FREE NEJM E-TOC    HOME   |   SUBSCRIBE   |   CURRENT ISSUE   |   PAST ISSUES   |   COLLECTIONS   |   Search Term  Advanced Search

Sign in | Get NEJM's E-Mail Table of Contents — Free | Subscribe

Previous Volume 339:653-658 September 3, 1998 Number 10 Next

Abstract PDF Editorial by Durie, P. R. Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited PubMed Citation

ABSTRACT

Background It is unknown whether genetic factors predispose patients to idiopathic pancreatitis. In patients with cystic fibrosis, mutations of the cystic fibrosis transmembrane conductance regulator (CFTR ) gene typically cause pulmonary and pancreatic insufficiency while rarely causing pancreatitis. We examined whether idiopathic pancreatitis is associated with CFTR mutations in persons who do not have lung disease of cystic fibrosis.

Methods We studied 27 patients (mean age at diagnosis, 36 years), 22 of whom were female, who had been referred for an evaluation of idiopathic pancreatitis. DNA was tested for 17 CFTR mutations and for the 5T allele in intron 8 of the CFTR gene. The 5T allele reduces the level of functional CFTR and is associated with an inherited form of infertility in males. Patients with two abnormal CFTR alleles were further evaluated for unrecognized cystic fibrosis–related lung disease, and both base-line and CFTR-mediated ion transport were measured in the nasal mucosa.

Results Ten patients with idiopathic chronic pancreatitis (37 percent) had at least one abnormal CFTR allele. Eight CFTR mutations were detected (prevalence ratio, 11:1; 95 percent confidence interval, 5 to 23; P<0.001). In three patients both alleles were affected (prevalence ratio, 80:1; 95 percent confidence interval, 17 to 379; P<0.001). These three patients did not have lung disease typical of cystic fibrosis on the basis of sweat testing, spirometry, or base-line nasal potential-difference measurements. Nonetheless, each had abnormal nasal cyclic AMP–mediated chloride transport.

Conclusions In a group of patients referred for evaluation of idiopathic pancreatitis, there was a strong association between mutations in the CFTR gene and pancreatitis. The abnormal CFTR genotypes in these patients with pancreatitis resemble those associated with male infertility.

The most common inherited disease of the exocrine pancreas is cystic fibrosis.^5,6,7,8 In cystic fibrosis, mutations of the cystic fibrosis transmembrane conductance regulator (CF TR) gene lead to dysfunction of the lung, sweat glands, vas deferens, and pancreas. Lung disease accounts for most of the complications and deaths related to cystic fibrosis. In persons with normal lung function, CF TR mutations cause one type of male infertility, congenital (bilateral) absence of the vas deferens.^9,10,11,12

The association of abnormal CF TR genotypes with congenital absence of the vas deferens led us to consider whether the gene has a role in idiopathic chronic pancreatitis. Even though the pancreatic disease in patients with cystic fibrosis does not usually resemble pancreatitis clinically, two factors suggested that CF TR has a role. First, both conditions are often associated with abnormal sweat electrolyte values.^13,14 Second, in both conditions, the earliest pathological finding is pancreatic ductal obstruction due to inspissated secretions,^15,16 and the ducts are normally the predominant site of CFTR protein in the pancreas.¹⁷ Because pancreatitis occasionally occurs in patients with cystic fibrosis^5,18 and because CF TR mutations are common, we examined whether abnormal CF TR genotypes are predisposing factors for idiopathic pancreatitis.

Methods

Selection of Patients

The records of all white patients who were referred to Duke University Medical Center in North Carolina from 1991 to 1996 for an evaluation of chronic pancreatitis were reviewed. Among 32 patients with idiopathic pancreatitis, 27 provided written informed consent and participated in the study. The study protocol was approved by the medical center's institutional review board. Each patient had had at least two episodes of pancreatitis at least six months apart. Each episode met at least two of the three criteria: abdominal pain typical of pancreatitis, an elevation of serum amylase or lipase (more than three times the upper limit of the normal range), and evidence of pancreatitis on abdominal computed tomography. Exclusion criteria included the ingestion of more than 15 alcoholic drinks per week at any time; the presence of hyperlipidemia, pancreatic cancer, pancreas divisum, or dysfunction of the sphincter of Oddi; and the onset of pancreatitis after the age of 65 years. Patients were also excluded if their pancreatitis was related to trauma, gallstones, drugs, or autosomal dominant pancreatitis. Twenty-two of the patients were female (81 percent); this preponderance may have resulted from the exclusion of many male patients because of alcohol use. The mean age at the diagnosis of pancreatitis was 36 years (range, 12 to 65). Pancreatograms were assessed for the severity of chronic pancreatitis according to published criteria by a reviewer who was unaware of the patients' histories (Table 1).¹⁹

View this table: [in this window] [in a new window]   Table 1. Characteristics of 27 Patients with Idiopathic Pancreatitis.

 
DNA Studies

We extracted DNA from blood samples²⁰ and tested for 16 CF TR mutations — F508, W1282X, R117H, 621+1(GT), R334W, R347P, A455E, I507, 1717–1(GA), G542X, S549N, G551D, R553X, R560T, N1303K, and 3849+10Kb(CT) — using reverse dot blot strips (Roche Molecular Systems, Alameda, Calif.). DNA was also tested for the G85E mutation.²¹ The length of the sequence of thymidines in intron 8 of the CF TR gene was determined with three allele-specific polymerase chain reactions per sample. The common forward primer was 5'TAATGGATCATGGGCCATGT3'. The reverse primers were 5'CCCCAAATCCCTGTTAAAAAC3', 5'CCCCAAATCCCTGTTAAAAAAAC3', and 5'CCCCAAATCCCTGTTAAAAAAAAAC3' for the 5T, 7T, and 9T alleles, respectively. For each reaction, the dystrophin gene (exon 16) was used as an internal amplification control.²² A sequence of five thymidines in the polyT region is associated with low levels of normal CFTR messenger RNA (mRNA).

