Micrometastases and Survival in Stage II Colorectal Cancer
Gerrit-Jan Liefers, M.D., Anne-Marie Cleton-Jansen, Ph.D., Cornelis J.H. van de Velde, M.D., Ph.D., Jo Hermans, Ph.D., Johannes H.J.M. van Krieken, M.D., Ph.D., Cees J. Cornelisse, Ph.D., and Rob A.E.M. Tollenaar, M.D., Ph.D.
Background Standard treatment of colorectal cancer includesadjuvant chemotherapy for patients with stage III disease (definedby the presence of lymph-node metastases), but not for patientswith stage II tumors (who have no lymph-node metastases). However,20 percent of patients with stage II tumors die of recurrentdisease. We investigated whether the detection of micrometastasescan be used to identify patients with stage II disease who areat high risk for recurrence.
Methods We analyzed 192 lymph nodes from 26 consecutive patientswith stage II colorectal cancer, using a carcinoembryonic antigen–specificnested reverse-transcriptase polymerase chain reaction. Five-yearfollow-up information was obtained on all patients. Observedand adjusted survival rates were assessed in the patients withand the patients without micrometastases.
Results Micrometastases were detected in one or more lymph nodesfrom 14 of 26 patients (54 percent). The adjusted five-yearsurvival rate (for which only cancer-related deaths were considered)was 50 percent in this group, whereas in the 12 patients withoutmicrometastases, the survival rate was 91 percent (P=0.02 bythe log-rank test). The observed five-year survival rates were36 percent and 75 percent, respectively (P=0.03). The groupswere similar with respect to age, sex, tumor side (locationin relation to the flexura lienalis), degree of tumor differentiation(grade), and diameter of the primary tumor.
Conclusions Molecular detection of micrometastases is a prognostictool in stage II colorectal cancer.
Dissemination to locoregional lymph nodes is an important prognosticfactor in colorectal cancer. Five-year survival rates drop from80 percent in patients with tumor–node–metastasis(TNM) stage II disease (who have no lymph-node metastases) to45 to 50 percent in those with TNM stage III disease (in whichlymph-node metastases are present).1 Surgery and adjuvant chemotherapyare standard treatments for stage III disease but not for stageII disease, in which adjuvant therapy is recommended only inthe setting of a clinical trial.2,3,4 Better assessment of prognosisin patients with stage II colorectal cancer could allow theselective use of adjuvant therapy and prevent unnecessary treatment.
It is known from immunohistochemical studies that some histopathologicallynegative lymph nodes draining colorectal tumors and other carcinomascontain minute amounts of tumor.5,6,7,8,9,10,11 However, theprognostic relevance of this phenomenon is not clear. Technicaladvances now permit the detection of micrometastases at themolecular level. For example, somatic mutations in oncogenesor tumor-suppressor genes that occur in the primary tumor arealso detectable in lymph-node DNA. Detection of micrometastasesby this method is not possible, however, in tumors that lacka genetic alteration suitable for amplification by the polymerasechain reaction (PCR). A more general method is the amplificationof cancer-specific RNA from lymph nodes. Carcinoembryonic antigenis present in the vast majority of colorectal tumors but notin normal tissues12 and is therefore a suitable marker of micrometastasesin colorectal cancer. The development of the reverse-transcriptase–PCRassay for carcinoembryonic antigen messenger RNA (mRNA) hasmade it possible to detect micrometastases in the lymph nodesand bone marrow of patients with colorectal cancer.13,14 Weused this method to evaluate whether the presence of micrometastasescan be used to identify patients with stage II colorectal cancerwho are at high risk for metastatic disease.
Methods
Patients
We studied 246 lymph nodes from 26 patients with TNM stage IIcolorectal cancer.15 The lymph nodes were obtained consecutivelyfrom curative resections performed at the surgical departmentof the Leiden University Medical Center between January 1990and February 1992. Preoperative and perioperative examinationsshowed no evidence of metastatic disease. Follow-up was carriedout in accordance with the department's protocol and was basedon periodic evaluations of the patient. The follow-up findingswere confirmed in all the patients as of November 1, 1997.
