomal translocations have come to define manytypes of sarcomas.8,9 The translocation t(X;18)(p11;q11) occursin over 90 percent of synovial sarcomas.2,22 Cloning of thetranslocation breakpoints has shown that two novel genes arethereby rearranged, SYT (at 18q11) and a duplicated gene, SSX(at Xp11).3 Identification of the SYT–SSX chimeric transcriptprovides a sensitive diagnostic test for synovial sarcoma.5,16,17Previously, we and Crew et al.5,17 found a specific SYT–SSXRT-PCR product in 58 of 64 (91 percent) synovial sarcomas tested.Analysis of additional material subsequently obtained from severalof our patients with initially negative results yielded positiveresults, indicating that the prevalence of this fusion transcriptin synovial sarcoma approaches 100 percent when there is materialadequate for molecular analysis. This finding is clinicallyimportant, because the differential diagnosis of synovial sarcomais broad and often problematic.1
The aim of our study was to determine whether the two alternativeforms of the SYT–SSX fusion transcript(SYT–SSX1and SYT–SSX2) are related to the histologic and clinicalcharacteristics of synovial sarcoma. Among 45 tumors analyzed,29 (64 percent) contained an SYT–SSX1 fusion transcriptand 16 (36 percent) had an SYT–SSX2 fusion transcript,a ratio concordant with that obtained elsewhere.5SSX3, a thirdmember of the SSX gene cluster at Xp11, was not involved inany case or in a previous series of 15 synovial sarcomas.6
We found a significant correlation between the SSX gene involvedin the fusion transcript and the histologic subtype of tumors.All 16 synovial sarcomas with SSX2 involvement were monophasic,whereas all 12 biphasic synovial sarcomas showed SSX1 involvement.This observation confirms earlier FISH results from three independentstudies including a total of 23 tumors, which found a correlationbetween the location of the X chromosome breakpoint and thehistologic subtype: in aggregate, all eight biphasic tumorshad a breakpoint in the OATL1 region (SSX1 gene).12,13,14 Anothergroup has reported the SYT–SSX2 fusion in two biphasicsynovial sarcomas,5,16 of which only one could be histologicallyconfirmed to contain focal glandular structures (Fisher C: personalcommunication). Thus, the present analysis and previous studiessuggest a significant relation between the type of fusion andthe histologic findings, but it is not a simple one, since overhalf of tumors containing SYT–SSX1 are monophasic. Hypothetically,the SYT–SSX1 fusion protein, although not sufficient byitself to induce architectural epithelial differentiation (glandformation), may be more permissive than SYT–SSX2 withrespect to this process.
Prognosis in synovial sarcoma has been correlated with age,site, tumor size, mitotic rate, necrosis, and histologic subtype.23,24,25,26,27,28Our study confirms that the presence of metastases at diagnosisis the most important prognostic factor for synovial sarcomas.The prognostic value of the histologic subtype has been controversial.Some early studies reported a more favorable outcome in patientswith biphasic tumors,23,29 whereas other groups found no differencesin survival between patients with monophasic tumors and thosewith biphasic tumors.25,26,27,28 Our results confirm the lackof prognostic importance of the histologic subtype. In mostsarcomas arising in the extremities, grade and depth are usuallyalso of prognostic importance,30 but they are of little valuein defining prognostic subgroups in synovial sarcomas, becausethese tumors are uniformly high grade and almost all are deep-seated.1It is therefore important to look for other prognostic variables.
Our data suggest that the type of SYT–SSX fusion transcriptmay be a major prognostic factor in synovial sarcoma. This resultdoes not appear to be biased by unequal distribution of thepatients, because possible prognostic factors for patients withlocalized tumors containing an SYT–SSX2 transcript (meanage, 29 years; tumor size, 8.9 cm; adjuvant chemotherapy, 4of 15 patients; median follow-up period, 36 months) were similarto those for patients with tumors containing an SYT–SSX1transcript (mean age, 37 years; tumor size, 8.4 cm; adjuvantchemotherapy, 11 of 24 patients; median follow-up period, 26months). Moreover, in multivariate analysis, the type of SYT–SSXfusion transcript was the sole independent prognostic factorfor metastasis-free survival in localized tumors (P = 0.03).We examined metastasis-free survival because local recurrenceof sarcomas is primarily related to the quality of local surgicalcontrol.30 Since the type of SYT–SSX fusion transcriptwas significantly correlated with both the clinical course andthe histologic subtype, but the latter alone had no prognosticimportance, the biologic mechanisms underlying these two differenteffects of fusion type may be independent.
