Background There is increasing evidence of genetic factors leadingto obesity, but the exact genes involved have not been defined.Peroxisome-proliferator–activated receptor 2 (PPAR2) isa transcription factor that has a key role in adipocyte differentiation,and therefore mutations of the gene for this factor might predisposepeople to obesity.
Methods We studied 358 unrelated German subjects, including121 obese subjects (defined as those with a body-mass index[the weight in kilograms divided by the square of the heightin meters] of more than 29). We evaluated these subjects formutations in the gene for PPAR2 at or near a site of serinephosphorylation at position 114 that negatively regulates thetranscriptional activity of the protein, using a polymerase-chain-reaction–basedassay coupled with specific endonuclease digestion. The activityof the mutation identified was analyzed by retroviral transfectionand overexpression in murine fibroblasts.
Results Four of the 121 obese subjects had a missense mutationin the gene for PPAR2 that resulted in the conversion of prolineto glutamine at position 115, as compared with none of the 237subjects of normal weight (P=0.01). All the subjects with themutant allele were markedly obese, with body-mass-index valuesranging from 37.9 to 47.3, as compared with a mean of 33.6 inthe other obese subjects. Overexpression of the mutant genein murine fibroblasts led to the production of a protein inwhich the phosphorylation of serine at position 114 was defective,as well as to accelerated differentiation of the cells intoadipocytes and greater cellular accumulation of triglyceridethan with the wild-type PPAR2. These effects were similar tothose of an in vitro mutation created directly at the Ser114phosphorylation site.
Conclusions A Pro115Gln mutation in PPAR2 accelerates the differentiationof adipocytes and may cause obesity.
Obesity is reported to be the most common health problem indeveloped countries and is the second most common cause of preventabledeath in the United States.1,2,3 It results from an inbalancebetween energy intake and energy expenditure. This imbalanceleads to a pathologic accumulation of adipose tissue; obesitytherefore reflects an interaction of development and environmentwith genotype. The results of studies of twins and familiessuggest that up to 80 percent of the variance in body-mass index(defined as the weight in kilograms divided by the square ofthe height in meters) is attributable to genetic factors.4,5
Several single-gene mutations have been described in rodentswith obesity, but the identity of the genes associated withobesity in humans is uncertain. In the best characterized ofthese rodents (ob/ob [obese hyperglycemic] and db/db [diabetic]mice), there are mutations in the gene for the hormone leptinor its receptor that interrupt the feedback signal between adiposemass and hypothalamic control of food intake.6,7,8 Recently,members of families with a mutation in the coding sequence ofthe leptin gene9 or the leptin-receptor gene10 have been reported.These mutations must be extremely rare, however, since thousandsof obese subjects have now been screened for variations in thesegenes and only a few have been found to have the mutations.Mutations of genes regulating adipocyte differentiation or triglyceridestorage, on the other hand, have not been associated with obesityin either rodents or humans.
Peroxisome-proliferator–activated receptors, especiallyperoxisome-proliferator–activated receptor 2 (PPAR2),are key regulators of adipocyte differentiation and energy storage.11,12PPAR2 is a transcription factor that directs the differentiationof preadipocytes to adipocytes. Overexpression of PPAR2 in fibroblastcell lines through the use of retroviral vectors efficientlyconverts them to adipocytes.13 PPAR2 has a reduced ability topromote the process of adipocyte differentiation when it isphosphorylated at the site of a single amino acid residue (serineat position 114 in the human PPAR2 gene), suggesting a mechanismof negative regulation to limit adipocyte differentiation andlipid accumulation (Figure 1).14,15 This serine phosphorylationoccurs at a typical consensus site for mitogen-activated proteinkinase or a related kinase and is characterized by the sequenceproline–any amino acid–serine–proline. Theaim of our study was to determine whether mutations in or aroundthis phosphorylation site might be associated with obesity.
Figure 1. Role of Peroxisome-Proliferator–Activated Receptor 2 (PPAR2) and Its Regulation by Phosphorylation.
PPAR2 is activated by thiazolidinediones and unknown endogenous ligands to promote adipocyte differentiation and to increase insulin sensitivity. Mitogen-activated protein kinase, which is activated by insulin and other growth factors, catalyzes the phosphorylation of a serine site at position 114 of the PPAR2 protein, leading to a decrease in adipocyte differentiation and insulin sensitivity.
Methods
Study Subjects
We studied 358 unrelated adult subjects living in the Nordrhein–Westfalenregion of Germany (in the cities of Bochum and Cologne, whichtogether have 1.6 million inhabitants). They were recruitedby random selection of subjects with type 2 diabetes mellitusand their spouses or employees of the participating institutions.Anonymous blood samples were obtained and frozen at –20°Cfor further analysis. Sixty-one women and 60 men were characterizedas obese on the basis of a body-mass index of more than 29.This group had a mean (±SD) body-mass index of 33.9±4.4and a mean age of 57±14 years. The group of subjectsof normal weight comprised 116 women and 121 men with a meanbody-mass index of 25.0±2.7 and a mean age of 59±16years. These subjects have been described in detail elsewhere.16
On the basis of the criteria of the World Health Organizationfor oral glucose tolerance, 186 subjects had diabetes mellitus,including 79 from the obese group and 107 from the normal-weightgroup. Since the subjects were originally recruited for studieson the genetics of type 2 diabetes mellitus, the high prevalenceof this disease in both the obese and normal-weight groups isnot representative of that in the general population. The studyprotocol was reviewed by the appropriate institutional reviewcommittees, and all the subjects gave informed consent for thestudies. Reidentification of subjects who carried a certaingenotype for further analysis (e.g., family analysis) was prohibitedby the committees' regulations.