Tissue and RNA Isolation
Half of each resected node was fixed with formalin and embeddedin paraffin for routine histopathological examination. The otherhalf was snap-frozen in liquid nitrogen and stored at –80°Cuntil the time of RNA isolation. Total cellular RNA was isolatedfrom 50-µm sections of the lymph nodes. These sectionswere sandwiched between two series of 5-µm frozen sectionsthat were used as controls for staining with hematoxylin andeosin and immunohistochemical staining with antibodies againstcytokeratin and carcinoembryonic antigen. The RNA was extractedwith the use of Trizol (Life Technologies, Gaithersburg, Md.)in a single-step method as described previously.16 The RNA wasassessed spectrophotometrically and by electrophoresis on a0.8 percent agarose gel to determine its integrity and quantity.
Reverse-Transcriptase PCR
Nested PCR was performed according to the method described byGerhard et al.13 Briefly, complementary DNA (cDNA) was generatedwith avian myeloblastosis virus reverse transcriptase (BoehringerMannheim, Mannheim, Germany) with the use of 2 µg of totalRNA and primer B in a reaction volume of 20 µl. For thefirst round of PCR, 100-µl reactions were prepared with15 µl of the cDNA preparation and primers A and B.13 Reactiontubes were placed in a thermocycler and preheated at the denaturingtemperature; after initial denaturing at 95°C for 7 minutes,20 cycles of amplification were performed at 95°C (for 1minute) and 72°C (for 2 minutes), with a final extensionstep for 10 minutes. All mixtures were prepared on ice in aPCR workstation (CBS Scientific, Del Mar, Calif.).
For the second round of PCR, the reaction mixture containingprimer A and an internal primer C13 was prepared, and 96.5 µlwas dispensed into each tube. The tubes were overlaid with mineraloil and taken to another room, where 3.5 µl of the firstreaction mixture was pipetted through the oil with the use ofself-sealing sterile filter tips (Biozyme, Landgraaf, the Netherlands)to prevent cross-contamination.
Fifteen more cycles of amplification were performed under thesame conditions, except that 69°C (for one minute) was chosenas the annealing temperature. The PCR products were separatedon a 2 percent agarose gel and stained with ethidium bromide.The negative control samples that were coamplified in everyPCR procedure did not yield any product when this protocol wasused. However, a very faint band could be detected in some negativecontrol samples when 20 or 25 cycles were used in the secondPCR analysis. Consequently, we concluded that 15 cycles wereadequate in our assay.
Efficient amplification of the RNA was monitored by a controlPCR of hypoxanthine phosphoribosyltransferase (HPRT) cDNA withthe use of primer H1 (5'ACCGGCTTCCTCCTCCTGAGCAGTC3') and primerH2 (5'AGGACTCCAGATGTTTCCAAACTCAACTT3'). Seven lymph nodes fromtwo patients, one treated for an ischemic ulcer and the otherfor a tubulovillous adenoma, were used as negative controls.Furthermore, we performed a negative control reaction usinga confirmed metastatic lymph node by omitting the addition ofreverse transcriptase to check for possible contamination ofgenomic DNA.
Statistical Analysis
The primary end point was survival, measured from the date ofsurgery to the time of the last follow-up or death. Kaplan–Meiersurvival curves were constructed.17 For overall survival, alldeaths, irrespective of cause, were considered events. For adjustedsurvival, only cancer-related deaths were considered; data onthe patients who died from other causes or who were still aliveat the end of our study were censored. The rates of recurrencewere calculated from the time of surgery to the time of relapsewith the same methods. The comparison of the survival curvesfor the patients with and the patients without micrometastaseswas performed with the use of the log-rank test. We used a Coxregression analysis to estimate the simultaneous prognosticeffect of the variables.18 Fisher's exact test was used to evaluatethe numbers of patients with events according to various covariates;the Mann–Whitney U test was used to compare means. Alltests were two-sided, and a P value of less than 0.05 was consideredto indicate statistical significance.