Remarkably, there were no deaths due to cancer in patients withtumors containing the SYT–SSX2 fusion transcript in thefirst five years after surgery (data not shown). Analysis ofmetastasis-free survival showed that after the first two years,the survival curve of patients with tumors containing SYT–SSX2began to drop and became almost parallel to that of patientswith tumors containing SYT–SSX1 (Figure 3). These findingsindicate that patients with tumors positive for SYT–SSX2had a low risk of early relapse, but the cumulative risk ofdistant metastasis may be similar in both groups. A relativelyhigh incidence of late metastases is characteristic of synovialsarcoma.1 It is possible that tumors with SYT–SSX2 couldaccount for this clinical observation in synovial sarcoma. Studieswith a larger number of patients and longer follow-up are neededto confirm these observations. We have developed a method fordetecting SYT–SSX transcripts in archival formalin-fixed,paraffin-embedded material31 that should facilitate retrospectivestudies of historical cohorts of patients with extended follow-up.
The biologic basis of our results is unclear. Comparative functionalstudies of the two types of SYT–SSX fusion proteins havenot yet been performed. Hypothetically, the differences in 13amino acids among the 78 amino acids of the carboxy terminalof the SSX proteins included in SYT–SSX4,5 may influencespecific protein–protein interactions and, hence, alterthe target gene specificity of SYT–SSX chimeric proteinsor the degree of transactivation of target-gene subgroups, therebyinfluencing the biologic behavior of synovial sarcoma.
Different fusion products generated by cytogenetically identicalchromosomal translocation can have major clinical correlates.This was first demonstrated for the BCR–ABL rearrangement(the Philadelphia chromosome), in which the position of thebreakpoint within the BCR gene determines which BCR exons areincluded in the encoded chimeric tyrosine kinase, thereby leadingto either chronic myelogenous leukemia or acute lymphoblasticleukemia.32 More recently, the type of PAX-FKHR chimeric transcriptionfactor (i.e., PAX3–FKHR or PAX7–FKHR) has been shownto influence the clinical presentation and course of alveolarrhabdomyosarcoma.33 We and others have also found that the preciseexon composition of the EWS–FLI1 fusion transcript isa prognostic factor in the Ewing's sarcoma tumor group.34,35The structure of the fusion transcript appears to be a novelmarker of clinical behavior in sarcomas and leukemias with specificchromosomal translocations that show molecular heterogeneity.
In conclusion, the SYT–SSX gene fusion resulting fromthe translocation t(X;18), already presumed to be a primarypathogenetic event in synovial sarcoma, also appears to influenceits morphology and subsequent clinical behavior. Analysis ofSYT–SSX fusion transcripts provides both a useful diagnosticmarker for synovial sarcoma and important independent prognosticinformation, because SYT–SSX1 and SYT–SSX2 may definesubtly different types of synovial sarcoma.
We are indebted to Aimée Hamelin for technical assistance.
Source Information
From the Departments of Surgery (A.K., J.H.H., M.F.B.), Pathology (J.W., C.R.A., M.L.), and Human Genetics (M.L.), Memorial Sloan-Kettering Cancer Center, New York.
Address reprint requests to Dr. Ladanyi at the Department of Pathology, Memorial Sloan-Kettering Cancer Center, 1275 York Ave., New York, NY 10021.