Tests of the Transepithelial Nasal Potential Difference

The transepithelial nasal potential difference was assessed to evaluate CFTR-mediated chloride transport in vivo.²³ Briefly, bioelectric responses were measured during perfusion with solutions containing amiloride, gluconate plus amiloride, and isoproterenol, gluconate, and amiloride to determine the combined effect of removing chloride and activating intracellular cyclic AMP.

Statistical Analysis

Differences between groups were compared with the Wilcoxon rank-sum test.²⁴ All P values are two-tailed. Differences between the expected and observed frequencies of mutations or genotypes were evaluated with a binomial distribution for 54 alleles or 27 patients. This analysis depends on the reliability of data on the prevalence of CF TR alleles. The expected frequency of various abnormal alleles was estimated as follows. The frequency of cystic fibrosis among U.S. whites is 1 in 3003.⁶ Among the 2200 white persons who have been genotyped at our medical center, consisting of patients with cystic fibrosis and carriers, the 17 mutations that we tested for in the current study accounted for 75 percent of all alleles causing cystic fibrosis, and half of all patients with cystic fibrosis were homozygous for F508.²⁵ The frequency of the 5T allele is 5 percent among whites tested at our medical center²² and elsewhere.^10,11,12 Thus, the expected frequency of genotypes consisting of one of the tested mutations on one chromosome and the 5T allele on the other chromosome is 1 in 731 (2 x 3003^–0.5 x 0.75 x 0.05). Finally, patients who were homozygous for F508 would have been excluded from this study because this genotype almost invariably causes clinically significant lung disease. Thus, the expected frequency of genotypes affecting both alleles (carriers of a CF TR mutation on one chromosome and the 5T allele on the other [1/731] plus subjects who are homozygous and compound heterozygotes for the tested mutations [0.75²/3003] minus those who are homozygous for F508 [0.5/3003]) is 1 in 720 (1/731 + 0.75²/3003 – 1/6006).

Results

Table 1 summarizes the CF TR genotypes for the 27 patients with idiopathic pancreatitis. Three different mutations were detected: F508 in five patients, R117H in two, and N1303K in one, for a total of eight. Thus, CF TR mutations were found at 11 times the expected frequency (95 percent confidence interval, 5 to 23; P<0.001) (Table 2).

View this table: [in this window] [in a new window]   Table 2. Association of Abnormal CF TR Genotypes with Idiopathic Pancreatitis.

 
Patients were also tested for the 5T allele (Figure 1), and it was present in 5 of the 27 patients. This variant reduces the efficiency of exon 9 splicing and thereby reduces the expression of functional CFTR in patients who have a mutation that causes cystic fibrosis on one chromosome and the 5T allele on the other chromosome.^26,27 Patients with these genotypes resemble patients with cystic fibrosis in that they have congenital absence of the vas deferens, but differ because they do not have lung disease. By contrast, when the 7T or 9T allele is present, there are sufficient levels of properly spliced CFTR and these alleles do not cause congenital absence of the vas deferens.

View larger version (47K): [in this window] [in a new window]   Figure 1. Allele-Specific Polymerase-Chain-Reaction Analysis of the PolyT Sequence of Intron 8 of the CF TR Gene. Three reactions were performed for each DNA sample, with specific primers for the 5T, 7T, and 9T alleles (labeled 5, 7, and 9, respectively). Patient 8 had the 5T/7T genotype, Patient 16 had the 7T/7T genotype, Patient 3 had the 5T/9T genotype, Patient 1 had the 7T/9T genotype, and a control sample shows all three alleles. The band at 290 bp in all reactions is an internal amplification control. The first lane shows size markers.

 
A total of 10 patients had CF TR mutations or the 5T allele or both (Table 1). None had lung disease typical of cystic fibrosis on the basis of a clinical history or a recent chest film. These 10 patients were 33 years of age on average when pancreatitis was diagnosed and were hospitalized for pancreatitis a total of 116 times (approximately 12 times per patient) during a mean observation period of five years after diagnosis. Nine of the 10 had abnormal findings on pancreatography consistent with a diagnosis of chronic pancreatitis.¹⁹ Four of the 10 (Patients 1, 6, 7, and 8 in Table 1) required pancreatic surgery for pain management. The other 17 patients were similar to these 10 with respect to the age at diagnosis and the severity of pancreatitis.

In three patients both CF TR alleles were affected, a frequency that was 80 times the expected rate (95 percent confidence interval, 17 to 379; P<0.001) (Table 2). The genotypes of these three patients (F508/wild type, 9T/5T in two and F508/R117H, 9T/7T in one) are the two most common in patients with congenital absence of the vas deferens.^10,11,12,27 These genotypes do not typically cause lung disease. In contrast, lung disease is present in patients with a genotype of F508/R117H, 9T/5T.²⁸

The three patients with abnormalities of both CF TR alleles were further evaluated to determine whether they had unrecognized cystic fibrosis–related lung disease (Table 3). None had sweat chloride values diagnostic of cystic fibrosis in adults. Their base-line nasal potential-difference values ranged from –24 to –21 mV, values similar to the mean value of –22 mV in normal adults.²³ Two patients reported no chronic pulmonary symptoms and had normal results on spirometry. In the third patient, the forced expiratory volume in one second was 58 percent of the predicted value. Her sputum contained normal flora, and the abnormal value for forced expiratory volume in one second seemed most consistent with a diagnosis of chronic obstructive pulmonary disease due to cigarette use (2 packs per day). Thus, none of the patients fulfilled traditional diagnostic criteria for the classic cystic fibrosis phenotype.^5,7,8 However, one of the three patients had congenital absence of the vas deferens, and his sputum contained smooth Pseudomonas aeruginosa during an episode of acute bronchitis. (Recovery of either smooth or mucoid strains of P. aeruginosa from sputum is unusual during episodes of acute bronchitis in persons who do not have cystic fibrosis; however, the mucoid strain is specifically associated with cystic fibrosis.) Taken together with his genotype, this constellation of findings is suggestive of an atypical cystic fibrosis phenotype.^5,8

View this table: [in this window] [in a new window]   Table 3. Characteristics of Three Patients with Idiopathic Pancreatitis and Two Abnormal CF TR Alleles.