Screening for PPAR2 Mutations
We isolated the genomic DNA of 32 subjects from peripheral-bloodleukocytes and amplified it by the polymerase chain reaction(PCR) using a sense primer (5'TGCAATCAAAGTGGAGCC3') and an antisenseprimer (5'CAGAAGCTTTATCTCCACAGAC3') that flank the region containingthe serine-phosphorylation site of PPAR2. The PCR products werecloned, and several clones from each subject were sequencedas described elsewhere.17 On the basis of the polymorphism foundin a single subject during this initial screening, a PCR-basedassay for the analysis of restriction-fragment–lengthpolymorphisms was performed on the remaining DNA samples witha modified sense primer (5'TGCAATCAAAGTGGAGCCTGCATGTC3'). Thesense primer generated an additional single-base mutation (indicatedin boldface type) in the modified sense primer 3 bp upstreamof the expected substitution of glutamine for proline at position115 (Pro115Gln). This mutation led to a new HindII restrictionsite in DNA samples from the subjects with the mutation.
Functional Analyses of PPAR2 Mutations
Full-length PPAR2 complementary DNA (cDNA) was amplified fromfirst-strand cDNA taken from human fat tissue (Clontech, PaloAlto, Calif.) under conditions previously described18 and cloned.This wild-type (normal) cDNA was used for site-directed mutagenesis(QuikChange, Stratagene, La Jolla, Calif.) of amino acids atpositions 114 (serine to alanine) and 115 (proline to glutamine).Previous studies have shown that the mutation of serine to alanineat position 114 (Ser114Ala) ablates in vitro phosphorylation,which increases the activity of PPAR2 in promoting adipocytedifferentiation.14,15 The Pro115Gln mutation was the one foundin this study.
The three samples of cDNA (wild type, Ser114Ala, and Pro115Gln)were subcloned into the retroviral expression vector pBabePuro19and amplified in BOSC23 cells.20 The supernatant containingthe retrovirus was harvested and used to infect NIH 3T3 cells(American Type Culture Collection, Manassas, Va.) as previouslydescribed.21 The infected NIH 3T3 cells were treated with trypsinand further cultured in Dulbecco's modified Eagle's medium (4.5g of glucose per liter) with 10 percent heat-inactivated fetal-calfserum (HyClone, Logan, Utah) and 2 µg of puromycin permilliliter (Sigma, St. Louis) to select successfully infectedcells. Approximately 90 fibroblast clones of each type wereisolated and pooled to obtain cell lines for further experiments.
The three pooled cell lines were grown to confluence. To promotedifferentiation, the medium was changed for two days to Dulbecco'smodified Eagle's medium containing 10 percent fetal-calf serum,1 µM dexamethasone (Sigma), 500 µM methylisobutylxanthine(Sigma), 0.05 µM troglitazone (Parke-Davis, Morris Plains,N.J.), and 2 µM bovine insulin (Sigma). The cells werethen maintained for another seven days in Dulbecco's modifiedEagle's medium with 10 percent fetal-calf serum, 0.05 µMtroglitazone, and 2 µM bovine insulin. The triglyceridecontent of the cells at various stages of the differentiationprocess was determined by staining with oil red O (Sigma) afterfixation with 10 percent formalin or chemically by using theGPO Trinder kit (Sigma). Protein content was determined withthe Bradford assay (Bio-Rad, Hercules, Calif.).
To determine the phosphorylation status of PPAR2, differentiatedcells were processed for Western blot analysis as describedelsewhere22 with use of a primary antibody against PPAR2 obtainedfrom Santa Cruz (Santa Cruz, Calif.).
Statistical Analysis
Statistical analyses were performed with SPSS software (release7.5, SPSS, Chicago). The prevalence of mutations in the obesesubjects as compared with the normal-weight subjects was analyzedwith a two-tailed Fisher's exact test, and the pathophysiologicdata were compared by the Mann–Whitney U test.
Results
As an initial approach to identify mutations at or around theSer114 phosphorylation site of PPAR2, we amplified the genomicDNA of 32 obese subjects by PCR, as described in the Methodssection, and the product was then cloned into a plasmid forsequence analysis. Since heterozygous mutations might be missedby the sequencing of single clones, several clones of each subjectwere analyzed. DNA from one subject contained a missense mutationat bp 344 of PPAR2 in about 50 percent of the clones sequenced,a finding that is consistent with heterozygosity at this site(Figure 2). This mutation would change the wild-type prolineat position 115 to glutamine. No mutations at Ser114 were found.
Figure 2. Sequence Analysis of a Cloned DNA Fragment from an Obese Subject with a Mutation in the Peroxisome-Proliferator–Activated Receptor 2 Gene.
The complementary DNA from some of the obese subjects was subcloned and sequenced. An example of a missense mutation at bp 344 in the antisense strand (arrowhead) is shown. This mutation leads to the substitution of glutamine for proline at position 115. The serine phosphorylation site at position 114 is not directly affected.
In order to study more subjects and determine the prevalenceof this mutation, we used a restriction-enzyme–based assay.Since the region of interest does not contain a natural restrictionsite, a PCR primer was constructed by changing a nucleotide3 bp upstream of the putative mutation to introduce a new restrictionsite which, when coupled with the mutation, generated a sitefor restriction enzyme HindII when the mutant allele was present(Figure 3). Using this assay, we studied a total of 358 subjects(121 obese subjects and 237 normal-weight subjects).
Figure 3. Results of Polymerase-Chain-Reaction (PCR) Screening for Mutations in Peroxisome-Proliferator–Activated Receptor 2.