Sreekantaiah C, Ladanyi M, Rodriguez E, Chaganti RSK. Chromosomal aberrations in soft tissue tumors: relevance to diagnosis, classification, and molecular mechanisms. Am J Pathol 1994;144:1121-1134. [Abstract]
Clark J, Rocques PJ, Crew AJ, et al. Identification of novel genes, SYT and SSX, involved in the t(X;18)(p11.2;q11.2) translocation found in human synovial sarcoma. Nat Genet 1994;7:502-508. [CrossRef][Medline]
de Leeuw B, Balemans M, Olde Weghuis D, Geurts van Kessel A. Identification of two alternative fusion genes, SYT-SSX1 and SYT-SSX2, int(X;18)(p11.2;q11.2)-positive synovial sarcomas. Hum Mol Genet 1995;4:1097-1099. [Free Full Text]
Crew AJ, Clark J, Fisher C, et al. Fusion of SYT to two genes, SSX1 and SSX2, encoding proteins with homology to the Kruppel-associated box in human synovial sarcoma. EMBO J 1995;14:2333-2340. [Medline]
de Leeuw B, Balemans M, Geurts van Kessel A. A novel Kruppel-associated box containing the SSX gene (SSX3) on the human X chromosome is not implicated in t(X;18)-positive synovial sarcomas. Cytogenet Cell Genet 1996;73:179-183. [Medline]
Chand A, Clark J, Cooper CS, Craig IW. Long-range organization of reiterated sequences, including the SSX1 cDNA at the OATL1 cluster in Xp11.23. Genomics 1995;30:545-552. [CrossRef][Medline]
Ladanyi M. The emerging molecular genetics of sarcoma translocations. Diagn Mol Pathol 1995;4:162-173. [Medline]
Sorensen PH, Triche TJ. Gene fusions encoding chimaeric transcription factors in solid tumours. Semin Cancer Biol 1996;7:3-14. [CrossRef][Medline]
Brett D, Whitehouse S, Antonson P, Shipley J, Cooper C, Goodwin G. The SYT protein involved in the t(X;18) synovial sarcoma translocation is a transcriptional activator localised in nuclear bodies. Hum Mol Genet 1997;6:1559-1564. [Free Full Text]
dos Santos NR, de Bruijn DRH, Balemans M, et al. Nuclear localization of SYT, SSX and the synovial sarcoma-associated SYT-SSX fusion proteins. Hum Mol Genet 1997;6:1549-1558. [Free Full Text]
de Leeuw B, Suijkerbuijk RF, Olde Weghuis D, et al. Distinct Xp11.2 breakpoint regions in synovial sarcoma revealed by metaphase and interphase FISH: relationship to histologic subtypes. Cancer Genet Cytogenet 1994;73:89-94. [CrossRef][Medline]
Janz M, De Leeuw B, Weghuis DO, et al. Interphase cytogenetic analysis of distinct X-chromosomal translocation breakpoints in synovial sarcoma. J Pathol 1995;175:391-396. [CrossRef][Medline]
Renwick PJ, Reeves BR, Dal Cin P, et al. Two categories of synovial sarcoma defined by divergent chromosome translocation breakpoints in Xp11.2, with implications for the histologic sub-classification of synovial sarcoma. Cytogenet Cell Genet 1995;70:58-63. [Medline]
Shipley JM, Clark J, Crew AJ, et al. The t(X;18)(p11.2;q11.2) translocation found in human synovial sarcomas involves two distinct loci on the X chromosome. Oncogene 1994;9:1447-1453. [Medline]
Shipley J, Crew J, Birdsall S, et al. Interphase fluorescence in situ hybridization and reverse transcription polymerase chain reaction as a diagnostic aid for synovial sarcoma. Am J Pathol 1996;148:559-567. [Abstract]
Fligman I, Lonardo F, Jhanwar SC, Gerald WL, Woodruff J, Ladanyi M. Molecular diagnosis of synovial sarcoma and characterization of a variant SYT-SSX2 fusion transcript. Am J Pathol 1995;147:1592-1599. [Abstract]
Kampe CE, Rosen G, Eilber F, et al. Synovial sarcoma: a study of intensive chemotherapy in 14 patients with localized disease. Cancer 1993;72:2161-2169. [CrossRef][Medline]
Kaplan EL, Meier P. Nonparametric estimation from incomplete observations. J Am Stat Assoc 1958;53:457-81.
Rosen G, Forscher C, Lowenbraun S, et al. Synovial sarcoma: uniform response of metastases to high dose ifosfamide. Cancer 1994;73:2506-2511. [CrossRef][Medline]
Connelly EF, Budd GT. Ifosfamide in the treatment of soft tissue sarcomas. Semin Oncol 1996;23:Suppl 6:16-21.