Results
Expression of Carcinoembryonic Antigen–Specific mRNA
Intact RNA was isolated from 192 lymph nodes resected from 26patients. Fifty-four additional lymph nodes from 17 of these26 patients were excluded from our analysis. Most of these lostnodes were too small to be divided into two parts, and the othersdid not yield sufficient amounts of intact RNA, on the basisof the control PCR from the HPRT gene. A 131-bp PCR productwas amplified from a lymph node with histopathologically confirmedmetastasis and from tumor samples. Direct sequencing of thePCR product confirmed that the 3' end of the carcinoembryonicantigen gene had been amplified (data not shown). The controlsamples repeatedly failed to be amplified when 15 cycles wereused in the second PCR (Figure 1).
Figure 1. Nested Polymerase-Chain-Reaction (PCR) Assay for Carcinoembryonic Antigen and Hypoxanthine Phosphoribosyltransferase.
In the upper panel, lanes 4 through 15 show PCR results for lymph nodes from Patient 19. Lanes 4, 5, 9, 10, 11, 13, 14, and 15 show a PCR product of the expected length of 131 bp (carcinoembryonic-antigen gene product). This patient was therefore considered to have micrometastases. Lane 2 shows a positive control sample (a lymph node with microscopically visible metastases), and lanes 1 and 3 show negative controls: water and complementary DNA generated without reverse transcriptase, respectively. As shown in the lower panel, the same samples were analyzed for hypoxanthine phosphoribosyltransferase messenger RNA. Lanes 1 and 2 show negative controls, lane 3 a metastatic lymph node, and lanes 4 through 15 nodes from Patient 19. Lane 7 failed to show a PCR product and was therefore excluded from the final analysis. M denotes the molecular-size marker.
Overall, micrometastases were present in 36 of 192 lymph nodes(19 percent). Staining with hematoxylin and eosin and immunohistochemicalstaining with antibodies against cytokeratin and carcinoembryonicantigen failed to identify micrometastases in any of these lymphnodes. Fourteen patients (54 percent) had one or more nodesthat were positive in our assay. Table 1 presents the findingsin the lymph nodes and the clinical outcomes of the 26 patients.
Table 1. Molecular Detection of Micrometastasis and Outcomes of Patients with Stage II Colorectal Cancer.
Characteristics of the Patients
Table 2 shows the clinical characteristics of the 26 patientswhose lymph nodes were analyzed for the presence of micrometastases.The mean age was 68 years at the time of diagnosis. The meanage of the patients with micrometastases was 73 years, as comparedwith 63 years for the patients without nodal spread (P=0.17).There was no significant difference in the frequency of micrometastasesbetween tumors on the left and right sides. The histologic gradeof the primary tumors did not differ significantly between thepatients with and the patients without micrometastases (P=0.54).The depth of invasion was not a statistically significant factor.Lymphatic invasion was observed in four patients, all of whomhad evidence of micrometastatic spread of disease. Analysisof the diameter and growth pattern of the primary tumor andpreoperative serum carcinoembryonic antigen levels in both groupsdid not show any significant differences.
Table 2. Clinical Characteristics of 26 Patients with Histopathologically Negative Lymph Nodes Analyzed for the Presence of Carcinoembryonic-Antigen Messenger RNA.
Micrometastatic Disease and Survival
By the end of our study, seven cancer-related deaths had occurredin the 14 patients with evidence of micrometastases (50 percent)whereas only one cancer-related death was observed in the 12patients without evidence of nodal spread (8 percent). No patientswere lost to follow-up, and the mean length of follow-up forthe patients who were still alive was 73 months (range, 66 to85). The mean (±SE) observed five-year survival ratewas 54±10 percent and the adjusted five-year survivalrate was 70±10 percent.