PCR amplification of DNA, followed by restriction-enzyme digestion and ethidium bromide–stained agarose-gel electrophoresis, was performed as described in the Methods section. When applied to a recombinant DNA sample that was homozygous for the mutation (lane 2), the restriction endonuclease HindII cut the entire DNA sample into two fragments. In DNA from a heterozygous obese subject (lane 3), fragments of three sizes were observed, owing to the digestion of the mutant allele and the absence of digestion of the wild-type allele. In DNA from a normal-weight subject with two wild-type alleles (lane 1), the fragment amplified by PCR was not cleaved by the restriction enzyme, resulting in a single band.
In addition to the one obese subject described above, threeother obese subjects, but none of the normal-weight subjects,were found to carry a heterozygous mutation at nucleotide 344.Subsequent cloning and sequencing of this region in these obesesubjects confirmed the Pro115Gln mutation. The association ofthe mutation with obesity (defined as a body-mass index of >29)was significant (P=0.01) (Table 1). Three of the four subjectscarrying the mutation also had type 2 diabetes. The overallprevalence of the mutation was 1.1 percent in the 358 subjects,corresponding to an allelic frequency of approximately 0.5 percent.
Table 1. Frequency of the Pro115Gln Mutation in the PPARg2 Gene in Obese and Normal-Weight Subjects.
The 4 subjects with mutant alleles were markedly more obesethan the other 117 obese subjects (body-mass index, 37.9 to47.3, as compared with a mean of 33.6±4.1; P=0.03) (Table 2).The average age of the subjects with mutations was not significantlydifferent from that of the rest of the group. The mean seruminsulin concentration while fasting was significantly lowerin the obese subjects with the mutation than in the rest ofthe obese group, suggesting a lower level of insulin resistance(Table 2).
Table 2. Clinical Characteristics of the Subjects with the PPARg2 Mutation and the Obese Subjects without the Mutation.
Since Pro115 flanks Ser114 at the phosphorylation site of PPAR2,it appeared likely that this mutation might lead to decreasedserine phosphorylation and therefore increased differentiationof fibroblasts into adipocytes, as has been observed with anartificial mutation of serine at position 114.14,15 To testthis hypothesis, the nonmutant (wild-type) PPAR2, the subject-derivedPro115Gln PPAR2, and an artificially mutated Ser114Ala PPAR2were each evaluated with regard to phosphorylation and supportof adipocyte differentiation. The Ser114Ala mutant had moreactivity than the wild-type PPAR2, because the potential negativeeffect of serine phosphorylation on the activity of the proteinis lost owing to the substitution of alanine.14 Each constructwas used for retrovirus-mediated, stable transfection of NIH3T3 fibroblasts. These cells do not normally accumulate triglyceridebut do differentiate into adipocytes when transfected with PPAR2and stimulated appropriately.14
PPAR2 protein was demonstrated in extracts of all three transfectedcell lines by Western blot analysis (Figure 4A), and the expressionwas significantly increased as compared with the endogenousexpression in nontransfected NIH 3T3 cells (data not shown).After stimulation by insulin, the mobility of wild-type PPAR2on sodium dodecyl sulfate–polyacrylamide gels was retarded,a finding consistent with the effect of phosphorylation of serineat position 114. This gel shift was absent in cells expressingeither of the mutant proteins, indicating that neither the Pro115Glnmutant nor the Ser114Ala mutant was phosphorylated at position114.
Figure 4. Functional Analyses of Constitutively Active Mutant Peroxisome-Proliferator–Activated Receptor 2 (PPAR2).
NIH 3T3 cells transfected with the wild-type unmutated PPAR2 and two mutant PPAR2 genes were differentiated with 0.05 µM troglitazone as described in the Methods section. Panel A shows the results of a Western blot analysis in which an antibody against PPAR2 was used. As compared with the wild-type protein, both mutant proteins migrated more rapidly. This effect was consistent with the phosphorylation of the wild-type protein at position 114, which does not occur in either of the mutants. Panel B shows the cells stained with oil red O to identify lipid accumulation. As compared with the wild-type PPAR2, both the natural mutation of proline to glutamine at position 115, found in the obese subjects, and the artificial mutation of the Ser114 phosphorylation site accelerated the accumulation of triglyceride during differentiation. In Panel C, the same effect is evident in the results of a quantitative triglyceride assay to assess lipid accumulation. The standard deviations of the triglyceride values were less than 10 percent of the mean values and are therefore not shown.
To assess adipocyte differentiation and lipid accumulation,the transfected NIH 3T3 cells were treated with a differentiationmedium that supported and maintained the cells for an additionalnine days in culture. Staining with oil red O, a fat-specificdye, revealed more lipid accumulation in the cells containingeither the Ser114Ala or the Pro115Gln mutants than in thosecontaining wild-type PPAR2 after six and nine days of differentiation(Figure 4B). This finding was confirmed by chemical analysisof both mutant cell lines, which revealed an accumulation oftriglyceride in the mutant cells that was at least 2.5 timesthat found in the wild-type cell line, after normalization forcell protein content (Figure 4C). Thus, both the natural mutationof proline to glutamine at position 115 and the artificial mutationof serine to alanine at position 114 increased the activityof PPAR2 and accelerated adipocyte differentiation and triglycerideaccumulation.
Discussion
Obesity in humans results from a combination of environmentalinfluences and genetic factors that affect energy storage andcaloric intake. In subjects with severe obesity, this interactionis associated with an increased number (hyperplasia) and size(hypertrophy) of fat cells.1 The hyperplastic adipocytes arederived from a poorly defined precursor pool of preadipocytes,which appear to be fibroblasts on morphologic analysis. Activationof the transcription factor PPAR2 appears to be a key elementin the regulation of the process of adipocyte differentiation.11,13The activity of PPAR2 is decreased by phosphorylation of a singleserine site at position 114.14,15
In this study, we identified a mutation that affects the serinephosphorylation of PPAR2 and appears to contribute to the developmentof severe obesity. This mutation was found in approximately3 percent of obese subjects in a German population, or about1 percent of all subjects screened. Since neither a foundereffect nor linkage disequilibrium can be fully ruled out bythe methods used in this study, further studies will be neededto determine the prevalence of this mutation in other populationsand in families with obesity.