 
To assess CFTR-mediated ion transport more directly, we measured the nasal potential-difference responses in these three patients. The combined response to the chloride-free maneuver and stimulation by isoproterenol may be a more accurate indicator of CFTR function than the sweat test.²³ The changes in values were +4.5, +1.5, and –5.0 mV in the three patients. These values differed significantly from those measured in 20 normal adults (range, –16 to –44 mV; mean, –31 mV; P<0.01) and resembled the values in 23 adults with cystic fibrosis (range, –3 to +12 mV; mean, +5 mV).²³

Discussion

We found a strong association between chronic pancreatitis and CF TR mutations among 27 patients who were referred for endoscopic evaluation of idiopathic chronic pancreatitis. In these patients, the frequency of a single CF TR mutation was 11 times the expected frequency and the frequency of two abnormal alleles was 80 times the expected frequency.

In three patients, both copies of the CF TR gene were affected. These patients had the CF TR genotypes that are most commonly seen in patients with congenital absence of the vas deferens. In such patients, CFTR function is reduced by roughly 90 percent, leading to abnormal nasal chloride transport and congenital absence of the vas deferens but not pancreatic insufficiency, lung disease, or sweat-duct abnormalities.^7,11 Data on our three patients with idiopathic pancreatitis and these CF TR genotypes suggest that their phenotype is similar to that of patients with congenital absence of the vas deferens and these genotypes. Specifically, nasal potential-difference responses of each patient showed defective CFTR-mediated ion transport even though none had sweat chloride values diagnostic of cystic fibrosis or evidence of lung disease. Taken together, these findings suggest that in this group of patients, abnormal CF TR genotypes cause pancreatitis as one component of an inherited syndrome affecting multiple epithelial tissues and that such patients should be examined for congenital absence of the vas deferens^9,10,11,12 and sinusitis,^22,29 which are not typical of pancreatitis.

Seven patients had an abnormality in only one copy of the CF TR gene. This finding requires cautious interpretation because DNA samples were tested for only 17 of the more than 500 CF TR mutations associated with cystic fibrosis.³⁰ Therefore, it is possible that more comprehensive DNA testing (e.g., with single-strand conformation polymorphism analysis) might detect additional mutations. If so, the true magnitude of the association between CF TR mutations and pancreatitis was underestimated by our data. Moreover, it is possible that some of the seven patients may actually be compound heterozygotes with a second mutation that was not detected. Thus, on the basis of our data, we could not determine whether having one copy of an abnormal CF TR allele (as is found in carriers of cystic fibrosis) is sufficient to predispose persons to pancreatitis.

Our study calls attention to the relation between CF TR genotypes and pancreatitis. Pancreatitis occurs in 1 to 2 percent of patients with cystic fibrosis, with progression to chronic pancreatitis in a minority of these patients.^5,18 The absence of clinical pancreatitis in most patients with cystic fibrosis is in agreement with the histopathological findings in such patients: there is extensive fibrosis without prominent inflammation.¹⁶ When pancreatitis does develop in patients with cystic fibrosis, lung disease is usually evident. Nonetheless, there have been occasional reports of pancreatitis in patients with cystic fibrosis before the onset of lung disease.^{18,31,32,33,34} Pancreatitis occurred before the age of 23 years in each instance, suggesting that pancreatitis may herald the diagnosis of cystic fibrosis in young adults.⁸ Our findings suggest that unexplained pancreatitis in older adults may also be an indicator of mutations in the CF TR gene.

Emerging data indicate that cystic fibrosis affects different organs to a varying but predictable extent, depending on the CF TR genotype.^7,8 Genotypes that result in a reduction of functional CFTR to 1 percent of normal values cause classic cystic fibrosis consisting of pancreatic insufficiency, lung disease, abnormal sweat chloride concentrations, and congenital absence of the vas deferens. Genotypes that result in a reduction of functional CFTR to 5 percent of normal values cause cystic fibrosis without pancreatic insufficiency, consisting of lung disease, abnormal sweat chloride concentrations, and congenital absence of the vas deferens. Genotypes that result in a reduction of functional CFTR to 10 percent of normal values cause congenital absence of the vas deferens alone. Thus, one can infer that each manifestation of cystic fibrosis is associated with a reduction of CFTR levels below a tissue-specific threshold value (10 percent of normal levels in the case of vas deferens abnormalities, 5 percent in the case of lung and sweat-gland abnormalities, and 1 percent in the case of abnormalities of the exocrine pancreas).

Our data expand on these findings in two respects. First, they suggest that the pancreas and the vas deferens are both relatively susceptible to injury resulting from reduced CFTR levels. Thus, pancreatitis and congenital absence of the vas deferens are clinical manifestations of genotypes that cause relatively mild impairment of CFTR function. Second, they indicate that the pancreas differs from the lung, sweat gland, and vas deferens in that it is affected in qualitatively different ways depending on the degree to which CFTR function is impaired. Severe impairment causes pancreatic insufficiency, and less severe impairment causes pancreatitis. Available evidence suggests that the main role of CFTR in the normal human pancreas is to promote the dilution and alkalinization of pancreatic juice.¹⁷ Thus, depending on the extent to which CFTR function is reduced, either of these two distinct patterns of pancreatic dysfunction can develop.

Our study has implications for the pathogenesis and classification of pancreatitis. It raises the remote possibility that CF TR mutations may increase the risk of pancreatitis after exposure to alcohol or certain drugs, and it identifies a subgroup of patients with idiopathic pancreatitis who have abnormalities of both CF TR alleles. Since pancreatitis in these patients apparently results from defective CFTR function, genetic testing to identify patients at risk may be useful and may increase our understanding of the clinical course of these patients and their response to therapy.