At the end of follow-up, 9 of the 12 patients without micrometastaseswere still alive, as compared with 4 of the 14 patients withmicrometastases. Figure 2 shows the Kaplan–Meier curvesfor both groups, with observed and adjusted survival. For bothend points, the patients with micrometastases had a significantlyworse survival rate than the patients without micrometastases.The five-year observed survival rate for the patients with micrometastaseswas 36 percent, as compared with 75 percent for the patientswithout micrometastases (P=0.03); the five-year adjusted survivalrate was 50 percent, as compared with 91 percent (P=0.02 bythe log-rank test), respectively.
Figure 2. Kaplan–Meier Life-Table Analysis of the Observed and Adjusted Survival of Patients with Stage II Colorectal Cancer According to the Presence or Absence of Micrometastases.
For observed survival, all deaths were defined as events, whereas for adjusted survival only cancer-related deaths were considered. The patients with micrometastases had a significantly worse prognosis. The observed five-year survival rate for patients with micrometastases was 36 percent, as compared with 75 percent for those without micrometastases (P=0.03), and the adjusted five-year survival rate was 50 percent as compared with 91 percent (P=0.02).
Among the 12 patients without micrometastases, 1 had a recurrenceat 15 months (8 percent); thereafter, there were no recurrencesin this group. By contrast, in the group with micrometastasesthe recurrence rates at 36 and 60 months were 49 percent and58 percent, respectively. According to the log-rank test, thisdifference was statistically significant (P=0.02).
Micrometastases and Other Prognostic Variables
Analysis of micrometastases together with age, pT (pathologicallyconfirmed tumor) category, and the presence or absence of lymphaticinvasion with the Cox regression analysis showed that the differencesin observed and adjusted survival were completely attributableto the presence of micrometastatic disease. Age, pT category,and lymphatic invasion were not independent prognostic factors.The relative risk of death from any cause that was associatedwith the presence of micrometastases was 5.0 (P=0.03); for cancer-relateddeath, it was 11.7 (P=0.03).
Discussion
Our study demonstrates that the detection of micrometastasesby reverse-transcriptase–PCR amplification of carcinoembryonicantigen mRNA in lymph nodes from patients with stage II colorectalcancer may have clinical value. We found that such micrometastaseswere associated with a significant reduction in the five-yearsurvival rate, from 91 percent in patients without micrometastasesto 50 percent in patients with micrometastatic disease in oneor more lymph nodes.
There is a substantial literature on occult metastatic diseasein colorectal cancer.5,6,7,8 Most studies show that micrometastasesdo occur, but they disagree about the prognostic significanceof such a finding. In most studies, antibodies against cytokeratinsand carcinoembryonic antigen were used to detect micrometastases.The differences in the choice of antibody, staining procedures,and interpretation may explain in part the discrepant results.Recent technical advances permit the detection of micrometastasesat the DNA or RNA level. Known oncogenic mutations in the primarytumor can be used to detect very small amounts of tumor in lymphnodes, bone marrow aspirates, and surgical-resection margins.20,21,22Using this method, Hayashi et al. found micrometastases in lymphnodes of 52 percent of patients with Dukes' stage A and stageB tumors, in which lymph-node metastases are undetectable byroutine methods.23 However, they failed to detect mutationssuitable for amplification by PCR in 49 of 120 patients, makingthis method unsuitable for use in a clinical setting.
A second method uses the reverse-transcriptase PCR to detectcancer-specific mRNA in tissues.13,24,25,26,27 Amplificationof carcinoembryonic antigen mRNA has been used to detect minuteamounts of tumor in the lymph nodes and bone marrow of patientswith gastrointestinal tumors (at concentrations as low as 10tumor cells in 5 x 107 normal bone marrow cells).26 Our studyexamined whether the results of this sensitive method correlatewith clinical outcome.