Limon J, Mrozek K, Mandahl N, et al. Cytogenetics of synovial sarcoma: presentation of ten new cases and review of the literature. Genes Chromosomes Cancer 1991;3:338-345. [Medline]
Cagle LA, Mirra JM, Storm FK, Roe DJ, Eilber FR. Histologic features relating to prognosis in synovial sarcoma. Cancer 1987;59:1810-1814. [CrossRef][Medline]
Rooser B, Willen H, Hugoson A, Rydholm A. Prognostic factors in synovial sarcoma. Cancer 1989;63:2182-2185. [CrossRef][Medline]
Brodsky JT, Burt ME, Hajdu SI, Casper ES, Brennan MF. Tendosynovial sarcoma: clinicopathologic features, treatment, and prognosis. Cancer 1992;70:484-489. [CrossRef][Medline]
Oda Y, Hashimoto H, Tsuneyoshi M, Takeshita S. Survival in synovial sarcoma: a multivariate study of prognostic factors with special emphasis on the comparison between early death and long-term survival. Am J Surg Pathol 1993;17:35-44. [Medline]
Pappo AS, Fontanesi J, Luo X, et al. Synovial sarcoma in children and adolescents: the St Jude Children's Research Hospital experience. J Clin Oncol 1994;12:2360-2366. [Free Full Text]
Singer S, Baldini EH, Demetri GD, Fletcher JA, Corson JM. Synovial sarcoma: prognostic significance of tumor size, margin of resection, and mitotic activity for survival. J Clin Oncol 1996;14:1201-1208. [Free Full Text]
Krall RA, Kostianovsky M, Patchefsky AS. Synovial sarcoma: a clinical, pathological, and ultrastructural study of 26 cases supporting the recognition of a monophasic variant. Am J Surg Pathol 1981;5:137-151. [Medline]
Pisters PW, Leung DH, Woodruff J, Shi W, Brennan MF. Analysis of prognostic factors in 1,041 patients with localized soft tissue sarcomas of the extremities. J Clin Oncol 1996;14:1679-1689. [Free Full Text]
Argani P, Zakowski MF, Klimstra DS, Rosai J, Ladanyi M. Detection of the SYT–SSX chimeric RNA of synovial sarcoma in paraffin-embedded tissue and its application in problematic cases. Mod Pathol (in press).
Melo JV. The diversity of BCR-ABL fusion proteins and their relationship to leukemia phenotype. Blood 1996;88:2375-2384. [Free Full Text]
Kelly KM, Womer RB, Sorensen PHB, Xiong QB, Barr FG. Common and variant gene fusions predict distinct clinical phenotypes in rhabdomyosarcoma. J Clin Oncol 1997;15:1831-1836. [Free Full Text]
Zoubek A, Dockhorn-Dworniczak B, Delattre O, et al. Does expression of different EWS chimeric transcripts define clinically distinct risk groups of Ewing tumor patients? J Clin Oncol 1996;14:1245-1251. [Free Full Text]
de Alava E, Kawai A, Healey JH, et al. EWS-FLI1 fusion transcript structure is an independent determinant of prognosis in Ewing's sarcoma. J Clin Oncol (in press).
Merchant, M. S., Mackall, C. L.
(2009). Current Approach to Pediatric Soft Tissue Sarcomas. The Oncologist
14: 1139-1153
[Abstract][Full Text]
Canter, R. J., Qin, L.-X., Maki, R. G., Brennan, M. F., Ladanyi, M., Singer, S.
(2008). A Synovial Sarcoma-Specific Preoperative Nomogram Supports a Survival Benefit to Ifosfamide-Based Chemotherapy and Improves Risk Stratification for Patients. Clin. Cancer Res.
14: 8191-8197
[Abstract][Full Text]
Tawbi, H., Thomas, D., Lucas, D. R., Biermann, J. S., Schuetze, S. M., Hart, A. L., Chugh, R., Baker, L. H.
(2008). Epidermal Growth Factor Receptor Expression and Mutational Analysis in Synovial Sarcomas and Malignant Peripheral Nerve Sheath Tumors. The Oncologist
13: 459-466
[Abstract][Full Text]
Slater, O., Shipley, J.
(2007). Clinical relevance of molecular genetics to paediatric sarcomas. J. Clin. Pathol.
60: 1187-1194
[Abstract][Full Text]
Kohno, Y., Okamoto, T., Ishibe, T., Nagayama, S., Shima, Y., Nishijo, K., Shibata, K. R., Fukiage, K., Otsuka, S., Uejima, D., Araki, N., Naka, N., Nakashima, Y., Aoyama, T., Nakayama, T., Nakamura, T., Toguchida, J.
(2006). Expression of Claudin7 Is Tightly Associated with Epithelial Structures in Synovial Sarcomas and Regulated by an Ets Family Transcription Factor, ELF3. J. Biol. Chem.