As predicted by its structure and according to our functionalanalysis, the mutation of proline to glutamine at position 115blocks the phosphorylation of PPAR2 at Ser114, just adjacentto the mutation. This mutation reduces the inactivation of PPAR2,leading to a constitutively more active protein. Since our screeningtechnique focused on a specific mutation alone, a search forother PPAR2 mutations should be considered in future studiesof the genetics of obesity. Yen et al. recently identified apolymorphism converting serine to alanine at position 12 atthe amino-terminal end of PPAR2.23 However, the function ofthis site remains uncertain, and there is no evidence that thismutation is associated with obesity or that it increases PPAR2activity.23 By contrast, the subjects with the mutation in ourstudy were massively obese, even as compared with the otherobese subjects in the study. Also, the Pro115Gln mutation, ascompared with the wild-type sequence, clearly results in increasedrates of differentiation of adipocytes when transfected intoNIH 3T3 cells.
Although the endogenous ligand for PPAR2 is unknown, a new classof antidiabetic drugs called thiazolidinediones, which includestroglitazone and pioglitazone, has been found to act as a syntheticligand for this transcription factor.24 These drugs act as insulinsensitizers, decreasing insulin resistance in patients withtype 2 diabetes.25 There is no evidence that the administrationof troglitazone results in greater weight gain than the administrationof other antidiabetic drugs26; however, studies in rodents suggestthat the long-term administration of this drug may increasethe total number of adipocytes.27
Although obesity is usually associated with insulin resistancein proportion to the excess in body weight,28,29 one might predictthat activating mutations of PPAR2 might cause obesity thatwould be associated with less insulin resistance than expected.Although we did not measure the degree of insulin resistancein our subjects, the obese subjects with the PPAR2 mutationhad lower serum insulin concentrations while fasting than theother obese subjects, suggesting a lower degree of insulin resistance.28
In summary, the missense mutation Pro115Gln in the gene forthe transcription factor PPAR2 is associated with marked obesity.In vitro analyses showed a permanent activation of PPAR2 thatled to an accelerated rate of adipocyte differentiation andincreased fat accumulation in a tissue-culture model of adipogenesis.Although the degree of obesity was pronounced, there was noassociation with type 2 diabetes or hyperinsulinemia, thus possiblydefining a specific subclass of obesity.
Supported by a grant (DK 45935, to Dr. Kahn) from the NationalInstitutes of Health, a Diabetes and Endocrinology ResearchCenter grant (2 P30 DK 36836, to the Joslin Diabetes Center),a grant from the KoelnFortune program of the University of Cologne(88/97, to Dr. Ristow), and a grant from the Hermann und LillySchilling Stiftung (to Dr. Pfeiffer).
We are indebted to Ms. Terri-Lyn Azar for secretarial assistance,to Ms. Eleni Giannakidou and Dr. Kay Busch for technical help,and to Dr. James H. Warram for statistical advice.
Source Information
From the Joslin Diabetes Center and Harvard Medical School, Boston (M.R., C.R.K.); the Klinik II und Poliklinik für Innere Medizin, Universität zu Köln, Cologne, Germany (M.R., D.M.-W., W.K.); and the Medizinische Klinik und Poliklinik, Bergmannsheil, Ruhr-Universität Bochum, Bochum, Germany (A.P.).
Address reprint requests to Dr. Kahn at the Joslin Diabetes Center, Research Division, Section on Cellular and Molecular Physiology, 1 Joslin Pl., Boston, MA 02215.
References
Rosenbaum M, Leibel RL, Hirsch J. Obesity. N Engl J Med 1997;337:396-407. [Free Full Text]
Kuczmarski RJ, Flegal KM, Campbell SM, Johnson CL. Increasing prevalence of overweight among US adults: the National Health and Nutrition Examination Surveys, 1960 to 1991. JAMA 1994;272:205-211. [Free Full Text]
McGinnis JM, Foege WH. Actual causes of death in the United States. JAMA 1993;270:2207-2212. [Free Full Text]
Whitaker RC, Wright JA, Pepe MS, Seidel KD, Dietz WH. Predicting obesity in young adulthood from childhood and parental obesity. N Engl J Med 1997;337:869-873. [Free Full Text]
Zhang Y, Proenca R, Maffei M, Barone M, Leopold L, Friedman JM. Positional cloning of the mouse obese gene and its human homologue. Nature 1994;372:425-432. [Erratum, Nature 1995;374:479.] [CrossRef][Medline]
Tartaglia LA, Dembski M, Weng X, et al. Identification and expression cloning of a leptin receptor, OB-R. Cell 1995;83:1263-1271. [CrossRef][Medline]
Flier JS, Maratos-Flier E. Obesity and the hypothalamus: novel peptides for new pathways. Cell 1998;92:437-440. [CrossRef][Medline]
Montague CT, Farooqi IS, Whitehead JP, et al. Congenital leptin deficiency is associated with severe early-onset obesity in humans. Nature 1997;387:903-908. [CrossRef][Medline]