Our data on survival are strikingly similar to those in recentstudies of the loss of heterozygosity of chromosome 18q andthe expression of the DCC (deleted in colorectal cancer) proteinin stage II and stage III colorectal tumors.28,29 Survival decreasedfrom 93 percent to 54 percent in patients with stage II tumorswith loss of heterozygosity and from 94 percent to 61 percentin patients with stage II tumors with loss of DCC expression.Although these findings are clinically relevant, the biologicbasis for them is unknown. The similarity of the prognosticinformation obtained by the analysis of DCC and the detectionof micrometastases by reverse-transcriptase PCR suggests thatthe inactivation of the gene for DCC or an additional gene onchromosome 18q results in the early dissemination of tumor cellsto locoregional lymph nodes. This idea is compatible with theassociation of loss of chromosome 18q with distant metastases.30In any case, it seems clear that patients with TNM stage IIcolorectal cancer are a heterogeneous group. Fifty percent havean excellent prognosis, whereas in the other half the prognosisis similar to that of patients with stage III disease. It ispossible that these groups can be distinguished by an analysisof micrometastatic disease in lymph nodes.
Source Information
From the Department of Surgery (G.-J.L., C.J.H.V., R.A.E.M.T.), the Department of Pathology (A.-M.C.-J., J.H.J.M.K., C.J.C.), and the Department of Medical Statistics (J.H.), Leiden University Medical Center, Leiden, the Netherlands.
Address reprint requests to Dr. Tollenaar at the Department of Surgery K6R, Leiden University Medical Center, P.O. Box 9600, 2300 RC, Leiden, the Netherlands.
References
Hermanek P. pTNM and residual tumor classifications: problems of assessment and prognostic significance. World J Surg 1995;19:184-190. [CrossRef][Medline]
Moertel CG. Chemotherapy for colorectal cancer. N Engl J Med 1994;330:1136-1142. [Free Full Text]
Moertel CG, Fleming TR, Macdonald JS, et al. Intergroup study of fluorouracil plus levamisole as adjuvant therapy for stage II/Dukes' B2 colon cancer. J Clin Oncol 1995;13:2936-2943. [Abstract]
O'Connell MJ, Mailliard JA, Kahn MJ, et al. Controlled trial of fluorouracil and low-dose leucovorin given for 6 months as postoperative adjuvant therapy for colon cancer. J Clin Oncol 1997;15:246-250. [Free Full Text]
Greenson JK, Isenhart CE, Rice R, Mojzisik C, Houchens D, Martin EW Jr. Identification of occult micrometastases in pericolic lymph nodes of Dukes' B colorectal cancer patients using monoclonal antibodies against cytokeratin and CC49. Cancer 1994;73:563-569. [CrossRef][Medline]
Jeffers MD, O'Dowd GM, Mulcahy H, Stagg M, O'Donoghue DP, Toner M. The prognostic significance of immunohistochemically detected lymph node micrometastases in colorectal carcinoma. J Pathol 1994;172:183-187. [CrossRef][Medline]
Cutait R, Alves VAF, Lopes LC, et al. Restaging of colorectal cancer based on the identification of lymph node micrometastases through immunoperoxidase staining of CEA and cytokeratins. Dis Colon Rectum 1991;34:917-920. [CrossRef][Medline]
Adell G, Boeryd B, Franlund B, Sjodahl R, Hakansson L. Occurrence and prognostic importance of micrometastases in regional lymph nodes in Dukes' B colorectal carcinoma: an immunohistochemical study. Eur J Surg 1996;162:637-642. [Medline]
International (Ludwig) Breast Cancer Study Group. Prognostic importance of occult axillary lymph node micrometastases from breast cancers. Lancet 1990;335:1565-1568. [CrossRef][Medline]
Passlick B, Izbicki JR, Kubuschok B, et al. Immunohistochemical assessment of individual tumor cells in lymph nodes of patients with non-small-cell lung cancer. J Clin Oncol 1994;12:1827-1832. [Free Full Text]
Izbicki JR, Hosch SB, Pichlmeier U, et al. Prognostic value of immunohistochemically identifiable tumor cells in lymph nodes of patients with completely resected esophageal cancer. N Engl J Med 1997;337:1188-1194. [Free Full Text]
Shively JE, Beatty JD. CEA-related antigens: molecular biology and clinical significance. Crit Rev Oncol Hematol 1985;2:355-399. [Medline]
Gerhard M, Juhl H, Kalthoff H, Schreiber HW, Wagener C, Neumaier M. Specific detection of carcinoembryonic antigen-expressing tumor cells in bone marrow aspirates by polymerase chain reaction. J Clin Oncol 1994;12:725-729. [Abstract]
Mori M, Mimori K, Inoue H, et al. Detection of cancer micrometastases in lymph nodes by reverse transcriptase-polymerase chain reaction. Cancer Res 1995;55:3417-3420. [Free Full Text]
Sobin LH, Wittekind C, eds. TNM classification of malignant tumours. 5th ed. New York: Wiley-Liss, 1997.
Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987;162:156-159. [Medline]
Kaplan EL, Meier P. Nonparametric estimation from incomplete observations. J Am Stat Assoc 1958;53:457-81.
Cox DR. Regression models and life-tables. J R Stat Soc [B] 1972;34:187-220.
Jass JR, Atkin WS, Cuzick J, et al. The grading of rectal cancer: historical perspectives and a multivariate analysis of 447 cases. Histopathology 1986;10:437-459. [Medline]
Hayashi N, Arakawa H, Nagase H, et al. Genetic diagnosis identifies occult lymph node metastases undetectable by the histopathological method. Cancer Res 1994;54:3853-3856. [Free Full Text]
Nakamori S, Kameyama M, Furukawa H, et al. Genetic detection of colorectal cancer cells in circulation and lymph nodes. Dis Colon Rectum 1997;40:Suppl:S29-S36. [CrossRef][Medline]
Brennan JA, Mao L, Hruban RH, et al. Molecular assessment of histopathological staging in squamous-cell carcinoma of the head and neck. N Engl J Med 1995;332:429-435. [Free Full Text]
Hayashi N, Ito I, Yanagisawa A, et al. Genetic diagnosis of lymph-node metastasis in colorectal cancer. Lancet 1995;345:1257-1259. [CrossRef][Medline]
Smith B, Selby P, Southgate J, Pittman K, Bradley C, Blair GE. Detection of melanoma cells in peripheral blood by means of reverse transcriptase and polymerase chain reaction. Lancet 1991;338:1227-1229. [CrossRef][Medline]
Schoenfeld A, Luqmani Y, Smith D, et al. Detection of breast cancer micrometastases in axillary lymph nodes by using polymerase chain reaction. Cancer Res 1994;54:2986-2990. [Free Full Text]
Neumaier M, Gerhard M, Wagener C. Diagnosis of micrometastases by the amplification of tissue-specific genes. Gene 1995;159:43-47. [CrossRef][Medline]
Gunn J, McCall JL, Yun K, Wright PA. Detection of micrometastases in colorectal cancer patients by K19 and K20 reverse-transcription polymerase chain reaction. Lab Invest 1996;75:611-616. [Medline]
Shibata D, Reale MA, Lavin P, et al. The DCC protein and prognosis in colorectal cancer. N Engl J Med 1996;335:1727-1732. [Free Full Text]
Jen J, Kim H, Piantadosi S, et al. Allelic loss of chromosome 18q and prognosis in colorectal cancer. N Engl J Med 1994;331:213-221. [Free Full Text]
Kern SE, Fearon ER, Tersmette KWF, et al. Clinical and pathological associations with allelic loss in colorectal carcinoma. JAMA 1989;261:3099-3103. [Erratum, JAMA 1989;262:1952.] [Free Full Text]
Hughes, S. J., Xi, L., Gooding, W. E., Cole, D. J., Mitas, M., Metcalf, J., Bhargava, R., Dabbs, D., Ching, J., Kozma, L., McMillan, W., Godfrey, T. E.