Supported in part by grants from the National Institutes of Health (RR0006, HL34322, and DK40701), the Department of Veterans Affairs, and the Cystic Fibrosis Foundation.

We are indebted to C.Q. Lee, Z. Zhou, J. Kole, and L. Chien for technical assistance.

Source Information

From the Department of Medicine, Veterans Affairs and Duke University Medical Centers, Durham, N.C. (J.A.C., P.S.J.); and the Departments of Pathology and Laboratory Medicine (K.J.F., L.M.S.) and the Department of Medicine (P.G.N., M.R.K.), University of North Carolina, Chapel Hill.

Address reprint requests to Dr. Cohn at Box 3378, Duke University Medical Center, Durham, NC 27710.

References

1. Steer ML, Waxman I, Freedman S. Chronic pancreatitis. N Engl J Med 1995;332:1482-1490. [Free Full Text]
2. Haber P, Wilson J, Apte M, Korsten M, Pirola R. Individual susceptibility to alcoholic pancreatitis: still an enigma. J Lab Clin Med 1995;125:305-312. [Medline]
3. Whitcomb DC, Gorry MC, Preston RA, et al. Hereditary pancreatitis is caused by a mutation in the cationic trypsinogen gene. Nat Genet 1996;14:141-145. [CrossRef][Medline]
4. Liddle RA, Cohn JA. Hereditary diseases of the pancreas. In: Yamada T, Alpers DH, Owyang C, Powell DW, Silverstein FE, eds. Textbook of gastroenterology. 3rd ed. New York: J.B. Lippincott (in press).
5. Welsh MJ, Tsui L-C, Boat TF, Beaudet AL. Cystic fibrosis. In: Scriver CR, Beaudet AL, Sly WS, Valle D, eds. The metabolic and molecular bases of inherited disease. 7th ed. Vol. 3. New York: McGraw-Hill, 1995:3799-876.
6. Hamosh A, FitzSimmons SC, Macek M Jr, et al. New CF incidence data and phenotype-genotype comparison of African-American and Caucasian CF patients. Pediatr Pulmonol 1996;22:Suppl 13:104-105. 
7. Davis PB, Drumm M, Konstan MW. Cystic fibrosis. Am J Respir Crit Care Med 1996;154:1229-1256. [Medline]
8. Stern RC. The diagnosis of cystic fibrosis. N Engl J Med 1997;336:487-491. [Free Full Text]
9. Anguiano A, Oates RD, Amos JA, et al. Congenital bilateral absence of the vas deferens: a primarily genital form of cystic fibrosis. JAMA 1992;267:1794-1797. [Abstract]
10. Costes B, Girodon E, Ghanem N, et al. Frequent occurrence of the CFTR intron 8 (TG)n 5T allele in men with congenital bilateral absence of the vas deferens. Eur J Hum Genet 1995;3:285-293. [Medline]
11. Chillón M, Casals T, Mercier B, et al. Mutations in the cystic fibrosis gene in patients with congenital absence of the vas deferens. N Engl J Med 1995;332:1475-1480. [Free Full Text]
12. Dumur V, Gervais R, Rigot JM, et al. Congenital bilateral absence of the vas deferens (CBAVD) and cystic fibrosis transmembrane regulator (CFTR): correlation between genotype and phenotype. Hum Genet 1996;97:7-10. [CrossRef][Medline]
13. Bank S, Marks IN, Novis B. Sweat electrolytes in chronic pancreatitis. Am J Dig Dis 1978;23:178-181. [CrossRef][Medline]
14. Hanawa M, Takebe T, Takahashi S, Koizumi M, Endo K. The significance of the sweat test in chronic pancreatitis. Tohoku J Exp Med 1978;125:59-69. [Medline]
15. De Angelis C, Valente G, Spaccapietra M, et al. Histological study of alcoholic, nonalcoholic, and obstructive chronic pancreatitis. Pancreas 1992;7:193-196. [Medline]
16. Oppenheimer EH, Esterly JR. Pathology of cystic fibrosis: review of the literature and comparison with 146 autopsied cases. Perspect Pediatr Pathol 1975;2:241-278. [Medline]
17. Marino CR, Matovcik LM, Gorelick FS, Cohn JA. Localization of the cystic fibrosis transmembrane conductance regulator in pancreas. J Clin Invest 1991;88:712-716.
18. Shwachman H, Lebenthal E, Khaw KT. Recurrent acute pancreatitis in patients with cystic fibrosis with normal pancreatic enzymes. Pediatrics 1975;55:86-95. [Free Full Text]
19. Axon ATR, Classen M, Cotton PB, Cremer M, Freeny PC, Lees WR. Pancreatography in chronic pancreatitis: international definitions. Gut 1984;25:1107-1112. [Free Full Text]
20. Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 1988;16:1215-1215. [Free Full Text]
21. Zielenski J, Bozon D, Kerem BS, et al. Identification of mutations in exons 1 through 8 of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. Genomics 1991;10:229-235. [CrossRef][Medline]
22. Friedman KJ, Heim RA, Knowles MR, Silverman LM. Rapid characterization of the variable length polythymidine tract in the cystic fibrosis (CFTR) gene: association of the 5T allele with selected CFTR mutations and its incidence in atypical sinopulmonary disease. Hum Mutat 1997;10:108-115. [CrossRef][Medline]
23. Knowles MR, Paradiso AM, Boucher RC. In vivo nasal potential difference: techniques and protocols for assessing efficacy of gene transfer in cystic fibrosis. Hum Gene Ther 1995;6:445-455. [Medline]
24. Diem K, Lentner C. Scientific tables. 7th ed. Basel, Switzerland: Ciba-Geigy, 1970.
25. Population variation of common cystic fibrosis mutations: the Cystic Fibrosis Genetic Analysis Consortium. Hum Mutat 1994;4:167-177. [CrossRef][Medline]
26. Chu CS, Trapnell BC, Curristin S, Cutting GR, Crystal RG. Genetic basis of variable exon 9 skipping in cystic fibrosis transmembrane conductance regulator mRNA. Nat Genet 1993;3:151-156. [CrossRef][Medline]
27. Rave-Harel N, Kerem E, Nissim-Rafinia M, et al. The molecular basis of partial penetrance of splicing mutations in cystic fibrosis. Am J Hum Genet 1997;60:87-94. [Medline]
28. Kiesewetter S, Macek M Jr, Davis C, et al. A mutation in CFTR produces different phenotypes depending on chromosomal background. Nat Genet 1993;5:274-278. [CrossRef][Medline]
29. Kerem E, Rave-Harel N, Augarten A, et al. A cystic fibrosis transmembrane conductance regulator splice variant with partial penetrance associated with variable cystic fibrosis presentations. Am J Respir Crit Care Med 1997;155:1914-1920. [Abstract]
30. Zielenski J, Tsue LC. Cystic fibrosis: genotypic and phenotypic variation. Annu Rev Genet 1995;29:777-807. [CrossRef][Medline]
31. Masaryk TJ, Achkar E. Pancreatitis as initial presentation of cystic fibrosis in young adults: a report of two cases. Dig Dis Sci 1983;28:874-878. [CrossRef][Medline]
32. Gross V, Schoelmerich J, Denzel K, Gerok W. Relapsing pancreatitis as initial manifestation of cystic fibrosis in a young man without pulmonary disease. Int J Pancreatol 1989;4:221-228. [Medline]
33. Atlas AB, Orenstein SR, Orenstein DM. Pancreatitis in young children with cystic fibrosis. J Pediatr 1992;120:756-759. [CrossRef][Medline]
34. Blustein PK, Gaskin K, Filler R, Ho CS, Connon J. Endoscopic retrograde cholangiopancreatography in pancreatitis in children and adolescents. Pediatrics 1981;68:387-393. [Free Full Text]