281: 38941-38950
[Abstract][Full Text]
Barr, F. G., Zhang, P. J.
(2006). The impact of genetics on sarcoma diagnosis: an evolving science.. Clin. Cancer Res.
12: 5256-5257
[Full Text]
Murphey, M. D., Gibson, M. S., Jennings, B. T., Crespo-Rodriguez, A. M., Fanburg-Smith, J., Gajewski, D. A.
(2006). From the Archives of the AFIP: Imaging of Synovial Sarcoma with Radiologic-Pathologic Correlation. RadioGraphics
26: 1543-1565
[Abstract][Full Text]
Saito, T., Nagai, M., Ladanyi, M.
(2006). SYT-SSX1 and SYT-SSX2 Interfere with Repression of E-Cadherin by Snail and Slug: A Potential Mechanism for Aberrant Mesenchymal to Epithelial Transition in Human Synovial Sarcoma.. Cancer Res.
66: 6919-6927
[Abstract][Full Text]
Frazier, A. A., Franks, T. J., Pugatch, R. D., Galvin, J. R.
(2006). From the archives of the AFIP: Pleuropulmonary synovial sarcoma.. RadioGraphics
26: 923-940
[Abstract][Full Text]
Granowetter, L.
(2006). Pediatric Oncology. Integr Cancer Ther
5: 49-50
Perani, M., Antonson, P., Hamoudi, R., Ingram, C. J. E., Cooper, C. S., Garrett, M. D., Goodwin, G. H.
(2005). The Proto-oncoprotein SYT Interacts with SYT-interacting Protein/Co-activator Activator (SIP/CoAA), a Human Nuclear Receptor Co-activator with Similarity to EWS and TLS/FUS Family of Proteins. J. Biol. Chem.
280: 42863-42876
[Abstract][Full Text]
Evans, C. H., Rosier, R. N.
(2005). Molecular Biology in Orthopaedics: The Advent of Molecular Orthopaedics. JBJS
87: 2550-2564
[Abstract][Full Text]
Hosono, T., Hironaka, M., Kobayashi, A., Yamasawa, H., Bando, M., Ohno, S., Sohara, Y., Sugiyama, Y.
(2005). Primary Pulmonary Synovial Sarcoma Confirmed by Molecular Detection of SYT-SSX1 Fusion Gene Transcripts: a Case Report and Review of the Literature. Jpn J Clin Oncol
35: 274-279
[Abstract][Full Text]
Oliveira, A. M., Fletcher, C. D.M.
(2004). Molecular Prognostication for Soft Tissue Sarcomas: Are We Ready Yet?. JCO
22: 4031-4034
[Full Text]
Guillou, L., Benhattar, J., Bonichon, F., Gallagher, G., Terrier, P., Stauffer, E., de Saint Aubain Somerhausen, N., Michels, J.-J., Jundt, G., Vince, D. R., Taylor, S., Genevay, M., Collin, F., Trassard, M., Coindre, J.-M.
(2004). Histologic Grade, But Not SYT-SSX Fusion Type, Is an Important Prognostic Factor in Patients With Synovial Sarcoma: A Multicenter, Retrospective Analysis. JCO
22: 4040-4050
[Abstract][Full Text]
Dennison, S., Weppler, E., Giacoppe, G.
(2004). Primary Pulmonary Synovial Sarcoma: A Case Report and Review of Current Diagnostic and Therapeutic Standards. The Oncologist
9: 339-342
[Abstract][Full Text]
Ottaiano, A., De Chiara, A., Perrone, F., Botti, G., Fazioli, F., De Rosa, V., Mozzillo, N., Ravo, V., Morrica, B., Gallo, C., Pisano, C., Napolitano, M., Ascierto, P. A., Iaffaioli, R. V., Apice, G.
(2004). Prognostic Value of CD40 in Adult Soft Tissue Sarcomas. Clin. Cancer Res.
10: 2824-2831
[Abstract][Full Text]
Chang, C.-C., Shidham, V. B.
(2003). Molecular Genetics of Pediatric Soft Tissue Tumors: Clinical Application. J. Mol. Diagn.
5: 143-154
[Abstract][Full Text]
Segal, N. H., Pavlidis, P., Antonescu, C. R., Maki, R. G., Noble, W. S., DeSantis, D., Woodruff, J. M., Lewis, J. J., Brennan, M. F., Houghton, A. N., Cordon-Cardo, C.
(2003). Classification and Subtype Prediction of Adult Soft Tissue Sarcoma by Functional Genomics. Am. J. Pathol.
163: 691-700
[Abstract][Full Text]
Gaffney, R., Chakerian, A., O'Connell, J. X., Mathers, J., Garner, K., Joste, N., Viswanatha, D. S.
(2003). Novel Fluorescent Ligase Detection Reaction and Flow Cytometric Analysis of SYT-SSX Fusions in Synovial Sarcoma. J. Mol. Diagn.
5: 127-135
[Abstract][Full Text]
Okcu, M. F., Munsell, M., Treuner, J., Mattke, A., Pappo, A., Cain, A., Ferrari, A., Casanova, M., Ozkan, A., Raney, B.
(2003). Synovial Sarcoma of Childhood and Adolescence: A Multicenter, Multivariate Analysis of Outcome. JCO
21: 1602-1611
[Abstract][Full Text]
Allander, S. V., Illei, P. B., Chen, Y., Antonescu, C. R., Bittner, M., Ladanyi, M., Meltzer, P. S.
(2002). Expression Profiling of Synovial Sarcoma by cDNA Microarrays : Association of ERBB2, IGFBP2, and ELF3 with Epithelial Differentiation. Am. J. Pathol.
161: 1587-1595
[Abstract][Full Text]
Nagayama, S., Katagiri, T., Tsunoda, T., Hosaka, T., Nakashima, Y., Araki, N., Kusuzaki, K., Nakayama, T., Tsuboyama, T., Nakamura, T., Imamura, M., Nakamura, Y., Toguchida, J.
(2002). Genome-wide Analysis of Gene Expression in Synovial Sarcomas Using a cDNA Microarray. Cancer Res.
62: 5859-5866
[Abstract][Full Text]
Colwell, A. S., D'Cunha, J., Vargas, S. O., Parker, B., Cin, P. D., Maddaus, M. A.
(2002). Synovial sarcoma of the pleura: A clinical and pathologic study of three cases. J. Thorac. Cardiovasc. Surg.
124: 828-832
[Abstract][Full Text]
Singer, S., Rubin, B. P., Lux, M. L., Chen, C.-J., Demetri, G. D., Fletcher, C. D.M., Fletcher, J. A.
(2002). Prognostic Value of KIT Mutation Type, Mitotic Activity, and Histologic Subtype in Gastrointestinal Stromal Tumors. JCO
20: 3898-3905
[Abstract][Full Text]
Barr, F. G., Qualman, S. J., Macris, M. H., Melnyk, N., Lawlor, E. R., Strzelecki, D. M., Triche, T. J., Bridge, J. A., Sorensen, P. H. B.
(2002). Genetic Heterogeneity in the Alveolar Rhabdomyosarcoma Subset without Typical Gene Fusions. Cancer Res.
62: 4704-4710
[Abstract][Full Text]
Hosaka, T., Nakashima, Y., Kusuzaki, K., Murata, H., Nakayama, T., Nakamata, T., Aoyama, T., Okamoto, T., Nishijo, K., Araki, N., Tsuboyama, T., Nakamura, T., Toguchida, J.
(2002). A Novel Type of EWS-CHOP Fusion Gene in Two Cases of Myxoid Liposarcoma. J. Mol. Diagn.
4: 164-171
[Abstract][Full Text]
Sato, Y., Nabeta, Y., Tsukahara, T., Hirohashi, Y., Syunsui, R., Maeda, A., Sahara, H., Ikeda, H., Torigoe, T., Ichimiya, S., Wada, T., Yamashita, T., Hiraga, H., Kawai, A., Ishii, T., Araki, N., Myoui, A., Matsumoto, S., Umeda, T., Ishii, S., Kawaguchi, S., Sato, N.
(2002). Detection and Induction of CTLs Specific for SYT-SSX-Derived Peptides in HLA-A24+ Patients with Synovial Sarcoma. J. Immunol.
169: 1611-1618
[Abstract][Full Text]
Cummings, T. J., Brown, N. M., Stenzel, T. T.
(2002). TaqMan Junction Probes and the Reverse Transcriptase Polymerase Chain Reaction: Detection of Alveolar Rhabdomyosarcoma, Synovial Sarcoma, and Desmoplastic Small Round Cell Tumor. Annals of Clinical & Laboratory Science
32: 219-224
[Abstract][Full Text]
Sorensen, P. H.B., Lynch, J. C., Qualman, S. J., Tirabosco, R., Lim, J. F., Maurer, H. M., Bridge, J. A., Crist, W. M., Triche, T. J., Barr, F. G.
(2002). PAX3-FKHR and PAX7-FKHR Gene Fusions Are Prognostic Indicators in Alveolar Rhabdomyosarcoma: A Report From the Children's Oncology Group. JCO
20: 2672-2679
[Abstract][Full Text]
Trupiano, J. K., Rice, T. W., Herzog, K., Barr, F. G., Shipley, J., Fisher, C., Goldblum, J. R.
(2002). Mediastinal synovial sarcoma: report of two cases with molecular genetic analysis. Ann. Thorac. Surg.
73: 628-630
[Abstract][Full Text]
Bijwaard, K. E., Fetsch, J. F., Przygodzki, R., Taubenberger, J. K., Lichy, J. H.
(2002). Detection of SYT-SSX Fusion Transcripts in Archival Synovial Sarcomas by Real-Time Reverse Transcriptase-Polymerase Chain Reaction. J. Mol. Diagn.
4: 59-64
[Abstract][Full Text]
Ladanyi, M., Antonescu, C. R., Leung, D. H., Woodruff, J. M., Kawai, A., Healey, J. H., Brennan, M. F., Bridge, J. A., Neff, J. R., Barr, F. G., Goldsmith, J. D., Brooks, J. S. J., Goldblum, J. R., Ali, S. Z., Shipley, J., Cooper, C. S., Fisher, C., Skytting, B., Larsson, O.
(2002). Impact of SYT-SSX Fusion Type on the Clinical Behavior of Synovial Sarcoma: A Multi-Institutional Retrospective Study of 243 Patients. Cancer Res.
62: 135-140
[Abstract][Full Text]
Saito, T., Oda, Y., Sugimachi, K., Kawaguchi, K.-i., Tamiya, S., Tanaka, K., Matsuda, S., Sakamoto, A., Iwamoto, Y., Tsuneyoshi, M.
(2001). E-Cadherin Gene Mutations Frequently Occur in Synovial Sarcoma as a Determinant of Histological Features. Am. J. Pathol.
159: 2117-2124
[Abstract][Full Text]
Worley, B. S., van den Broeke, L. T., Goletz, T. J., Pendleton, C. D., Daschbach, E. M., Thomas, E. K., Marincola, F. M., Helman, L. J., Berzofsky, J. A.
(2001). Antigenicity of Fusion Proteins from Sarcoma-associated Chromosomal Translocations. Cancer Res.
61: 6868-6875
[Abstract][Full Text]
Heimann, P., El Housni, H., Ogur, G., Weterman, M. A. J., Petty, E. M., Vassart, G.
(2001). Fusion of a Novel Gene, RCC17, to the TFE3 gene in t(X;17)(p11.2;q25.3)-bearing Papillary Renal Cell Carcinomas. Cancer Res.
61: 4130-4135
[Abstract][Full Text]
Inagaki, H., Okabe, M., Seto, M., Nakamura, S., Ueda, R., Eimoto, T.
(2001). API2-MALT1 Fusion Transcripts Involved in Mucosa-Associated Lymphoid Tissue Lymphoma : Multiplex RT-PCR Detection Using Formalin-Fixed Paraffin-Embedded Specimens. Am. J. Pathol.
158: 699-706
[Abstract][Full Text]
Einhorn, T. A., Nielsen, G. P.
(2001). Case 1-2001- A 26-Year-Old Man with a Mass in the Knee. NEJM
344: 124-131
[Full Text]
de Alava, E., Pardo, J.
(2001). Ewing Tumor: Tumor Biology and Clinical Applications. INT J SURG PATHOL
9: 7-17
[Abstract]
Rosai, J.
(2000). Editorial: Genes and Cancer. INT J SURG PATHOL
8: 175-176
Sekeres, M., Vasconcelles, M. J., Mcmenamin, M., Rosenfeld-Darling, M., Bueno, R.
(2000). Two Patients With Sarcoma. JCO
18: 2341-2342
[Full Text]
Lewis, J. J., Antonescu, C. R., Leung, D. H. Y., Blumberg, D., Healey, J. H., Woodruff, J. M., Brennan, M. F.
(2000). Synovial Sarcoma: A Multivariate Analysis of Prognostic Factors in 112 Patients With Primary Localized Tumors of the Extremity. JCO
18: 2087-2094
[Abstract][Full Text]
Kasai, T, Shimajiri, S, Hashimoto, H
(2000). Detection of SYT-SSX fusion transcripts in both epithelial and spindle cell areas of biphasic synovial sarcoma using laser capture microdissection. Mol. Pathol.
53: 107-110
[Abstract][Full Text]
Antonescu, C. R., Leung, D. H., Dudas, M., Ladanyi, M., Brennan, M., Woodruff, J. M., Cordon-Cardo, C.
(2000). Alterations of Cell Cycle Regulators in Localized Synovial Sarcoma : A Multifactorial Study with Prognostic Implications. Am. J. Pathol.
156: 977-983
[Abstract][Full Text]
Lindblom, A., Liljegren, A.
(2000). Regular review: Tumour markers in malignancies. BMJ
320: 424-427
[Full Text]
Grier, H. E.
(1999). Soft Tissue Sarcoma: Apples, Oranges, and Passion Fruit. JCO
17: 3695-3696
[Full Text]
Ladanyi, M.
(1999). Diagnosis and Classification of Small Round-Cell Tumors of Childhood. Am. J. Pathol.
155: 2181-2182
[Full Text]
Xie, Y., Skytting, B., Nilsson, G., Brodin, B., Larsson, O.
(1999). Expression of Insulin-like Growth Factor-1 Receptor in Synovial Sarcoma: Association with an Aggressive Phenotype. Cancer Res.
59: 3588-3591
[Abstract][Full Text]
Nilsson, G., Skytting, B., Xie, Y., Brodin, B., Perfekt, R., Mandahl, N., Lundeberg, J., Uhlen, M., Larsson, O.
(1999). The SYT-SSX1 Variant of Synovial Sarcoma Is Associated with a High Rate of Tumor Cell Proliferation and Poor Clinical Outcome. Cancer Res.
59: 3180-3184
[Abstract][Full Text]
Skytting, B., Nilsson, G., Brodin, B., Xie, Y., Lundeberg, J., Uhlen, M., Larsson, O.
(1999). A Novel Fusion Gene, SYT-SSX4, in Synovial Sarcoma. JNCI J Natl Cancer Inst
91: 974-975
[Full Text]
Ginsberg, J. P., de Alava, E., Ladanyi, M., Wexler, L. H., Kovar, H., Paulussen, M., Zoubek, A., Dockhorn-Dworniczak, B., Juergens, H., Wunder, J. S., Andrulis, I. L., Malik, R., Sorensen, P. H.B., Womer, R. B., Barr, F. G.
(1999). EWS-FLI1 and EWS-ERG Gene Fusions Are Associated With Similar Clinical Phenotypes in Ewing's Sarcoma. JCO
17: 1809-1809
[Abstract][Full Text]
Fletcher, C. D. M., Dal Cin, P., de Wever, I., Mandahl, N., Mertens, F., Mitelman, F., Rosai, J., Rydholm, A., Sciot, R., Tallini, G., van den Berghe, H., Vanni, R., Willen, H.
(1999). Correlation between Clinicopathological Features and Karyotype in Spindle Cell Sarcomas : A Report of 130 Cases from the CHAMP Study Group. Am. J. Pathol.
154: 1841-1847
[Abstract][Full Text]
Tsuji, S., Hisaoka, M., Morimitsu, Y., Hashimoto, H., Shimajiri, S., Komiya, S., Ushijima, M., Nakamura, T.
(1998). Detection of SYT-SSX Fusion Transcripts in Synovial Sarcoma by Reverse Transcription-Polymerase Chain Reaction Using Archival Paraffin-Embedded Tissues. Am. J. Pathol.
153: 1807-1812
[Abstract][Full Text]
Debourdeau, P., Gligorov, J., Couteau, C., Healey, J. H., Ladanyi, M., Brennan, M. F.
(1998). Genetic Abnormalities in Synovial Sarcoma. NEJM
338: 1699-1699
[Full Text]
Rabbitts, T.H.
(1998). The Clinical Significance of Fusion Oncogenes in Cancer. NEJM
338: 192-194
[Full Text]
Previous