(2009). A Quantitative Reverse Transcription-PCR Assay for Rapid, Automated Analysis of Breast Cancer Sentinel Lymph Nodes. J. Mol. Diagn.
11: 576-582
[Abstract][Full Text]
D'Armento, G., Daniele, L., Mariani, S., Ottaviani, D., Mussa, A., Cassoni, P., Sapino, A., Bussolati, G.
(2009). Added Value of Combined Gene and Protein Expression of CK20 and CEA in Non--macroscopically Involved Lymph Nodes of Colorectal Cancer. INT J SURG PATHOL
17: 93-98
[Abstract]
Jiang, Y., Casey, G., Lavery, I. C., Zhang, Y., Talantov, D., Martin-McGreevy, M., Skacel, M., Manilich, E., Mazumder, A., Atkins, D., Delaney, C. P., Wang, Y.
(2008). Development of a Clinically Feasible Molecular Assay to Predict Recurrence of Stage II Colon Cancer. J. Mol. Diagn.
10: 346-354
[Abstract][Full Text]
Turner, R. R., Li, C., Compton, C. C.
(2007). Newer Pathologic Assessment Techniques for Colorectal Carcinoma. Clin. Cancer Res.
13: 6871s-6876s
[Abstract][Full Text]
Nicastri, D. G., Doucette, J. T., Godfrey, T. E., Hughes, S. J.
(2007). Is Occult Lymph Node Disease in Colorectal Cancer Patients Clinically Significant?: A Review of the Relevant Literature. J. Mol. Diagn.
9: 563-571
[Abstract][Full Text]
MacGuill, M. J, Barrett, C., Ravi, N., MacDonald, G., Reynolds, J. V
(2007). Isolated tumour cells in pathological node-negative lymph nodes adversely affect prognosis in cancer of the oesophagus or oesophagogastric junction. J. Clin. Pathol.
60: 1108-1111
[Abstract][Full Text]
Sezeur, A., Chatelet, F.P., Cywiner, Ch., de Labriolle-Vaylet, Cl., Chastang, C., Billotey, Cl., Malafosse, M., Gallot, D., Betton, P., Montravers, F., Carvajal-Gonzalez, S., Askienazy, S., Talbot, J.N., Rain, J.D., Milhaud, G., Saumon, G., Barbet, J., Gruaz-Guyon, A.
(2007). Pathology Underrates Colon Cancer Extranodal and Nodal Metastases; Ex vivo Radioimmunodetection Helps Staging. Clin. Cancer Res.
13: 5592s-5597s
[Abstract][Full Text]
Al-Mulla, F., Hagan, S., Behbehani, A. I., Bitar, M. S., George, S. S., Going, J. J., Garcia, J. J. C., Scott, L., Fyfe, N., Murray, G. I., Kolch, W.
(2006). Raf Kinase Inhibitor Protein Expression in a Survival Analysis of Colorectal Cancer Patients. JCO
24: 5672-5679
[Abstract][Full Text]
Mescoli, C, Rugge, M, Pucciarelli, S, Russo, V M, Pennelli, G, Guido, M, Nitti, D
(2006). High prevalence of isolated tumour cells in regional lymph nodes from pN0 colorectal cancer. J. Clin. Pathol.
59: 870-874
[Abstract][Full Text]
Bilchik, A. J., DiNome, M., Saha, S., Turner, R. R., Wiese, D., McCarter, M., Hoon, D. S. B., Morton, D. L.
(2006). Prospective Multicenter Trial of Staging Adequacy in Colon Cancer: Preliminary Results. Arch Surg
141: 527-534
[Abstract][Full Text]
Xi, L., Coello, M. C., Litle, V. R., Raja, S., Gooding, W. E., Yousem, S. A., El-Hefnawy, T., Landreneau, R. J., Luketich, J. D., Godfrey, T. E.
(2006). A Combination of Molecular Markers Accurately Detects Lymph Node Metastasis in Non-Small Cell Lung Cancer Patients. Clin. Cancer Res.
12: 2484-2491
[Abstract][Full Text]
Xi, L., Gooding, W., McCarty, K., Godfrey, T. E., Hughes, S. J.
(2006). Identification of mRNA markers for molecular staging of lymph nodes in colorectal cancer.. Clin. Chem.
52: 520-523
[Abstract][Full Text]
Kurokawa, S, Arimura, Y, Yamamoto, H, Adachi, Y, Endo, T, Sato, T, Suga, T, Hosokawa, M, Shinomura, Y, Imai, K
(2005). Tumour matrilysin expression predicts metastatic potential of stage I (pT1) colon and rectal cancers. Gut
54: 1751-1758
[Abstract][Full Text]
Codignola, C., Zorzi, F., Zaniboni, A., Mutti, S., Rizzi, A., Padolecchia, E., Morandi, G. B.
(2005). Is there any Role for Sentinel Node Mapping in Colorectal Cancer Staging? Personal Experience and Review of the Literature. Jpn J Clin Oncol
35: 645-650
[Abstract][Full Text]
Kong, S L, Salto-Tellez, M, Leong, A P K, Chan, Y H, Koay, E S C
(2005). Discordant quantitative detection of putative biomarkers in nodal micrometastases of colorectal cancer: biological and clinical implications. J. Clin. Pathol.
58: 839-844
[Abstract][Full Text]
Ferris, R. L., Xi, L., Raja, S., Hunt, J. L., Wang, J., Gooding, W. E., Kelly, L., Ching, J., Luketich, J. D., Godfrey, T. E.
(2005). Molecular Staging of Cervical Lymph Nodes in Squamous Cell Carcinoma of the Head and Neck. Cancer Res.
65: 2147-2156
[Abstract][Full Text]
Zaniboni, A., Labianca, R.
(2004). Adjuvant therapy for stage II colon cancer: an elephant in the living room?. Ann Oncol
15: 1310-1318
[Abstract][Full Text]
Ho, S. B., Hyslop, A., Albrecht, R., Jacobson, A., Spencer, M., Rothenberger, D. A., Niehans, G. A., D'Cunha, J., Kratzke, R. A.
(2004). Quantification of Colorectal Cancer Micrometastases in Lymph Nodes by Nested and Real-Time Reverse Transcriptase-PCR Analysis for Carcinoembryonic Antigen. Clin. Cancer Res.
10: 5777-5784
[Abstract][Full Text]
Onate-Ocana, L. F., Montesdeoca, R., Lopez-Graniel, C. M., Aiello-Crocifoglio, V., Mondragon-Sanchez, R., Cortina-Borja, M., Herrera-Goepfert, R., Oros-Ovalle, C., Gallardo-Rincon, D.
(2004). Identification of Patients with High-risk Lymph Node-negative Colorectal Cancer and Potential Benefit from Adjuvant Chemotherapy. Jpn J Clin Oncol
34: 323-328
[Abstract][Full Text]
Wang, Y., Jatkoe, T., Zhang, Y., Mutch, M. G., Talantov, D., Jiang, J., McLeod, H. L., Atkins, D.
(2004). Gene Expression Profiles and Molecular Markers To Predict Recurrence of Dukes' B Colon Cancer. JCO
22: 1564-1571
[Abstract][Full Text]
Dieterle, C. P., Conzelmann, M., Linnemann, U., Berger, M. R.
(2004). Detection of Isolated Tumor Cells by Polymerase Chain Reaction-Restriction Fragment Length Polymorphism for K-ras Mutations in Tissue Samples of 199 Colorectal Cancer Patients. Clin. Cancer Res.
10: 641-650
[Abstract][Full Text]
Mesker, W. E., Doekhie, F. S., Vrolijk, H., Keyzer, R., Sloos, W. C. R., Morreau, H., O'Kelly, P. S., de Bock, G. H., