Background Deregulating the expression of Bcl-xL, an inhibitorof apoptosis, in an erythropoietin-dependent erythroblast cellline averts apoptosis induced by the withdrawal of erythropoietin.Since in polycythemia vera an abnormal clone of erythroid progenitorsis independent of erythropoietin, we investigated whether theendogenous expression of Bcl-xL was deregulated in these cells.
Methods Erythroid colonies from patients with polycythemia veraand normal subjects were cultured in the presence and absenceof erythropoietin and assessed by immunocytochemical and flow-cytometricanalysis with antiBcl-x antibodies that recognize thetwo species of Bcl-x (Bcl-x L and Bcl-xS). Reverse-transcriptasepolymerase-chain-reactionanalysis was used to determine which one of the two specieswas responsible for antiBcl-x staining. Bone marrow mononuclearcells from 8 healthy bone marrow donors, 14 patients with polycythemiavera, 19 patients with other myeloproliferative syndromes, and12 patients with secondary erythrocytosis were analyzed by flowcytometry with antibodies against Bcl-x and glycophorin A, anerythroid marker.
Results Erythroid cells from patients with polycythemia verasurvived in vitro without erythropoietin, and this finding correlatedwith the expression of Bcl-x protein (Bcl-xL messenger RNA wasthe main species of Bcl-x found), even in mature erythroblaststhat normally do not express Bcl-x. The mean (±SD) percentageof cells positive for both glycophorin A and Bcl-x in the 14patients with polycythemia vera (21.8±3.6 percent) wassignificantly higher than that in 8 normal donors (6.62±1.58percent), 12 patients with secondary erythrocytosis (6.87±1.95percent), 9 patients with essential thrombocythemia (3.81±0.97percent), and 10 patients with chronic myeloid leukemia (2.7±0.41percent).
Conclusions Deregulated expression of Bcl-x may contribute tothe erythropoietin-independent survival of erythroid-lineagecells in polycythemia vera and thereby contribute to the pathogenesisof this disease.
Polycythemia vera is a clonal hematopoietic disorder of stemcells characterized by erythrocytosis and, in most cases, granulocytosisand thrombocytosis. The overproduction of erythrocytes occursin the absence of a recognizable physiologic stimulus, sinceserum levels of erythropoietin are normal or lower than normal.1,2In polycythemia vera there are normal erythropoietin-dependenterythroblasts, but a fraction of the erythroid progenitors areindependent of erythropoietin.3 Normally, erythropoietin isessential for the survival and maturation of committed colony-forminguniterythroid progenitors and early erythroblasts.4,5,6
We have shown that Bcl-xL, a member of the Bcl-2 family of proteinsthat inhibit apoptosis,7 is expressed in human erythroleukemiacell lines and may regulate the survival of erythroid cellsduring differentiation.8,9 We have also demonstrated that inthe absence of erythropoietin, the erythropoietin-dependentmurine erythroid progenitor cell line HCD-57 rapidly down-regulatesthe expression of both Bcl-xL and Bcl-2 and undergoes apoptosis.10Furthermore, the ectopic expression of Bcl-xL (by means of aretroviral vector) rescues erythropoietin-deprived HCD-57 cellsfrom apoptosis, suggesting that erythropoietin inhibits apoptosisin erythroid progenitor cells through Bcl-xL and Bcl-2.10
In the present experiments, we analyzed the expression of Bcl-xin erythroid colonies derived from bone marrow or peripheral-bloodcells of patients with polycythemia vera. We found that theerythropoietin-independent erythroid cells express high levelsof Bcl-x when cultured in the absence of erythropoietin, thatBcl-xL was the predominant Bcl-x form as assessed by reverse-transcriptasepolymerase-chain-reaction(RT-PCR) analysis, and that the expression of Bcl-x proteinin bone marrow erythroid cells is significantly higher in patientswith untreated polycythemia vera than in those with other myeloproliferativedisorders or secondary erythrocytosis.
Methods
Study Subjects
We studied 33 patients with myeloproliferative disorders (14with polycythemia vera, 9 with essential thrombocythemia, and10 with chronic myeloid leukemia), 12 patients with secondaryerythrocytosis, and 8 normal subjects who were bone marrow donors.
The diagnosis of polycythemia vera11 required four of the followingcriteria: increased red-cell mass (>32 ml per kilogram ofbody weight in women and >36 ml per kilogram in men); splenomegaly;normal arterial oxygen saturation (>91 percent) in the presenceof an increased red-cell mass; an increased platelet count (>400,000per cubic millimeter) or white-cell count (>12,000 per cubicmillimeter), or both; and bone marrow hypercellularity withmegakaryocytic hyperplasia and the absence of iron stores orlow erythropoietin levels (<30 U/ml) in the presence of anincreased red-cell mass. The diagnosis of essential thrombocythemia12was made when a patient met all the following criteria: plateletcount greater than 600,000 per cubic millimeter; absence ofan identifiable cause of thrombocytosis; normal red-cell mass;absence of clinically significant fibrosis of the bone marrow;and absence of the Philadelphia chromosome and the presenceof bone marrow hypercellularity with marked megakaryocytic hyperplasia.The diagnosis of chronic myeloid leukemia was based on the presenceof leukocytosis with a leftward shift, splenomegaly, a low leukocytealkaline phosphatase score, and the Philadelphia chromosome.13The cases of secondary erythrocytosis included one case of sleepapnea, eight cases of chronic obstructive pulmonary disease,two cases associated with tumors (hypernephroma and uterinefibromyoma), and one case of polycystic renal disease.
The study was approved by the institutional review board ofthe Hospital Universitario Marqués de Valdecilla, Santander,Spain.
Laboratory Findings and Treatments
The clinical and laboratory characteristics of the study subjectsare summarized in Table 1. The studies were done at diagnosisin 4 of the patients with polycythemia vera, and a median of20 months after diagnosis (range, 3 to 108) in 10 patients.These 10 patients were being treated with phlebotomy, and 7of them had received cytoreductive chemotherapy with hydroxyureafor a median of 12 months (range, 6 to 45). In these 10 patients,the hemoglobin levels, hematocrit, and leukocyte counts werenormal at the time of the study, whereas in 2 of the other 4patients the platelet counts remained increased (729,000 and899,000 per cubic millimeter). The studies were done at diagnosisin two patients with essential thrombocythemia, and after amedian of 17 months (range, 6 to 72) in seven patients. Theseseven patients were receiving cytoreductive chemotherapy withhydroxyurea at the time of the study, and four of the nine hadplatelet counts below 600,000 per cubic millimeter. The 10 patientswith chronic myeloid leukemia were studied a median of 30 monthsafter diagnosis (range, 5 to 96). All of them were receivingcytoreductive chemotherapy with hydroxyurea, and 8 of 10 hadwhite-cell counts of more than 20,000 per cubic millimeter.Nine of the patients with secondary erythrocytosis were studiedat the time of diagnosis, and three were studied after phlebotomytreatment.
Table 1. Characteristics of the Patients and Control Subjects.
Cell Cultures
Erythroid colonies arise in vitro when progenitor cells fromthe bone marrow or peripheral blood of patients with polycythemiavera are cultured in the absence of erythropoietin, whereasnormal erythroid progenitors undergo apoptosis in the absenceof erythropoietin. These responses indicate the presence inpatients with polycythemia vera of abnormal erythroid progenitorsthat do not require erythropoietin to proliferate and differentiate.The loss of cell viability in normal erythroid progenitors isaccompanied by down-regulation of Bcl-xL, and in studies ofa murine erythroid progenitor cell line, the ectopic expressionof Bcl-xL blocked apoptosis induced by the withdrawal of erythropoietin.10
To study the participation of Bcl-x in the molecular mechanismof polycythemia vera, progenitor cells were obtained from peripheralblood of patients with the disease and control subjects afterthey had provided informed consent. Mononuclear cells were platedat a density of 250,000 cells per milliliter in a standard culture(Methocult, Stem Cell Technologies, Vancouver, B.C., Canada)containing 0.9 percent methylcellulose, 30 percent heat-inactivatedfetal-calf serum, 50 ng of stem-cell factor per milliliter,and 20 ng of interleukin-3 per milliliter. Cells were culturedin the presence or absence of 3 U of erythropoietin per milliliterand incubated until CFU-E was assessed on day 7. Erythroid cellswere then incubated in liquid culture (Iscove's modified Dulbecco'smedium, GIBCO-BRL, Grand Island, N.Y.) containing 30 percentfetal-calf serum with or without 3 U of erythropoietin per milliliter.
Immunocytochemical Staining
After 24 hours of incubation in liquid culture, erythroid cellswere cytocentrifuged onto slides, fixed in 100 percent ethanol,and incubated with rabbit antihuman Bcl-x (this antibody recognizesboth Bcl-xL, which inhibits apoptosis, and Bcl-xS, which inducesapoptosis) (Transduction Laboratories, Lexington, Ky.) or antihumanBcl-2 (Santa Cruz Laboratories, Santa Cruz, Calif.) as previouslydescribed.14 Cells incubated with normal rabbit serum insteadof primary antibodies were used as a negative control.
Flow-Cytometric Analysis
Cultured erythroid progenitors and mononuclear cells obtainedfrom peripheral blood and bone marrow of controls (donors forbone marrow transplantation) and patients with polycythemiavera were analyzed for the expression of Bcl-x by flow cytometryas described previously.14 Antibodies used included antiglycophorinA labeled with fluorescein isothiocyanate (Dako, Glostrup, Denmark)and mouse antiBcl-x (this antibody binds to both Bcl-xLand Bcl-xS) followed by biotin-conjugated goat antimouse IgGand phycoerythrin-labeled streptavidin.
RT-PCR Analysis
To assess the expression of messenger RNA, we used RT-PCR aspreviously described.9 The complementary DNA generated was amplifiedwith primers specific for human Bcl-x (5'CGGGCATTCAGTGACCTGAC3'and 5'TCAGGAACCAGCGGTTGAAG3'). The PCR consisted of denaturationat 94°C for 30 seconds, annealing at 55°C for 30 seconds,and extension at 72°C for 30 seconds. After 30 cycles ofamplification, the expected PCR products (340 bp for Bcl-xLand 151 bp for Bcl-xS) were fractionated according to size ontoa 2 percent agarose gel and stained with ethidium bromide.
Results
Bcl-x Protein in Erythropoietin-Independent Colonies from Patients with Polycythemia Vera
To assess the expression of Bcl-x in the erythroid colonies,we used flow-cytometric analysis of glycophorin Apositivecells that had been cultured in the presence of erythropoietinand in its absence. Glycophorin A is an erythroid-specific surfacemarker. A representative experiment is shown in Figure 1. After24 hours of culture, the percentages of cells positive for glycophorinA and Bcl-x in the control cultures were 59.5 percent in thepresence of erythropoietin and 13.7 percent in the absence oferythropoietin, whereas the percentage of cells positive forglycophorin A and negative for Bcl-x was 11.6 percent with erythropoietinand 22.4 percent without erythropoietin. By contrast, the presenceor absence of erythropoietin had no significant effect on theexpression of Bcl-x in the glycophorin Apositive populationof cells from patients with polycythemia vera (values, 87.8percent with erythropoietin and 75.2 percent without erythropoietin)(Figure 1).
Figure 1. Expression of Bcl-x in Erythroid Cells from Patients with Polycythemia Vera (PV) and Control Subjects.
Erythroid progenitors incubated with or without erythropoietin were labeled with antiglycophorin A and antiBcl-x monoclonal antibodies. The values above and below the horizontal lines indicate the percentage of cells positive for glycophorin A and Bcl-x and the percentage positive for glycophorin A and negative for Bcl-x, respectively. The quadrants were drawn up on the basis of the results for isotype-matched negative controls. All dot plots are from a representative experiment run in triplicate.
These results were confirmed by immunocytochemical analysis.Figure 2A and Figure 2B shows a representative experiment. Inthe presence of erythropoietin, Bcl-x was expressed mainly inimmature erythroid cells from both control subjects and patientswith polycythemia vera. However, when erythroid colonies werecultured without erythropoietin for 24 hours, control erythroidprogenitors underwent apoptosis as assessed morphologically(Figure 2A and Figure 2B) and on the basis of the typical patternof DNA fragmentation in apoptosis (not shown). These changeswere accompanied by reduced expression of Bcl-x (Figure 2A andFigure 2B). In contrast, in patients with polycythemia vera,erythroid progenitors cultured without erythropoietin for 24hours did not show any evidence of apoptosis (Figure 2A andFigure 2B), and the expression of Bcl-x was maintained in theimmature erythroblasts and was even increased in the more maturecells (Figure 2A and Figure 2B). Interestingly, the percentageof mature erythroblasts was greater when polycythemia vera erythroidprogenitors were cultured without erythropoietin than when theywere cultured with erythropoietin (mean [±SD], 54±6percent vs. 29±8 percent), suggesting that the absenceof erythropoietin facilitates the maturation of erythroid progenitorcells in patients with polycythemia vera.
Figure 2. Morphologic Analysis (Panel A) and Immunocytochemical Analysis (Panel B) of the Expression of Bcl-x in Erythroid Cells from Patients with Polycythemia Vera (PV) and Control Subjects.
Cells were stained with MayGrunwaldGiemsa solution (Panel A) and analyzed immunocytochemically for the expression of Bcl-x (Panel B) (x1000). There are apoptotic cells in the control preparation without erythropoietin, and the expression of Bcl-x increases with the maturation of the erythroid cells in patients with polycythemia vera in the absence of erythropoietin. No signal was detected when cells were incubated with normal rabbit serum instead of rabbit antiBcl-x. All samples are from a representative experiment run in triplicate.
To test further whether the expression of Bcl-x was independentof erythropoietin in erythroid progenitors from patients withpolycythemia vera, mononuclear cells from patients with polycythemiavera and normal subjects were plated in parallel in methylcellulosecultures in the absence of erythropoietin. On day 7, the colonieswere transferred to a liquid culture with or without erythropoietinand incubated for an additional 24 hours. Control erythroidprogenitors exhibited no growth without the addition of erythropoietin,and no colonies were found in the methylcellulose cultures.In contrast, erythroid colonies arose from progenitor cellsfrom patients with polycythemia vera cultured in the absenceof erythropoietin (Figure 3B). A representative flow-cytometricanalysis of this erythropoietin-independent erythroid populationshowed that the majority of glycophorin Apositive cellsexpressed Bcl-x (61.3 percent, as compared with 9.7 percentthat were negative for Bcl-x) (Figure 3A). This result was confirmedby immunocytochemical staining, which showed increased expressionof Bcl-x in the more mature erythroid cells (Figure 3C).
Figure 3. Expression of Bcl-x in Erythroid Cells from Patients with Polycythemia Vera (PV) and Control Subjects Cultured in the Absence of Erythropoietin.
Erythroid cells were analyzed by flow cytometry with antiglycophorin A and antiBcl-x (Panel A), stained with MayGrunwaldGiemsa solution for morphologic analysis (Panel B), and analyzed immunocytochemically for the expression of Bcl-x (Panel C) (x1000). There are no erythroid colonies in the normal controls under these culture conditions. The values above and below the horizontal lines in Panel A indicate the percentage of cells positive for both glycophorin A and Bcl-x and the percentage positive for glycophorin A and negative for Bcl-x, respectively. All results are from a representative experiment run in triplicate.
There are two species of human Bcl-x, Bcl-xL and Bcl-xS.7 Sincethe antiBcl-x antibodies that we used cannot distinguishbetween the two species, we used RT-PCR to determine whetherBcl-xL or Bcl-xS was responsible for antiBcl-x stainingin erythroid cells. A representative experiment is shown inFigure 4. In all the normal subjects and the patients with polycythemiavera, Bcl-xL was the predominant form of Bcl-x in colony-forminguniterythroid progenitors.
Figure 4. Expression of Bcl-x Messenger RNA in Erythroid Colonies from a Patient with Polycythemia Vera (PV) and a Control Subject.
Total RNA was subjected to reverse-transcriptasepolymerase-chain-reaction analysis with oligonucleotide primers that amplify both Bcl-xL and Bcl-xS. The simultaneous amplification of two plasmids containing Bcl-xL or Bcl-xS complementary DNA (1:1 molar ratio) was used as a positive control (M). Epo denotes erythropoietin.
Expression of Bcl-x by Glycophorin aPositive Cells in Bone Marrow
Given that cells in the erythropoietin-independent stages oferythroid differentiation express Bcl-x in patients with polycythemiavera, we hypothesized that the number of glycophorin Apositivecells in the bone marrow that express Bcl-x would be higherin patients with polycythemia vera than in normal subjects orpatients with other myeloproliferative disorders or secondaryerythrocytosis. We tested this idea by determining the percentageof mononuclear cells that were positive for both glycophorinA and Bcl-x in bone marrow from 8 bone marrow donors, 14 patientswith polycythemia vera, 12 with secondary erythrocytosis, 9with essential thrombocythemia, and 10 with chronic myelogenousleukemia. The percentage of erythroid cells and the ratio betweenimmature cells (proerythroblasts and basophilic erythroblasts)and mature cells (polychromatophilic and orthochromatic erythroblasts)were similar in the control subjects and the patients. However,the percentage of cells that were positive for both glycophorinA and Bcl-x was significantly higher (P<0.001 by one-wayanalysis of variance) in the patients with polycythemia vera(21.8±3.6 percent) than in the patients with secondaryerythrocytosis (6.87±1.95 percent), the patients withessential thrombocythemia (3.81±0.97 percent), the patientswith chronic myelogenous leukemia (2.7±0.41 percent),and the normal controls (6.62±1.58 percent) (Figure 5).Interestingly, the four patients with polycythemia vera whowere studied at the time of diagnosis had the highest percentagesof cells that were positive for both glycophorin A and Bcl-x(range, 33.1 to 52.6 percent).
Figure 5. Mean (±SD) Percentage of Glycophorin APositive Cells Expressing Bcl-x in Bone Marrow of Patients with Polycythemia Vera (PV), Secondary Erythrocytosis (SE), Essential Thrombocythemia (ET), or Chronic Myeloid Leukemia (CML) and Control Subjects.
The results were obtained by flow cytometry.
Discussion
Erythroid progenitor cells from normal subjects develop intocolonies in culture only when erythropoietin is added.15 Incontrast, erythroid progenitors from bone marrow or peripheralblood of patients with polycythemia vera give rise to coloniesin the absence of erythropoietin.16,17 The erythropoietin-independentformation of erythroid colonies is a hallmark of polycythemiavera and can be used to distinguish polycythemia vera from secondarypolycythemia.18 Erythropoietin is needed for normal erythroidmaturation,15,19 but the mechanism by which it controls thisprocess is unknown. It is possible that erythropoietin maintainscellular viability during the differentiation of erythroid progenitorcells. We have recently found that erythropoietin inhibits apoptosisof murine HCD-57 erythroid progenitor cells by promoting theexpression of Bcl-xL and Bcl-2, two inhibitors of apoptosis.10In the present study we showed that Bcl-x is mainly expressedin the erythropoietin-dependent stages of normal erythroid differentiation.Mature erythroblasts express little or no Bcl-x, whereas immatureerythroblasts (proerythroblasts and basophilic erythroblasts)are positive for Bcl-x. However, in patients with polycythemiavera, erythroid cells at all stages of differentiation expressBcl-x; indeed, the more mature erythroblasts express the highestlevel of Bcl-x. In vitro, polycythemia vera progenitors undergoerythroid differentiation in the presence of erythropoietin,but in the absence of erythropoietin, the differentiation processis accelerated. A similar phenomenon occurred with HCD-57 erythroidprogenitor cells that were transduced with a Bcl-xL retrovirusvector.10 Taken together, these studies suggest that erythropoietindoes not induce erythroid differentiation, but rather promotesdifferentiation by providing survival signals.
Our finding that erythroid progenitors from patients with polycythemiavera do not undergo apoptosis in vitro in the absence of erythropoietinwas made with cells obtained from patients who had been treatedwith hydroxyurea or studied at the time of diagnosis. In bothcases the erythroid colonies that arose in culture were indistinguishablein terms of the expression of Bcl-x and erythroid maturation(data not shown); however, the number of colonies was consistentlylower in the treated patients, most likely because of the inhibitoryeffect of hydroxyurea on the cell cycle.20 Our results suggestthat the deregulation of Bcl-x in erythroid progenitors maybe responsible for the accumulation of erythroid cells in patientswith polycythemia vera, since the predominant form of Bcl-xmessenger RNA in these cells is Bcl-xL, which is a repressorof apoptosis. We also found little or no expression of Bcl-2in erythroid progenitors from patients with polycythemia veracultured without erythropoietin (data not shown). However, thestaining pattern of Bcl-2 in erythroid cells is very weak, makingit difficult to rule out the possibility that Bcl-2 contributesto the accumulation of erythroid cells in patients with polycythemiavera.
The diagnosis of polycythemia vera is based mainly on criteriaused by the Polycythemia Vera Study Group21 in order to obtaina uniform population of patients for therapeutic evaluations.However, some patients have a myeloproliferative disorder resemblingpolycythemia vera but do not fulfill all the criteria. The erythropoietin-independentgrowth of erythroid colonies in semisolid culture may be a usefuldiagnostic tool to distinguish polycythemia vera from othermyeloproliferative disorders and secondary erythrocytosis; however,the erythroid progenitors of some patients with essential thrombocythemiahave similar in vitro behavior.22 It is clear that a betterunderstanding of the molecular alterations could improve ourability to diagnose polycythemia vera.
We found that the mean number of Bcl-xpositive cellsin the population carrying the erythroid marker glycophorinA was significantly higher in the bone marrow of patients withpolycythemia vera than in the bone marrow of normal subjectsand patients with essential thrombocythemia, chronic myelogenousleukemia, or secondary erythrocytosis. However, the percentageof Bcl-xpositive cells in 7 of 14 patients with polycythemiavera was similar to that found in patients with secondary erythrocytosis.Six of these seven patients were treated with hydroxyurea. Sinceerythroid cells from patients with polycythemia vera who aretreated with hydroxyurea give rise to fewer colonies in semisolidculture than cells from normal subjects, it is likely that thecytoreductive effect of hydroxyurea accounts for the relativelylow number of cells positive for both glycophorin A and Bcl-xin the bone marrow of treated patients. By contrast, the fourpatients studied at the time of diagnosis had the highest percentagesof Bcl-xpositive erythroid cells. These preliminary datasuggest that the number of cells positive for both glycophorinA and Bcl-x could be helpful in confirming the diagnosis ofpolycythemia vera.
In conclusion, we propose that the erythropoietin-independentexpression of Bcl-x may cause the accumulation of erythroidcells in polycythemia vera. A constitutively activated or hypersensitiveerythropoietin receptor might be involved, but mutations ofthe erythropoietin-receptor gene are detected in only some casesof hereditary polycythemia.23,24 A recent study proposed thatthe increased level of insulin-like growth factorbindingprotein 1 in patients with polycythemia vera may account forthe increased sensitivity of erythroid progenitors to insulin-likegrowth factor I and the consequent overproduction of erythroidcells.25,26 In line with this proposal, insulin-like growthfactor I has been shown to suppress apoptosis in erythroid progenitorsand myeloid cells.27,28 The role of insulin-like growth factorI in the erythropoietin-independent expression of the apoptosis-inhibitoryprotein Bcl-x will need to be addressed in future studies.
Supported by a grant (FISS-94/1415) from Fondo de InvestigacionesSanitarias, a grant (SAF-96/0274) from Plan Nacional de Investigaciony Desarrollo (to Dr. Fernández-Luna), and a postdoctoralfellowship from the Fundacion Marqués de Valdecilla (toDr. Benito).
We are indebted to Dr. Craig Thompson for generously supplyingantiBcl-x monoclonal antibody and to Drs. Francesco LoCoco, Mario Cazzola, and Gabriel Núñez for criticalreview of the manuscript.
Source Information
From the Servicio de Immunologia (M.S., A.B., C.S., J.L.F.-L.) and Servicio de Hematologia (C.R., I.O.), Hospital Universitario Marqués de Valdecilla, Santander, Spain.
Address reprint requests to Dr. Fernández-Luna at the Servicio de Immunologia, Hospital Universitario Marqués de Valdecilla, INSALUD, 39008 Santander, Spain.
References
Koeffler HP, Goldwasser E. Erythropoietin radioimmunoassay in evaluating patients with polycythemia. Ann Intern Med 1981;94:44-47.
Cotes PM, Doré CJ, Yin JAL, et al. Determination of serum immunoreactive erythropoietin in the investigation of erythrocytosis. N Engl J Med 1986;315:283-287. [Abstract]
Fisher MJ, Prchal JF, Prchal JT, D'Andrea AD. Anti-erythropoietin (EPO) receptor monoclonal antibodies distinguish EPO-dependent and EPO-independent erythroid progenitors in polycythemia vera. Blood 1994;84:1982-1991. [Free Full Text]
Koury MJ, Bondurant MC. Maintenance by erythropoietin of viability and maturation of murine erythroid precursor cells. J Cell Physiol 1988;137:65-74. [CrossRef][Medline]
Koury MJ, Bondurant MC. Erythropoietin retards DNA breakdown and prevents programmed death in erythroid progenitor cells. Science 1990;248:378-381. [Free Full Text]
Kelley LL, Koury MJ, Bondurant MC, Koury ST, Sawyer ST, Wickrema A. Survival or death of individual proerythroblasts results from differing erythropoietin sensitivities: a mechanism for controlled rates of erythrocyte production. Blood 1993;82:2340-2352. [Free Full Text]
Boise LH, Gonzalez-Garcia M, Postema CE, et al. Bcl-x, a Bcl-2-related gene that functions as a dominant regulator of apoptotic cell death. Cell 1993;74:597-608. [CrossRef][Medline]
Benito A, Grillot D, Nuñez G, Fernandez-Luna JL. Regulation and function of Bcl-2 during differentiation-induced cell death in HL-60 promyelocytic cells. Am J Pathol 1995;146:481-490. [Abstract]
Benito A, Silva M, Grillot D, Nuñez G, Fernández-Luna JL. Apoptosis induced by erythroid differentiation of human leukemia cell lines is inhibited by Bcl-XL. Blood 1996;87:3837-3843. [Free Full Text]
Silva M, Grillot D, Benito A, Richard C, Nuñez G, Fernández-Luna JL. Erythropoietin can promote erythroid progenitor survival by repressing apoptosis through Bcl-XL and Bcl-2. Blood 1996;88:1576-1582. [Free Full Text]
Hoffman R, Boswell HS. Polycythemia vera. In: Hoffman R, Benz EJ Jr, Shattil SJ, Furie B, Cohen HJ, Silberstein LE, eds. Hematology: basic principles and practice. 2nd ed. New York: Churchill Livingstone, 1995:1121-41.
Hoffman R, Silverstein LE, Hromas R. Primary thrombocythemia. In: Hoffman R, Benz EJ Jr, Shattil SJ, Furie B, Cohen HJ, Silberstein LE, eds. Hematology: basic principles and practice. 2nd ed. New York: Churchill Livingstone, 1995:1174-83.
Hughes TP, Goldman JM. Chronic myeloid leukemia. In: Hoffman R, Benz EJ Jr, Shattil SJ, Furie B, Cohen HJ, Silberstein LE, eds. Hematology: basic principles and practice. 2nd ed. New York: Churchill Livingstone, 1995:1142-59.
Sanz C, Benito A, Silva M, et al. The expression of Bcl-x is downregulated during differentiation of human hematopoietic progenitor cells along the granulocyte but not the monocyte/macrophage lineage. Blood 1997;89:3199-3204. [Free Full Text]
Tepperman AD, Curtis JE, McCulloch EA. Erythropoietic colonies in cultures of human marrow. Blood 1974;44:659-669. [Free Full Text]
Prchal JF, Axelrad AA. Bone-marrow responses in polycythemia vera. N Engl J Med 1974;290:1382-1382.
Greenberg BR, Golde DW. Erythropoiesis in familial erythrocytosis. N Engl J Med 1977;296:1080-1084. [Abstract]
Lemoine F, Najman A, Baillou C, et al. A prospective study of the value of bone marrow erythroid progenitor cultures in polycythemia. Blood 1986;68:996-1002. [Free Full Text]
Krantz SB. Erythropoietin. Blood 1991;77:419-434. [Free Full Text]
Yarbro JW. Mechanism of action of hydroxyurea. Semin Oncol 1992;19:Suppl 9:1-10. [Medline]
Berlin NI. Diagnosis and classification of the polycythemias. Semin Hematol 1975;12:339-351. [Medline]
Eridani S, Batten E, Sawyer B. Erythroid colony formation in primary thrombocythaemia: evidence of hypersensitivity to erythropoietin. Br J Haematol 1984;56:157-161. [Medline]
Sokol L, Prchal JF, Prchal JT. Primary familial and congenital polycythaemia. Lancet 1993;342:115-116. [Medline]
Hess G, Rose P, Gamm H, Papadileris S, Huber C, Seliger B. Molecular analysis of the erythropoietin receptor system in patients with polycythaemia vera. Br J Haematol 1994;88:794-802. [Medline]
Mirza AM, Ezzat S, Axelrad AA. Insulin-like growth factor binding protein-1 is elevated in patients with polycythemia vera and stimulates erythroid burst formation in vitro. Blood 1997;89:1862-1869. [Free Full Text]
Correa PN, Eskinazi D, Axelrad AA. Circulating erythroid progenitors in polycythemia vera are hypersensitive to insulin-like growth factor-1 in vitro: studies in an improved serum-free medium. Blood 1994;83:99-112. [Free Full Text]
Muta K, Krantz SB. Apoptosis of human erythroid colony-forming cells is decreased by stem cell factor and insulin-like growth factor I as well as erythropoietin. J Cell Physiol 1993;156:264-271. [CrossRef][Medline]
Liu Q, Schacher D, Hurth C, Freund GG, Dantzer R, Kelley KW. Activation of phosphatidylinositol 3'-kinase by insulin-like growth factor-I rescues promyeloid cells from apoptosis and permits their differentiation into granulocytes. J Immunol 1997;159:829-837. [Abstract]
Zeuner, A., Pedini, F., Francescangeli, F., Signore, M., Girelli, G., Tafuri, A., De Maria, R.
(2009). Activity of the BH3 mimetic ABT-737 on polycythemia vera erythroid precursor cells. Blood
113: 1522-1525
[Abstract][Full Text]
Zhao, R., Follows, G. A., Beer, P. A., Scott, L. M., Huntly, B. J.P., Green, A. R., Alexander, D. R.
(2008). Inhibition of the Bcl-xL Deamidation Pathway in Myeloproliferative Disorders. NEJM
359: 2778-2789
[Abstract][Full Text]
Gozgit, J. M., Bebernitz, G., Patil, P., Ye, M., Parmentier, J., Wu, J., Su, N., Wang, T., Ioannidis, S., Davies, A., Huszar, D., Zinda, M.
(2008). Effects of the JAK2 Inhibitor, AZ960, on Pim/BAD/BCL-xL Survival Signaling in the Human JAK2 V617F Cell Line SET-2. J. Biol. Chem.
283: 32334-32343
[Abstract][Full Text]
Levine, R. L., Gilliland, D. G.
(2008). Myeloproliferative disorders. Blood
112: 2190-2198
[Abstract][Full Text]
Hexner, E. O., Serdikoff, C., Jan, M., Swider, C. R., Robinson, C., Yang, S., Angeles, T., Emerson, S. G., Carroll, M., Ruggeri, B., Dobrzanski, P.
(2008). Lestaurtinib (CEP701) is a JAK2 inhibitor that suppresses JAK2/STAT5 signaling and the proliferation of primary erythroid cells from patients with myeloproliferative disorders. Blood
111: 5663-5671
[Abstract][Full Text]
Ciurea, S. O., Merchant, D., Mahmud, N., Ishii, T., Zhao, Y., Hu, W., Bruno, E., Barosi, G., Xu, M., Hoffman, R.
(2007). Pivotal contributions of megakaryocytes to the biology of idiopathic myelofibrosis. Blood
110: 986-993
[Abstract][Full Text]
Teofili, L., Martini, M., Cenci, T., Petrucci, G., Torti, L., Storti, S., Guidi, F., Leone, G., Larocca, L. M.
(2007). Different STAT-3 and STAT-5 phosphorylation discriminates among Ph-negative chronic myeloproliferative diseases and is independent of the V617F JAK-2 mutation. Blood
110: 354-359
[Abstract][Full Text]
Diwan, A., Koesters, A. G., Odley, A. M., Pushkaran, S., Baines, C. P., Spike, B. T., Daria, D., Jegga, A. G., Geiger, H., Aronow, B. J., Molkentin, J. D., Macleod, K. F., Kalfa, T. A., Dorn, G. W. II
(2007). Unrestrained erythroblast development in Nix-/- mice reveals a mechanism for apoptotic modulation of erythropoiesis. Proc. Natl. Acad. Sci. USA
104: 6794-6799
[Abstract][Full Text]
Campbell, P. J., Green, A. R.
(2006). The Myeloproliferative Disorders. NEJM
355: 2452-2466
[Full Text]
Garcon, L., Rivat, C., James, C., Lacout, C., Camara-Clayette, V., Ugo, V., Lecluse, Y., Bennaceur-Griscelli, A., Vainchenker, W.
(2006). Constitutive activation of STAT5 and Bcl-xL overexpression can induce endogenous erythroid colony formation in human primary cells. Blood
108: 1551-1554
[Abstract][Full Text]
Bellanne-Chantelot, C., Chaumarel, I., Labopin, M., Bellanger, F., Barbu, V., De Toma, C., Delhommeau, F., Casadevall, N., Vainchenker, W., Thomas, G., Najman, A.
(2006). Genetic and clinical implications of the Val617Phe JAK2 mutation in 72 families with myeloproliferative disorders. Blood
108: 346-352
[Abstract][Full Text]
Schafer, A. I.
(2006). Molecular basis of the diagnosis and treatment of polycythemia vera and essential thrombocythemia. Blood
107: 4214-4222
[Abstract][Full Text]
Zeuner, A., Pedini, F., Signore, M., Ruscio, G., Messina, C., Tafuri, A., Girelli, G., Peschle, C., De Maria, R.
(2006). Increased death receptor resistance and FLIPshort expression in polycythemia vera erythroid precursor cells. Blood
107: 3495-3502
[Abstract][Full Text]
Levine, R. L., Wernig, G.
(2006). Role of JAK-STAT Signaling in the Pathogenesis of Myeloproliferative Disorders. ASH Education Book
2006: 233-239
[Abstract][Full Text]
Jones, A. V., Kreil, S., Zoi, K., Waghorn, K., Curtis, C., Zhang, L., Score, J., Seear, R., Chase, A. J., Grand, F. H., White, H., Zoi, C., Loukopoulos, D., Terpos, E., Vervessou, E.-C., Schultheis, B., Emig, M., Ernst, T., Lengfelder, E., Hehlmann, R., Hochhaus, A., Oscier, D., Silver, R. T., Reiter, A., Cross, N. C. P.
(2005). Widespread occurrence of the JAK2 V617F mutation in chronic myeloproliferative disorders. Blood
106: 2162-2168
[Abstract][Full Text]
Tefferi, A., Gilliland, D. G.
(2005). The JAK2V617F Tyrosine Kinase Mutation in Myeloproliferative Disorders: Status Report and Immediate Implications for Disease Classification and Diagnosis. Mayo Clin Proc.
80: 947-958
[Abstract]
Kaushansky, K.
(2005). On the molecular origins of the chronic myeloproliferative disorders: it all makes sense. Blood
105: 4187-4190
[Full Text]
Vainchenker, W., Constantinescu, S. N.
(2005). A Unique Activating Mutation in JAK2 (V617F) Is at the Origin of Polycythemia Vera and Allows a New Classification of Myeloproliferative Diseases. ASH Education Book
2005: 195-200
[Abstract][Full Text]
Campbell, P. J., Green, A. R.
(2005). Management of Polycythemia Vera and Essential Thrombocythemia. ASH Education Book
2005: 201-208
[Abstract][Full Text]
Kaushansky, K.
(2005). On the Molecular Origins of the Chronic Myeloproliferative Disorders: It All Makes Sense. ASH Education Book
2005: 533-537
[Full Text]
Tenedini, E., Fagioli, M. E., Vianelli, N., Tazzari, P. L., Ricci, F., Tagliafico, E., Ricci, P., Gugliotta, L., Martinelli, G., Tura, S., Baccarani, M., Ferrari, S., Catani, L.
(2004). Gene expression profiling of normal and malignant CD34-derived megakaryocytic cells. Blood
104: 3126-3135
[Abstract][Full Text]
Carlsson, G., Aprikyan, A. A. G., Tehranchi, R., Dale, D. C., Porwit, A., Hellstrom-Lindberg, E., Palmblad, J., Henter, J.-I., Fadeel, B.
(2004). Kostmann syndrome: severe congenital neutropenia associated with defective expression of Bcl-2, constitutive mitochondrial release of cytochrome c, and excessive apoptosis of myeloid progenitor cells. Blood
103: 3355-3361
[Abstract][Full Text]
Xu, M.-j., Sui, X., Zhao, R., Dai, C., Krantz, S. B., Zhao, Z. J.
(2003). PTP-MEG2 is activated in polycythemia vera erythroid progenitor cells and is required for growth and expansion of erythroid cells. Blood
102: 4354-4360
[Abstract][Full Text]
Acosta, J. C., Richard, C., Delgado, M. D., Horita, M., Rizzo, M. G., Fernandez-Luna, J. L., Leon, J.
(2003). Amifostine impairs p53-mediated apoptosis of human myeloid leukemia cells. Molecular Cancer Therapeutics
2: 893-900
[Abstract][Full Text]
Pellagatti, A., Vetrie, D., Langford, C. F., Gama, S., Eagleton, H., Wainscoat, J. S., Boultwood, J.
(2003). Gene Expression Profiling in Polycythemia Vera Using cDNA Microarray Technology. Cancer Res.
63: 3940-3944
[Abstract][Full Text]
Aerbajinai, W., Giattina, M., Lee, Y. T., Raffeld, M., Miller, J. L.
(2003). The proapoptotic factor Nix is coexpressed with Bcl-xL during terminal erythroid differentiation. Blood
102: 712-717
[Abstract][Full Text]
Gray, H. E., Weigand, C. M., Cottrill, N. B., Willis, A. M., Morgan, R. V.
(2003). Polycythemia Vera in a Dog Presenting With Uveitis. Journal of the American Animal Hospital Association
39: 355-360
[Abstract][Full Text]
Tefferi, A.
(2003). Polycythemia Vera: A Comprehensive Review and Clinical Recommendations. Mayo Clin Proc.
78: 174-194
[Abstract]
Spivak, J. L.
(2002). Polycythemia vera: myths, mechanisms, and management. Blood
100: 4272-4290
[Full Text]
Giraudier, S., Chagraoui, H., Komura, E., Barnache, S., Blanchet, B., LeCouedic, J. P., Smith, D. F., Larbret, F., Taksin, A.-L., Moreau-Gachelin, F., Casadevall, N., Tulliez, M., Hulin, A., Debili, N., Vainchenker, W.
(2002). Overexpression of FKBP51 in idiopathic myelofibrosis regulates the growth factor independence of megakaryocyte progenitors. Blood
100: 2932-2940
[Abstract][Full Text]
Itoh, J, de la Motte, C, Strong, S A, Levine, A D, Fiocchi, C
(2001). Decreased Bax expression by mucosal T cells favours resistance to apoptosis in Crohn's disease. Gut
49: 35-41
[Abstract][Full Text]
Dai, C., Krantz, S. B.
(2001). Increased expression of the INK4a/ARF locus in polycythemia vera. Blood
97: 3424-3432
[Abstract][Full Text]
Weinstein, R. S., Nicholas, R. W., Manolagas, S. C.
(2000). Apoptosis of Osteocytes in Glucocorticoid-Induced Osteonecrosis of the Hip. J. Clin. Endocrinol. Metab.
85: 2907-2912
[Abstract][Full Text]
Klippel, S., Strunck, E., Roder, S., Lubbert, M., Lange, W., Azemar, M., Meinhardt, G., Schaefer, H.-E., Pahl, H. L.
(2000). Cloning of PRV-1, a novel member of the uPAR receptor superfamily, which is overexpressed in polycythemia rubra vera. Blood
95: 2569-2576
[Abstract][Full Text]
Pearson, T. C., Messinezy, M., Westwood, N., Green, A. R., Bench, A. J., Green, A. R., Huntly, B. J.P., Nacheva, E. P., Barbui, T., Finazzi, G.
(2000). A Polycythemia Vera Update: Diagnosis, Pathobiology, and Treatment. ASH Education Book
2000: 51-68
[Abstract][Full Text]
Silva, M., Benito, A., Sanz, C., Prosper, F., Ekhterae, D., Nunez, G., Fernandez-Luna, J. L.
(1999). Erythropoietin Can Induce the Expression of Bcl-xL through Stat5 in Erythropoietin-dependent Progenitor Cell Lines. J. Biol. Chem.
274: 22165-22169
[Abstract][Full Text]
Packham, G., White, E. L., Eischen, C. M., Yang, H., Parganas, E., Ihle, J. N., Grillot, D. A.M., Zambetti, G. P., Nuñez, G., Cleveland, J. L.
(1998). Selective regulation of Bcl-XL by a Jak kinase-dependent pathway is bypassed in murine hematopoietic malignancies. Genes Dev.
12: 2475-2487
[Abstract][Full Text]
Sinkovics, J. G., Horvath, J. C., Savitz, S., Hetts, S. W.
(1998). Role of Apoptosis in Health and Disease. JAMA
279: 1699-1700
[Full Text]
Schwartz, R. S.
(1998). Polycythemia Vera -- Chance, Death, and Mutability. NEJM
338: 613-615
[Full Text]