Clément K, Vaisse C, Lahlou N, et al. A mutation in the human leptin receptor gene causes obesity and pituitary dysfunction. Nature 1998;392:398-401. [CrossRef][Medline]
Spiegelman BM, Flier JS. Adipogenesis: rounding out the big picture. Cell 1996;87:377-389. [CrossRef][Medline]
Latruffe N, Vamecq J. Peroxisome proliferators and peroxisome proliferator activated receptors (PPARs) as regulators of lipid metabolism. Biochimie 1997;79:81-94. [Medline]
Tontonoz P, Hu E, Spiegelman BM. Stimulation of adipogenesis in fibroblasts by PPAR gamma 2, a lipid-activated transcription factor. Cell 1994;79:1147-1156. [Erratum, Cell 1995;80:957.] [CrossRef][Medline]
Hu E, Kim JB, Sarraf P, Spiegelman BM. Inhibition of adipogenesis through MAP kinase-mediated phosphorylation of PPARgamma. Science 1996;274:2100-2103. [Free Full Text]
Adams M, Reginato MJ, Shao DL, Lazar MA, Chatterjee VK. Transcriptional activation by peroxisome proliferator-activated receptor gamma is inhibited by phosphorylation at a consensus mitogen-activated protein kinase site. J Biol Chem 1997;272:5128-5132. [Free Full Text]
Ristow M, Giannakidou E, Hebinck J, et al. An association between NIDDM and a GAA trinucleotide repeat polymorphism in the X25/frataxin (Friedreich's ataxia) gene. Diabetes 1998;47:851-854. [Abstract]
Ristow M, Vorgerd M, Möhlig M, Schatz H, Pfeiffer A. Deficiency of phosphofructo-1-kinase/muscle subtype in humans impairs insulin secretion and causes insulin resistance. J Clin Invest 1997;100:2833-2841. [Medline]
Ristow M, Möhlig M, Rifai M, Schatz H, Feldmann K, Pfeiffer A. New isoniazid/ethionamide resistance gene mutation and screening for multidrug-resistant Mycobacterium tuberculosis strains. Lancet 1995;346:502-503. [Medline]
Morgenstern JP, Land H. Advanced mammalian gene transfer: high titre retroviral vectors with multiple drug selection markers and a complementary helper-free packaging cell line. Nucleic Acids Res 1990;18:3587-3596. [Free Full Text]
Pear WS, Nolan GP, Scott ML, Baltimore D. Production of high-titer helper-free retroviruses by transient transfection. Proc Natl Acad Sci U S A 1993;90:8392-8396. [Free Full Text]
Brüning JC, Winnay J, Cheatham B, Kahn CR. Differential signaling by insulin receptor substrate 1 (IRS-1) and IRS-2 in IRS-1-deficient cells. Mol Cell Biol 1997;17:1513-1521. [Abstract]
Knebel B, Kellner S, Kotzka J, et al. Defects of insulin and IGF-1 action at receptor and postreceptor level in a patient with type A syndrome of insulin resistance. Biochem Biophys Res Commun 1997;234:626-630. [CrossRef][Medline]
Yen CJ, Beamer BA, Negri C, et al. Molecular scanning of the human peroxisome proliferator activated receptor gamma (hPPAR gamma) gene in diabetic Caucasians: identification of a Pro12Ala PPAR gamma 2 missense mutation. Biochem Biophys Res Commun 1997;241:270-274. [CrossRef][Medline]
Lehmann JM, Moore LB, Smith-Oliver TA, Wilkison WO, Willson TM, Kliewer SA. An antidiabetic thiazolidinedione is a high affinity ligand for peroxisome proliferator-activated receptor gamma (PPAR gamma). J Biol Chem 1995;270:12953-12956. [Free Full Text]
Saltiel AR, Olefsky JM. Thiazolidinediones in the treatment of insulin resistance and type II diabetes. Diabetes 1996;45:1661-1669. [Abstract]
Schwartz S, Raskin P, Fonseca V, Graveline JF. Effect of troglitazone in insulin-treated patients with type II diabetes mellitus. N Engl J Med 1998;338:861-866. [Free Full Text]
Okuno A, Tamemoto H, Tobe K, et al. Troglitazone increases the number of small adipocytes without the change of white adipose tissue mass in obese Zucker rats. J Clin Invest 1998;101:1354-1361. [Medline]
Kahn CR. Banting Lecture: insulin action, diabetogenes, and the cause of type II diabetes. Diabetes 1994;43:1066-1084. [Medline]
National Diabetes Data Group. Diabetes in America. 2nd ed. Bethesda, Md.: National Institute of Diabetes and Digestive and Kidney Diseases, 1995. (NIH publication no. 95-1468.)
Tsai, Y.-S., Xu, L., Smithies, O., Maeda, N.
(2009). Genetic variations in peroxisome proliferator-activated receptor {gamma} expression affect blood pressure. Proc. Natl. Acad. Sci. USA
106: 19084-19089
[Abstract][Full Text]
Grun, F., Blumberg, B.
(2009). Minireview: The Case for Obesogens. Mol. Endocrinol.
23: 1127-1134
[Abstract][Full Text]
Ryu, G.-M., Song, P., Kim, K.-W., Oh, K.-S., Park, K.-J., Kim, J. H.
(2009). Genome-wide analysis to predict protein sequence variations that change phosphorylation sites or their corresponding kinases. Nucleic Acids Res
37: 1297-1307
[Abstract][Full Text]
Lehmann, D. F., Lohray, B. B.
(2008). A Lesson in Moderation: Applying Pharmacodynamics to Clarify the Relationship Between Thiazolidinediones and Adverse Vascular Outcomes in Type 2 Diabetes. J Clin Pharmacol
48: 999-1002
[Full Text]
Ruan, X., Zheng, F., Guan, Y.
(2008). PPARs and the kidney in metabolic syndrome. Am. J. Physiol. Renal Physiol.
294: F1032-F1047
[Abstract][Full Text]
Musaad, S., Haynes, E. N.