Abstract PDF Editorial by Durie, P. R. Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited PubMed Citation

This article has been cited by other articles:

• Audrezet, M.-P., Dabricot, A., Le Marechal, C., Ferec, C. (2008). Validation of High-Resolution DNA Melting Analysis for Mutation Scanning of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) Gene. J. Mol. Diagn. 10: 424-434 [Abstract] [Full Text]  
• Costa, C., Costa, J.-M., Martin, J., Boissier, B., Goossens, M., Girodon, E. (2008). Multiplex Allele-Specific Fluorescent PCR for Haplotyping the IVS8 (TG)m(T)n Locus in the CFTR Gene. Clin. Chem. 54: 1564-1567 [Abstract] [Full Text]  
• Callery, M. P., Freedman, S. D. (2008). A 21-Year-Old Man With Chronic Pancreatitis. JAMA 299: 1588-1594 [Abstract] [Full Text]  
• Chang, Y.-T., Chang, M.-C., Su, T.-C., Liang, P.-C., Su, Y.-N., Kuo, C.-H., Wei, S.-C., Wong, J.-M. (2008). Association of Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) Mutation/Variant/Haplotype and Tumor Necrosis Factor (TNF) Promoter Polymorphism in Hyperlipidemic Pancreatitis. Clin. Chem. 54: 131-138 [Abstract] [Full Text]  
• Boyle, M. P. (2007). Adult Cystic Fibrosis. JAMA 298: 1787-1793 [Abstract] [Full Text]  
• Wilschanski, M., Durie, P. R (2007). Patterns of GI disease in adulthood associated with mutations in the CFTR gene. Gut 56: 1153-1163 [Full Text]  
• Ratbi, I., Legendre, M., Niel, F., Martin, J., Soufir, J.-C., Izard, V., Costes, B., Costa, C., Goossens, M., Girodon, E. (2007). Detection of cystic fibrosis transmembrane conductance regulator (CFTR) gene rearrangements enriches the mutation spectrum in congenital bilateral absence of the vas deferens and impacts on genetic counselling. Hum Reprod 22: 1285-1291 [Abstract] [Full Text]  
• Bush, A. (2007). Update in Pediatric Lung Disease 2006. Am. J. Respir. Crit. Care Med. 175: 532-540 [Full Text]  
• Wilschanski, M., Dupuis, A., Ellis, L., Jarvi, K., Zielenski, J., Tullis, E., Martin, S., Corey, M., Tsui, L.-C., Durie, P. (2006). Mutations in the Cystic Fibrosis Transmembrane Regulator Gene and In Vivo Transepithelial Potentials. Am. J. Respir. Crit. Care Med. 174: 787-794 [Abstract] [Full Text]  
• Faa, V., Bettoli, P. P., Demurtas, M., Zanda, M., Ferri, V., Cao, A., Rosatelli, M. C. (2006). A New Insertion/Deletion of the Cystic Fibrosis Transmembrane Conductance Regulator Gene Accounts for 3.4% of Cystic Fibrosis Mutations in Sardinia: Implications for Population Screening. J. Mol. Diagn. 8: 499-503 [Abstract] [Full Text]  
• Sanchez-Fermin, P., Ukleja, A., Cruz-Correa, M. (2006). Successful Long-Term Jejunostomy Feedings in Relapsing Pancreatitis: A Case Report. JPEN J Parenter Enteral Nutr 30: 251-253 [Abstract] [Full Text]  
• Davis, P. B. (2006). Cystic Fibrosis Since 1938. Am. J. Respir. Crit. Care Med. 173: 475-482 [Abstract] [Full Text]  
• Arduino, C, Salacone, P, Pasini, B, Brusco, A, Salmin, P, Bacillo, E, Robecchi, A, Cestino, L, Cirillo, S, Regge, D, Cappello, N, Gaia, E (2005). Association of a new cationic trypsinogen gene mutation (V39A) with chronic pancreatitis in an Italian family. Gut 54: 1663-1664 [Full Text]  
• Verlaan, M, Drenth, J P H, Truninger, K, Koudova, M, Schulz, H-U, Bargetzi, M, Kunzli, B, Friess, H, Cerny, M, Kage, A, Landt, O, te Morsche, R H M, Rosendahl, J, Luck, W, Nickel, R, Halangk, J, Becker, M, Macek, M Jr, Jansen, J B M J, Witt, H (2005). Polymorphisms of UDP-glucuronosyltransferase 1A7 are not involved in pancreatic diseases. J. Med. Genet. 42: e62-e62 [Abstract] [Full Text]  
• Weiss, F U, Simon, P, Bogdanova, N, Mayerle, J, Dworniczak, B, Horst, J, Lerch, M M (2005). Complete cystic fibrosis transmembrane conductance regulator gene sequencing in patients with idiopathic chronic pancreatitis and controls. Gut 54: 1456-1460 [Abstract] [Full Text]  
• Howell, W M, Pead, P J, Shek, F W, Rose-Zerilli, M J, Armstrong, T, Johnson, C D, Fine, D R, Iredale, J P, Bateman, A C (2005). Influence of cytokine and ICAM-1 gene polymorphisms on susceptibility to chronic pancreatitis. J. Clin. Pathol. 58: 595-599 [Abstract] [Full Text]  
• Rowe, S. M., Miller, S., Sorscher, E. J. (2005). Cystic Fibrosis. NEJM 352: 1992-2001 [Full Text]  
