| |||||||||||||||||||||||||||||||
We report a case of malaria due to P. malariae in a 74-year-old woman from Greece whose illness was reactivated after decades of latency. All manifestations were reversed with a three-day course of chloroquine. Although thick and thin peripheral-blood smears were repeatedly negative, a nucleic acid–based assay detected the infecting species of malaria parasite. Since malaria was eradicated from Greece by about 1950, the patient's infection most likely lasted more than 40 years, possibly as long as 70. Symptoms of malaria began after asymptomatic splenomegaly was mistaken for lymphoma and she was treated with methotrexate. The fevers were in a quartan pattern (recurring every 72 hours). As Hippocrates wrote, "The least dangerous of all [fevers], and the mildest and most protracted, is the quartan."5
Case Report
In 1994, splenomegaly was documented in a 72-year-old woman from the Greek island of Karpathos during a routine examination (her first in many years). The woman felt healthy, had no constitutional symptoms, denied ever having malaria, and had never traveled outside of Greece. At a hospital in Athens in September 1995, ultrasonography and computed tomography of the abdomen showed an enlarged spleen but no other abnormalities; the spleen measured 21 cm. The patient was given a diagnosis of lymphoma and advised to undergo splenectomy, which she declined. In October 1995, she was treated with oral methotrexate (10 mg per day for 10 days). After seven days, rigors, headache, and fever (temperature of up to 39°C) developed that recurred in a quartan pattern for five cycles and that resolved after the methotrexate was stopped. Evaluation, including several blood films, provided no explanation for these symptoms.
When the woman was evaluated for splenomegaly in our clinic in February 1996, she denied all symptoms of illness. The physical examination was normal, except for a nontender, firm spleen extending 14 cm below the costal margin. Relevant laboratory data are shown in Table 1. The results of hemoglobin electrophoresis were normal, and glucose-6-phosphate 1-dehydrogenase levels were normal. Renal function and liver function, assessed by serum chemical analyses, were normal, as were the results of urinalysis. Serum IgG levels were elevated (Table 1). Serum levels of IgM were low (35 mg per deciliter). Five thick and five thin blood films obtained over a two-week period were negative for plasmodium species (more than 500 fields per slide were examined, corresponding to a finding of fewer than 2 parasites per microliter of blood).
|
In May 1997, one year after chloroquine treatment, we reevaluated the patient. She continued to feel clinically well and had gained 10 kg (22 lb). No abnormalities were found on physical examination. The spleen was no longer palpable, and ultrasonography confirmed that the spleen was of normal size (13 cm in the longest axis). Indirect immunofluorescence showed that antibodies against P. malariae had declined by a factor of 4 (Table 2). Serum IgG and hemoglobin levels had returned to normal (Table 1).
|
The study was approved by the Johns Hopkins Medical Institutions Joint Committee on Clinical Investigation and the National Institutes of Health Human Subjects Committee. The patient gave written informed consent.
Antibodies against all four malaria parasites of humans were measured by an immunofluorescence assay at the Centers for Disease Control and Prevention, Atlanta.6,7 The presence of P. malariae was evaluated by determining the species-specific sequence of an 18S ribosomal RNA (rRNA) in blood samples from the patient. This test can detect one plasmodium cell in 500 µl of whole blood.8 Parasite rRNA was reverse transcribed into single-stranded complementary DNA that was then amplified with the polymerase chain reaction (PCR), as previously described.8 The design of the PCR primers was based on highly conserved sequences in the 18S rRNA gene from the genus plasmodium: 5' primer 841 (5'GAACGAGATCTTAACCTGC3'); 3' primer 844 (5'TAITGATAAAGATTACCTA3'). The resulting products were separated by electrophoresis and Southern blot hybridization with a 32P-labeled oligonucleotide probe specific for P. malariae rRNA (5'TTTCACTTAAGAATATAGTGTATT3'). Amplified DNA fragments of rRNA were cloned as described previously.8 DNA sequencing was done manually by a modification of the dideoxynucleotide termination method of Sanger (Sequenase 2.0, U.S. Biochemical, Cleveland). The sequence of the P. malariae rRNA fragment reported here has GenBank accession number AF014942.
Results
Five specimens of whole blood, collected in citrate and simultaneously used for blood smears, were obtained over a two-week period and stored at 4°C. Thin and thick smears of all specimens were negative. Reverse-transcription (RT) PCR with genus-specific primers for plasmodium 18S asexual-stage rRNA was performed on total RNA extracted from 50 µl of whole blood. A Southern blot of the amplified DNA was hybridized with an internal probe specific for the P. malariae 18S rRNA gene (Figure 1). Two of five specimens showed the presence of P. malariae rRNA, suggesting that the degree of parasitemia was most likely near the limit of detection. Sequence analysis of PCR-amplified DNA fragments from the patient's specimens further confirmed the presence of an infection with P. malariae (Figure 2A and Figure 2B); the sequence amplified from the patient differed slightly from another P. malariae sequence determined in our laboratory (GenBank accession number U78741).
|
|
Discussion
This case demonstrates that P. malariae can cause prolonged asymptomatic infection that can reactivate decades after the initial infection and manifest as an indolent illness associated with insidious weight loss, splenomegaly, anemia, and hypergammaglobulinemia. On the basis of documentation provided by the World Health Organization (Dzenowagis J: personal communication) and others,9,10 the transmission of malaria was essentially eradicated in Greece, including Peloponnesus and Karpathos, by the early 1950s. Thus, the patient had most likely had this infection for more than 40 years. The clinical history suggests that her infection could have lasted about 70 years.
Although long-term asymptomatic infection with P. malariae is a well-recognized clinical entity, this case has a number of unusual features. First, the infection was suspected on the basis of the finding of splenomegaly; patients with chronic P. malariae typically have normal physical examinations.2 In contrast, acute malaria due to any of the four malaria parasites of humans is often associated with splenomegaly, which is also common in regions in which malaria is endemic among residents, with chronic or recurrent malaria due to P. falciparum or P. vivax. Second, despite the fact that more than 10 blood smears were negative over a period of more than 15 months, we were able to detect the infecting species of malaria parasite using an RT-PCR assay that provides a species-specific diagnosis. Third, serologic analysis was useful in confirming the clinical diagnosis of malaria. Typically, the indirect immunofluorescence assay is helpful for excluding the diagnosis of malaria; a positive titer does not confirm current infection, but rather that infection has occurred at some time in the past.11
Finally, that the patient's methotrexate treatment induced a malarial quartan fever seems certain: she had never had acute symptoms of fever or malaria previously, the symptoms disappeared soon after the methotrexate was stopped, and the pattern of fever was characteristic. Curiously, methotrexate is lethal to malaria parasites12; the blood levels of methotrexate must have been sublethal to the parasite in our patient but presumably sufficient to interfere with cell-mediated immunity, as occurs, for example, in rheumatoid arthritis and systemic lupus erythematosus.13 Because neither antibody titers nor antibody specificities would be expected to change within one week after immunosuppression induced by treatment with methotrexate, the rapid appearance of malaria symptoms after the administration of methotrexate suggests that cellular immunity contributed to the control of P. malariae infection in this patient. P. inui, a quartan-malaria parasite of monkeys thought to be analogous to P. malariae, has been reported to recur as a consequence of T-cell immunosuppression due to infection with the simian immunodeficiency virus.14 In contrast, neither the severity nor the frequency of illness due to P. falciparum, the lethal malaria parasite of humans, seems to be exacerbated by T-cell immunosuppression from concomitant infection with the human immunodeficiency virus,15,16,17 despite data from murine models of malaria suggesting that T cells are central to both induction and effector mechanisms of naturally acquired protection.18,19
The differential diagnosis was difficult in this case, especially given the paucity of systemic manifestations. In the tropics, a finding of splenomegaly has a broad range of diagnostic possibilities.20,21 Consideration in the present case was given to whether tropical splenomegaly syndrome (also known as hyperreactive malarial splenomegaly)22 was present. This syndrome is characterized by fever, anemia, weight loss, abdominal discomfort, and lassitude. Laboratory hallmarks include abnormal results of liver-function tests, elevated IgM levels, and hepatic sinusoidal lymphocytosis.22 Our patient had normal liver function and low rather than elevated serum IgM levels; a liver biopsy was not performed. Given the absence of clinical signs and symptoms, normal liver function, and low IgM levels, we conclude that this patient did not have tropical splenomegaly syndrome.
The epidemiologic importance of subclinical parasitemia is unclear and has not been well studied. A person may be asymptomatic while parasitemic and can be a source of transmission to mosquitoes and, hence, to other humans in a local population. Recent data indicate that more residents of regions in which malaria is holoendemic are continuously parasitemic (with P. falciparum) than the results of conventional microscopy would suggest; many such people carry subclinical infections demonstrable only by PCR.23 Subclinical carriers of malaria parasites may not be important in terms of transmission at any one time, since some critical level of gametocytemia, perhaps even at a subclinical level, is necessary. If the level of gametocytemia rises to levels in which transmission to mosquitoes is possible, however, malaria could be reintroduced into an area where it was once eradicated if anopheles mosquitoes are still present. Such a reintroduction of malaria occurred years after documented eradication in the West Indies.24 A highly sensitive assay such as the one we used may be a useful adjunct to serologic analysis in screening people for persistent malaria infections in a region where transmission of the disease has been eliminated.
Supported by a Physician Postdoctoral Fellow Award from the Howard Hughes Medical Institute (to Dr. Vinetz). Presented in part at the 45th Annual Meeting of the American Society for Tropical Medicine and Hygiene, Baltimore, December 1–5, 1996, and at the Infectious Disease Society of America Annual Meeting, San Francisco, September 7–11, 1997.
We are indebted to Maria Nikolaides for her help in gathering evidence for this report; to William Collins, Ph.D., and Marianna Wilson, M.S., of the Parasitology Branch, Centers for Disease Control and Prevention, Atlanta, for performing monkey and serologic studies and for helpful discussions; to J. Dzenowagis, Ph.D., World Health Organization, Geneva, for obtaining archival information about malaria transmission in Greece; to Drs. Franklin Neva, Louis Miller, Theodore Nash, Thomas Nutman, David Fidock, Mary Marovich, and Philip Cooper for helpful discussions and critique of the manuscript; to Thomas Spahr of the Johns Hopkins Hospital Clinical Microbiology Laboratory, for preparing blood smears and handling the specimens; to the Malaria Internet Group for obtaining information about the history of malaria transmission in Greece; and to Nancy Shulman for helping to prepare the manuscript.
Source Information
From the Laboratory of Parasitic Diseases, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, Md. (J.M.V., J.L., T.F.M., D.C.K.), and the Division of Infectious Diseases, Department of Medicine, Johns Hopkins School of Medicine, Baltimore (J.M.V.).
Address reprint requests to Dr. Vinetz at the Laboratory of Parasitic Diseases, National Institute of Allergy and Infectious Diseases, 9000 Rockville Pike, Bldg. 4, Rm. 126, Bethesda, MD 20892.
References
| |||||||||||||||||||||||||||||||
This article has been cited by other articles:
HOME | SUBSCRIBE | SEARCH | CURRENT ISSUE | PAST ISSUES | COLLECTIONS | PRIVACY | TERMS OF USE | HELP | beta.nejm.org Comments and questions? Please contact us. The New England Journal of Medicine is owned, published, and copyrighted © 2009 Massachusetts Medical Society. All rights reserved. |
Previous