(2007). Biomarkers of Obesity and Subsequent Cardiovascular Events. Epidemiol Rev
0: mxm005v1-
[Abstract][Full Text]
Monajemi, H., Zhang, L., Li, G., Jeninga, E. H., Cao, H., Maas, M., Brouwer, C. B., Kalkhoven, E., Stroes, E., Hegele, R. A., Leff, T.
(2007). Familial Partial Lipodystrophy Phenotype Resulting from a Single-Base Mutation in Deoxyribonucleic Acid-Binding Domain of Peroxisome Proliferator-Activated Receptor-{gamma}. J. Clin. Endocrinol. Metab.
92: 1606-1612
[Abstract][Full Text]
Gilde, A. J., Fruchart, J.-C., Staels, B.
(2006). Peroxisome Proliferator-Activated Receptors at the Crossroads of Obesity, Diabetes, and Cardiovascular Disease. J Am Coll Cardiol
48: A24-A32
[Abstract][Full Text]
Porter, J R, Barrett, T G
(2005). Monogenic syndromes of abnormal glucose homeostasis: clinical review and relevance to the understanding of the pathology of insulin resistance and {beta} cell failure. J. Med. Genet.
42: 893-902
[Abstract][Full Text]
Meirhaeghe, A., Cottel, D., Amouyel, P., Dallongeville, J.
(2005). Association Between Peroxisome Proliferator-Activated Receptor {gamma} Haplotypes and the Metabolic Syndrome in French Men and Women. Diabetes
54: 3043-3048
[Abstract][Full Text]
Sharma, A., Chavali, S., Mahajan, A., Tabassum, R., Banerjee, V., Tandon, N., Bharadwaj, D.
(2005). Genetic Association, Post-translational Modification, and Protein-Protein Interactions in Type 2 Diabetes Mellitus. Mol. Cell. Proteomics
4: 1029-1037
[Abstract][Full Text]
Pischon, T., Pai, J. K., Manson, J. E., Hu, F. B., Rexrode, K. M., Hunter, D., Rimm, E. B.
(2005). Peroxisome Proliferator-Activated Receptor-{gamma}2 P12A Polymorphism and Risk of Coronary Heart Disease in US Men and Women. Arterioscler. Thromb. Vasc. Bio.
25: 1654-1658
[Abstract][Full Text]
Paracchini, V., Pedotti, P., Taioli, E.
(2005). Genetics of Leptin and Obesity: A HuGE Review. Am J Epidemiol
162: 101-114
[Abstract][Full Text]
Hansen, S. K., Nielsen, E.-M. D., Ek, J., Andersen, G., Glumer, C., Carstensen, B., Mouritzen, P., Drivsholm, T., Borch-Johnsen, K., Jorgensen, T., Hansen, T., Pedersen, O.
(2005). Analysis of Separate and Combined Effects of Common Variation in KCNJ11 and PPARG on Risk of Type 2 Diabetes. J. Clin. Endocrinol. Metab.
90: 3629-3637
[Abstract][Full Text]
McGettrick, A. J., Feener, E. P., Kahn, C. R.
(2005). Human Insulin Receptor Substrate-1 (IRS-1) Polymorphism G972R Causes IRS-1 to Associate with the Insulin Receptor and Inhibit Receptor Autophosphorylation. J. Biol. Chem.
280: 6441-6446
[Abstract][Full Text]
Knouff, C., Auwerx, J.
(2004). Peroxisome Proliferator-Activated Receptor-{gamma} Calls for Activation in Moderation: Lessons from Genetics and Pharmacology. Endocr. Rev.
25: 899-918
[Abstract][Full Text]
Guan, Y.
(2004). Peroxisome Proliferator-Activated Receptor Family and Its Relationship to Renal Complications of the Metabolic Syndrome. J. Am. Soc. Nephrol.
15: 2801-2815
[Abstract][Full Text]
Yamashita, D., Yamaguchi, T., Shimizu, M., Nakata, N., Hirose, F., Osumi, T.
(2004). The transactivating function of peroxisome proliferator-activated receptor {gamma} is negatively regulated by SUMO conjugation in the amino-terminal domain. GENES CELLS
9: 1017-1029
[Abstract][Full Text]
Parton, L. E., Diraison, F., Neill, S. E., Ghosh, S. K., Rubino, M. A., Bisi, J. E., Briscoe, C. P., Rutter, G. A.
(2004). Impact of PPAR{gamma} overexpression and activation on pancreatic islet gene expression profile analyzed with oligonucleotide microarrays. Am. J. Physiol. Endocrinol. Metab.
287: E390-E404
[Abstract][Full Text]
Haluzik, M., Colombo, C., Gavrilova, O., Chua, S., Wolf, N., Chen, M., Stannard, B., Dietz, K. R., Le Roith, D., Reitman, M. L.
(2004). Genetic Background (C57BL/6J Versus FVB/N) Strongly Influences the Severity of Diabetes and Insulin Resistance in ob/ob Mice. Endocrinology
145: 3258-3264
[Abstract][Full Text]
Shin, H. D., Park, B. L., Kim, L. H., Jung, H. S., Cho, Y. M., Moon, M. K., Park, Y. J., Lee, H. K., Park, K. S.
(2004). Genetic Polymorphisms in Peroxisome Proliferator-Activated Receptor {delta} Associated With Obesity. Diabetes
53: 847-851
[Abstract][Full Text]
Farooqi, I.S., O'Rahilly, S.
(2004). Monogenic Human Obesity Syndromes. Recent Prog Horm Res
59: 409-424
[Abstract][Full Text]
Moyes, C. D.
(2003). Controlling muscle mitochondrial content. J. Exp. Biol.
206: 4385-4391
[Abstract][Full Text]
Orio, F. Jr., Matarese, G., Di Biase, S., Palomba, S., Labella, D., Sanna, V., Savastano, S., Zullo, F., Colao, A., Lombardi, G.
(2003). Exon 6 and 2 Peroxisome Proliferator-Activated Receptor-{gamma} Polymorphisms in Polycystic Ovary Syndrome. J. Clin. Endocrinol. Metab.
88: 5887-5892
[Abstract][Full Text]
Gardner, O. S., Dewar, B. J., Earp, H. S., Samet, J. M., Graves, L. M.
(2003). Dependence of Peroxisome Proliferator-activated Receptor Ligand-induced Mitogen-activated Protein Kinase Signaling on Epidermal Growth Factor Receptor Transactivation. J. Biol. Chem.
278: 46261-46269
[Abstract][Full Text]
Masud, S, Ye, S
(2003). Effect of the peroxisome proliferator activated receptor-{gamma} gene Pro12Ala variant on body mass index: a meta-analysis. J. Med. Genet.
40: 773-780
[Full Text]
Gupta, R. A., Sarraf, P., Mueller, E., Brockman, J. A., Prusakiewicz, J. J., Eng, C., Willson, T. M., DuBois, R. N.
(2003). Peroxisome Proliferator-activated Receptor {gamma}-mediated Differentiation: A MUTATION IN COLON CANCER CELLS REVEALS DIVERGENT AND CELL TYPE-SPECIFIC MECHANISMS. J. Biol. Chem.
278: 22669-22677
[Abstract][Full Text]
Gurnell, M., Savage, D. B., Chatterjee, V. K. K., O'Rahilly, S.
(2003). The Metabolic Syndrome: Peroxisome Proliferator-Activated Receptor {gamma} and Its Therapeutic Modulation. J. Clin. Endocrinol. Metab.
88: 2412-2421
[Abstract][Full Text]
Korc, M.
(2003). Diabetes Mellitus in the Era of Proteomics. Mol. Cell. Proteomics
2: 399-404
[Full Text]
Bluher, M., Lubben, G., Paschke, R.
(2003). Analysis of the Relationship Between the Pro12Ala Variant in the PPAR-{gamma}2 Gene and the Response Rate to Therapy With Pioglitazone in Patients With Type 2 Diabetes. Diabetes Care
26: 825-831
[Abstract][Full Text]
Meirhaeghe, A., Fajas, L., Gouilleux, F., Cottel, D., Helbecque, N., Auwerx, J., Amouyel, P.
(2003). A Functional Polymorphism in a STAT5B Site of the Human PPAR{gamma}3 Gene Promoter Affects Height and Lipid Metabolism in a French Population. Arterioscler. Thromb. Vasc. Bio.
23: 289-294
[Abstract][Full Text]
Patel, N. G., Holder, J. C., Smith, S. A., Kumar, S., Eggo, M. C.
(2003). Differential Regulation of Lipogenesis and Leptin Production by Independent Signaling Pathways and Rosiglitazone During Human Adipocyte Differentiation. Diabetes
52: 43-50
[Abstract][Full Text]
Labib, M
(2003). The investigation and management of obesity. J. Clin. Pathol.
56: 17-25
[Abstract][Full Text]
Hegele, R. A., Cao, H., Frankowski, C., Mathews, S. T., Leff, T.
(2002). PPARG F388L, a Transactivation-Deficient Mutant, in Familial Partial Lipodystrophy. Diabetes
51: 3586-3590
[Abstract][Full Text]
Rieusset, J., Touri, F., Michalik, L., Escher, P., Desvergne, B., Niesor, E., Wahli, W.
(2002). A New Selective Peroxisome Proliferator-Activated Receptor {gamma} Antagonist with Antiobesity and Antidiabetic Activity. Mol. Endocrinol.
16: 2628-2644
[Abstract][Full Text]
Sewter, C., Blows, F., Considine, R., Vidal-Puig, A., O'Rahilly, S.
(2002). Differential Effects of Adiposity on Peroxisomal Proliferator-Activated Receptor {gamma}1 and {gamma}2 Messenger Ribonucleic Acid Expression in Human Adipocytes. J. Clin. Endocrinol. Metab.
87: 4203-4207
[Abstract][Full Text]
Stumvoll, M., Haring, H.
(2002). The Peroxisome Proliferator-Activated Receptor-{gamma}2 Pro12Ala Polymorphism. Diabetes
51: 2341-2347
[Abstract][Full Text]
Tamori, Y., Masugi, J., Nishino, N., Kasuga, M.
(2002). Role of Peroxisome Proliferator-Activated Receptor-{gamma} in Maintenance of the Characteristics of Mature 3T3-L1 Adipocytes. Diabetes
51: 2045-2055
[Abstract][Full Text]
Schneider, J., Kreuzer, J., Hamann, A., Nawroth, P. P., Dugi, K. A.
(2002). The Proline 12 Alanine Substitution in the Peroxisome Proliferator-Activated Receptor-{gamma}2 Gene Is Associated With Lower Lipoprotein Lipase Activity in Vivo. Diabetes
51: 867-870
[Abstract][Full Text]
Walczak, R., Tontonoz, P.
(2002). PPARadigms and PPARadoxes: expanding roles for PPAR{gamma} in the control of lipid metabolism. J. Lipid Res.
43: 177-186
[Abstract][Full Text]
Pihlajamaki, J., Austin, M., Edwards, K., Laakso, M.
(2001). A Major Gene Effect on Fasting Insulin and Insulin Sensitivity in Familial Combined Hyperlipidemia. Diabetes
50: 2396-2401
[Abstract][Full Text]
Ko, C., Lee, T.-L., Lau, P. W., Li, J., Davis, B. T., Voyiaziakis, E., Allison, D. B., Chua, S. C. , Jr., Huang, L.-S.
(2001). Two novel quantitative trait loci on mouse chromosomes 6 and 4 independently and synergistically regulate plasma apoB levels. J. Lipid Res.
42: 844-855
[Abstract][Full Text]
Douglas, J. A., Erdos, M. R., Watanabe, R. M., Braun, A., Johnston, C. L., Oeth, P., Mohlke, K. L., Valle, T. T., Ehnholm, C., Buchanan, T. A., Bergman, R. N., Collins, F. S., Boehnke, M., Tuomilehto, J.
(2001). The Peroxisome Poliferator-Activated Receptor-{gamma}2 Pro12Ala Variant: Association With Type 2 Diabetes and Trait Differences. Diabetes
50: 886-890
[Abstract][Full Text]
Hsueh, W.-C., Mitchell, B. D., Schneider, J. L., St. Jean, P. L., Pollin, T. I., Ehm, M. G., Wagner, M. J., Burns, D. K., Sakul, H., Bell, C. J., Shuldiner, A. R.
(2001). Genome-Wide Scan of Obesity in the Old Order Amish. J. Clin. Endocrinol. Metab.
86: 1199-1205
[Abstract][Full Text]
Luan, J.'a., Browne, P. O., Harding, A.-H., Halsall, D. J., O’Rahilly, S., Chatterjee, V.K. K., Wareham, N. J.
(2001). Evidence for Gene-Nutrient Interaction at the PPAR{gamma} Locus. Diabetes
50: 686-689
[Abstract][Full Text]
Hasstedt, S. J., Ren, Q.-F., Teng, K., Elbein, S. C.
(2001). Effect of the Peroxisome Proliferator-Activated Receptor-{{gamma}}2 Pro12Ala Variant on Obesity, Glucose Homeostasis, and Blood Pressure in Members of Familial Type 2 Diabetic Kindreds. J. Clin. Endocrinol. Metab.
86: 536-541
[Abstract][Full Text]
Hsueh, W. A., Jackson, S., Law, R. E.
(2001). Control of Vascular Cell Proliferation and Migration by PPAR-{gamma}: A new approach to the macrovascular complications of diabetes. Diabetes Care
24: 392-397
[Abstract][Full Text]
Fasshauer, M., Klein, J., Kriauciunas, K. M., Ueki, K., Benito, M., Kahn, C. R.
(2001). Essential Role of Insulin Receptor Substrate 1 in Differentiation of Brown Adipocytes. Mol. Cell. Biol.
21: 319-329
[Abstract][Full Text]
Arioglu, E., Duncan-Morin, J., Sebring, N., Rother, K. I., Gottlieb, N., Lieberman, J., Herion, D., Kleiner, D. E., Reynolds, J., Premkumar, A., Sumner, A. E., Hoofnagle, J., Reitman, M. L., Taylor, S. I.
(2000). Efficacy and Safety of Troglitazone in the Treatment of Lipodystrophy Syndromes. ANN INTERN MED
133: 263-274
[Abstract][Full Text]
Devlin, M. J., Yanovski, S. Z., Wilson, G. T.
(2000). Obesity: What Mental Health Professionals Need to Know. Am. J. Psychiatry
157: 854-866
[Abstract][Full Text]
Fredriks, A M, van Buuren, S, Wit, J M, Verloove-Vanhorick, S P
(2000). Body index measurements in 1996-7 compared with 1980. Arch. Dis. Child.
82: 107-112
[Abstract][Full Text]
Knoblauch, H., Busjahn, A., Muller-Myhsok, B., Faulhaber, H.-D., Schuster, H., Uhlmann, R., Luft, F. C.
(1999). Peroxisome Proliferator-Activated Receptor {gamma} Gene Locus Is Related to Body Mass Index and Lipid Values in Healthy Nonobese Subjects. Arterioscler. Thromb. Vasc. Bio.
19: 2940-2944
[Abstract][Full Text]
Wang, X. L., Oosterhof, J., Duarte, N.
(1999). Peroxisome proliferator-activated receptor {gamma} C161->T polymorphism and coronary artery disease. Cardiovasc Res
44: 588-594
[Abstract][Full Text]
Yanovski, J. A., Yanovski, S. Z.
(1999). Recent Advances in Basic Obesity Research. JAMA
282: 1504-1506
[Full Text]
Desvergne, B., Wahli, W.
(1999). Peroxisome Proliferator-Activated Receptors: Nuclear Control of Metabolism. Endocr. Rev.
20: 649-688
[Abstract][Full Text]
Chen, D., Garg, A.
(1999). Monogenic disorders of obesity and body fat distribution. J. Lipid Res.
40: 1735-1746
[Abstract][Full Text]
Valve, R., Sivenius, K., Miettinen, R., Pihlajamaki, J., Rissanen, A., Deeb, S. S., Auwerx, J., Uusitupa, M., Laakso, M.
(1999). Two Polymorphisms in the Peroxisome Proliferator-Activated Receptor-{gamma} Gene Are Associated with Severe Overweight among Obese Women. J. Clin. Endocrinol. Metab.
84: 3708-3712
[Abstract][Full Text]
Poretsky, L., Cataldo, N. A., Rosenwaks, Z., Giudice, L. C.
(1999). The Insulin-Related Ovarian Regulatory System in Health and Disease. Endocr. Rev.
20: 535-582
[Abstract][Full Text]
Eubank, D. W., Duplus, E., Williams, S. C., Forest, C., Beale, E. G.
(2001). Peroxisome Proliferator-activated Receptor gamma and Chicken Ovalbumin Upstream Promoter Transcription Factor II Negatively Regulate the Phosphoenolpyruvate Carboxykinase Promoter via a Common Element*. J. Biol. Chem.
276: 30561-30569
[Abstract][Full Text]
2 (PPAR
Previous