• Idris, M M, Bhaskar, S, Reddy, D N, Mani, K R, Rao, G V, Singh, L, Chandak, G R (2005). Mutations in anionic trypsinogen gene are not associated with tropical calcific pancreatitis. Gut 54: 728-729 [Full Text]  
• Sermet-Gaudelus, I., Dechaux, M., Vallee, B., Fajac, A., Girodon, E., Nguyen-Khoa, T., Marianovski, R., Hurbain, I., Bresson, J. L., Lenoir, G., Edelman, A. (2005). Chloride Transport in Nasal Ciliated Cells of Cystic Fibrosis Heterozygotes. Am. J. Respir. Crit. Care Med. 171: 1026-1031 [Abstract] [Full Text]  
• De Boeck, K., Weren, M., Proesmans, M., Kerem, E. (2005). Pancreatitis Among Patients With Cystic Fibrosis: Correlation With Pancreatic Status and Genotype. Pediatrics 115: e463-e469 [Abstract] [Full Text]  
• Wang, X., Kim, J., McWilliams, R., Cutting, G. R. (2005). Increased Prevalence of Chronic Rhinosinusitis in Carriers of a Cystic Fibrosis Mutation. Arch Otolaryngol Head Neck Surg 131: 237-240 [Abstract] [Full Text]  
• Whitcomb, D C (2004). Value of genetic testing in the management of pancreatitis. Gut 53: 1710-1717 [Full Text]  
• Niel, F, Martin, J, Dastot-Le Moal, F, Costes, B, Boissier, B, Delattre, V, Goossens, M, Girodon, E (2004). Rapid detection of CFTR gene rearrangements impacts on genetic counselling in cystic fibrosis. J. Med. Genet. 41: e118-e118 [Full Text]  
• Southernl, K W, Peckham, D (2004). Establishing a diagnosis of cystic fibrosis. Chronic Respiratory Disease 1: 205-210 [Abstract]  
• Gilljam, M., Ellis, L., Corey, M., Zielenski, J., Durie, P., Tullis, D. E. (2004). Clinical Manifestations of Cystic Fibrosis Among Patients With Diagnosis in Adulthood. Chest 126: 1215-1224 [Abstract] [Full Text]  
• Zaman, M. M., Gelrud, A., Junaidi, O., Regan, M. M., Warny, M., Shea, J. C., Kelly, C., O'Sullivan, B. P., Freedman, S. D. (2004). Interleukin 8 Secretion from Monocytes of Subjects Heterozygous for the {Delta}F508 Cystic Fibrosis Transmembrane Conductance Regulator Gene Mutation Is Altered. CVI 11: 819-824 [Abstract] [Full Text]  
• Whitcomb, D. C. (2004). Inflammation and Cancer V. Chronic pancreatitis and pancreatic cancer. Am. J. Physiol. Gastrointest. Liver Physiol. 287: G315-G319 [Abstract] [Full Text]  
• Chandak, G R, Idris, M M, Reddy, D N, Mani, K R, Bhaskar, S, Rao, G V, Singh, L (2004). Absence of PRSS1 mutations and association of SPINK1 trypsin inhibitor mutations in hereditary and non-hereditary chronic pancreatitis. Gut 53: 723-728 [Abstract] [Full Text]  
• Fujiki, K, Ishiguro, H, Ko, S B., Mizuno, N, Suzuki, Y, Takemura, T, Yamamoto, A, Yoshikawa, T, Kitagawa, M, Hayakawa, T, Sakai, Y, Takayama, T, Saito, M, Kondo, T, Naruse, S (2004). Genetic evidence for CFTR dysfunction in Japanese: background for chronic pancreatitis. J. Med. Genet. 41: e55-e55 [Full Text]  
• Zuccato, E., Buratti, E., Stuani, C., Baralle, F. E., Pagani, F. (2004). An Intronic Polypyrimidine-rich Element Downstream of the Donor Site Modulates Cystic Fibrosis Transmembrane Conductance Regulator Exon 9 Alternative Splicing. J. Biol. Chem. 279: 16980-16988 [Abstract] [Full Text]  
• Freedman, S. D., Blanco, P. G., Zaman, M. M., Shea, J. C., Ollero, M., Hopper, I. K., Weed, D. A., Gelrud, A., Regan, M. M., Laposata, M., Alvarez, J. G., O'Sullivan, B. P. (2004). Association of Cystic Fibrosis with Abnormalities in Fatty Acid Metabolism. NEJM 350: 560-569 [Abstract] [Full Text]  
• Gibson, R. L., Burns, J. L., Ramsey, B. W. (2003). Pathophysiology and Management of Pulmonary Infections in Cystic Fibrosis. Am. J. Respir. Crit. Care Med. 168: 918-951 [Abstract] [Full Text]  
• Lee, J. H., Choi, J. H., Namkung, W., Hanrahan, J. W., Chang, J., Song, S. Y., Park, S. W., Kim, D. S., Yoon, J.-H., Suh, Y., Jang, I.-J., Nam, J. H., Kim, S. J., Cho, M.-O., Lee, J.-E., Kim, K. H., Lee, M. G. (2003). A haplotype-based molecular analysis of CFTR mutations associated with respiratory and pancreatic diseases. Hum Mol Genet 12: 2321-2332 [Abstract] [Full Text]  
• Fong, P., Argent, B. E., Guggino, W. B., Gray, M. A. (2003). Characterization of vectorial chloride transport pathways in the human pancreatic duct adenocarcinoma cell line HPAF. Am. J. Physiol. Cell Physiol. 285: C433-C445 [Abstract] [Full Text]  
• Ninis, V N, Kylync, M O, Kandemir, M, Dathly, E, Tolun, A (2003). High frequency of T9 and CFTR mutations in children with idiopathic bronchiectasis. J. Med. Genet. 40: 530-535 [Full Text]  
• Witt, H (2003). Chronic pancreatitis and cystic fibrosis. Gut 52: ii31-41 [Abstract] [Full Text]  
• Satoh, H., Moriyama, N., Hara, C., Yamada, H., Horita, S., Kunimi, M., Tsukamoto, K., Iso-o, N., Inatomi, J., Kawakami, H., Kudo, A., Endou, H., Igarashi, T., Goto, A., Fujita, T., Seki, G. (2003). Localization of Na+-HCO-3 cotransporter (NBC-1) variants in rat and human pancreas. Am. J. Physiol. Cell Physiol. 284: C729-C737 [Abstract] [Full Text]  
• Namkung, W., Lee, J. A., Ahn, W., Han, W., Kwon, S. W., Ahn, D. S., Kim, K. H., Lee, M. G. (2003). Ca2+ Activates Cystic Fibrosis Transmembrane Conductance Regulator- and Cl--dependent HCO3 Transport in Pancreatic Duct Cells. J. Biol. Chem. 278: 200-207 [Abstract] [Full Text]  
• Groman, J. D., Meyer, M. E., Wilmott, R. W., Zeitlin, P. L., Cutting, G. R. (2002). Variant Cystic Fibrosis Phenotypes in the Absence of CFTR Mutations. NEJM 347: 401-407 [Abstract] [Full Text]  
• Witt, H (2002). The SPINK in chronic pancreatitis: similar finds, different minds. Gut 50: 590-591 [Full Text]  
• Threadgold, J, Greenhalf, W, Ellis, I, Howes, N, Lerch, M M, Simon, P, Jansen, J, Charnley, R, Laugier, R, Frulloni, L, Olah, A, Delhaye, M, Ihse, I, Schaffalitzky de Muckadell, O B, Andren-Sandberg, A, Imrie, C W, Martinek, J, Gress, T M, Mountford, R, Whitcomb, D, Neoptolemos, J P (2002). The N34S mutation of SPINK1 (PSTI) is associated with a familial pattern of idiopathic chronic pancreatitis but does not cause the disease. Gut 50: 675-681 [Abstract] [Full Text]  
• Friess, H, Shrikhande, S, Shrikhande, M, Martignoni, M, Kulli, C, Zimmermann, A, Kappeler, A, Ramesh, H, Buchler, M (2002). Neural alterations in surgical stage chronic pancreatitis are independent of the underlying aetiology. Gut 50: 682-686 [Abstract] [Full Text]  
• Drenth, J P H, te Morsche, R, Jansen, J B M J (2002). Mutations in serine protease inhibitor Kazal type 1 are strongly associated with chronic pancreatitis. Gut 50: 687-692 [Abstract] [Full Text]  
• Chandak, G R, Idris, M M, Reddy, D N, Bhaskar, S, Sriram, P V J, Singh, L (2002). Mutations in the pancreatic secretory trypsin inhibitor gene (PSTI/SPINK1) rather than the cationic trypsinogen gene (PRSS1) are significantly associated with tropical calcific pancreatitis. J. Med. Genet. 39: 347-351 [Full Text]  
• LEBECQUE, P., LEAL, T., DE BOECK, C., JASPERS, M., CUPPENS, H., CASSIMAN, J.-J. (2002). Mutations of the Cystic Fibrosis Gene and Intermediate Sweat Chloride Levels in Children. Am. J. Respir. Crit. Care Med. 165: 757-761 [Abstract] [Full Text]  
• De Lisle, R. C., Isom, K. S., Ziemer, D., Cotton, C. U. (2001). Changes in the exocrine pancreas secondary to altered small intestinal function in the CF mouse. Am. J. Physiol. Gastrointest. Liver Physiol. 281: G899-G906 [Abstract] [Full Text]  
• OCKENGA, J, STUHRMANN, M, MANNS, M P, ESTIVILL, X, CASALS, T, MALATS, N, PORTA, M, GUARNER, L, REAL, F X (2001). Evaluation of the role of CFTR in alcohol related pancreatic disease Reply. Gut 49: 312a-313 [Full Text]  
• Dean, M., Hamon, Y., Chimini, G. (2001). The human ATP-binding cassette (ABC) transporter superfamily. J. Lipid Res. 42: 1007-1017 [Abstract] [Full Text]  
• Doull, I. J M (2001). Recent advances: Recent advances in cystic fibrosis. Arch. Dis. Child. 85: 62-66 [Abstract] [Full Text]  
• Wilschanski, M., Famini, H., Strauss-Liviatan, N., Rivlin, J., Blau, H., Bibi, H., Bentur, L., Yahav, Y., Springer, H., Kramer, M.R., Klar, A., Ilani, A., Kerem, B., Kerem, E. (2001). Nasal potential difference measurements in patients with atypical cystic fibrosis. Eur Respir J 17: 1208-1215 [Abstract] [Full Text]  
• Boyle, M. P. (2001). Minocycline-Induced Pancreatitis in Cystic Fibrosis. Chest 119: 1283-1285 [Abstract] [Full Text]  
• CASTELLANI, C., BENETAZZO, M. G., TAMANINI, A., BEGNINI, A., MASTELLA, G., PIGNATTI, P. (2001). Analysis of the entire coding region of the cystic fibrosis transmembrane regulator gene in neonatal hypertrypsinaemia with normal sweat test. J. Med. Genet. 38: 202-205 [Full Text]  
• Howes, N, Greenhalf, W, Rutherford, S, O'Donnell, M, Mountford, R, Ellis, I, Whitcomb, D, Imrie, C, Drumm, B, Neoptolemos, J P (2001). A new polymorphism for the RI22H mutation in hereditary pancreatitis. Gut 48: 247-250 [Abstract] [Full Text]  
• Malats, N, Casals, T, Porta, M, Guarner, L, Estivill, X, Real, F X (2001). Cystic fibrosis transmembrane regulator (CFTR) Delta F508 mutation and 5T allele in patients with chronic pancreatitis and exocrine pancreatic cancer. Gut 48: 70-74 [Abstract] [Full Text]  
• NOONE, P. G., PUE, C. A., ZHOU, Z., FRIEDMAN, K. J., WAKELING, E. L., GANESHANANTHAN, M., SIMON, R. H., SILVERMAN, L. M., KNOWLES, M. R. (2000). Lung Disease Associated with the IVS8 5T Allele of the CFTR Gene. Am. J. Respir. Crit. Care Med. 162: 1919-1924 [Abstract] [Full Text]  
• Wang, X., Moylan, B., Leopold, D. A., Kim, J., Rubenstein, R. C., Togias, A., Proud, D., Zeitlin, P. L., Cutting, G. R. (2000). Mutation in the Gene Responsible for Cystic Fibrosis and Predisposition to Chronic Rhinosinusitis in the General Population. JAMA 284: 1814-1819 [Abstract] [Full Text]  
• Widerman, E., Millner, L., Sexauer, W., Fiel, S. (2000). Health Status and Sociodemographic Characteristics of Adults Receiving a Cystic Fibrosis Diagnosis After Age 18 Years. Chest 118: 427-433 [Abstract] [Full Text]  
• MASSIE, J., DU SART, D., FORSHAW, K., CARLIN, J., FORREST, S M (2000). The relationship between neonatal immunoreactive trypsinogen, Delta F508, and IVS8-5T. J. Med. Genet. 37: 629-632 [Full Text]  
• Casals, T., Bassas, L., Egozcue, S., Ramos, M. D., Gimenez, J., Segura, A., Garcia, F., Carrera, M., Larriba, S., Sarquella, J., Estivill, X. (2000). Heterogeneity for mutations in the CFTR gene and clinical correlations in patients with congenital absence of the vas deferens. Hum Reprod 15: 1476-1483 [Abstract] [Full Text]  
• Katz, A. J., Graeme-Cook, F. M. (2000). Case 19-2000- A 17-Year-Old Boy with Obstructive Jaundice. NEJM 342: 1893-1900 [Full Text]  
• Mak, V., Zielenski, J., Tsui, L.-C., Durie, P., Zini, A., Martin, S., Longley, T. B., Jarvi, K. A. (2000). Cystic fibrosis gene mutations and infertile men with primary testicular failure. Hum Reprod 15: 436-439 [Abstract] [Full Text]  
• PALLARES-RUIZ, N, CARLES, S, GEORGES, M D., GUITTARD, C, CLAUSTRES, M, LARREY, D, PAGEAUX, G (2000). Is isolated idiopathic pancreatitis associated with CFTR mutations?. Gut 46: 140b-140 [Full Text]  
• CHEN, J.-M., MERCIER, B., AUDREZET, M.-P., FEREC, C. (2000). Mutational analysis of the human pancreatic secretory trypsin inhibitor (PSTI) gene in hereditary and sporadic chronic pancreatitis. J. Med. Genet. 37: 67-69 [Full Text]  
• Brugge, W. R., Dam, J. V. (1999). Pancreatic and Biliary Endoscopy. NEJM 341: 1808-1816 [Full Text]  
• Wyllie, R. (1999). Gastrointestinal Manifestations of Cystic Fibrosis. CLIN PEDIATR 38: 735-738  
• Sullivan, J. L. (1999). Iron and the Genetics of Cardiovascular Disease. Circulation 100: 1260-1263 [Full Text]  
• Mak, V., Zielenski, J., Tsui, L.-C., Durie, P., Zini, A., Martin, S., Longley, T. B., Jarvi, K. A. (1999). Proportion of Cystic Fibrosis Gene Mutations Not Detected by Routine Testing in Men With Obstructive Azoospermia. JAMA 281: 2217-2224 [Abstract] [Full Text]  
• Malats, N., Real, F. X., Sharer, N. M., Schwartz, M. J. (1999). Correction: Mutations of the Cystic Fibrosis Gene in Patients with Chronic Pancreatitis. NEJM 340: 1592-1593 [Full Text]  
• Ren, C. L., Sharer, N., Schwartz, M., Cohn, J. A., Silverman, L. M., Knowles, M. R. (1999). Mutations of the Cystic Fibrosis Gene and Pancreatitis. NEJM 340: 238-239 [Full Text]  
• (1998). Pancreatitis and Cystic Fibrosis Mutations. JWatch General 1998: 5-5 [Full Text]  
• Durie, P. R. (1998). Pancreatitis and Mutations of the Cystic Fibrosis Gene. NEJM 339: 687-688 [Full Text]  
• Dean, M., Rzhetsky, A., Allikmets, R. (2001). The Human ATP-Binding Cassette (ABC) Transporter Superfamily. Genome Res 11: 1156-1166 [Abstract] [Full Text]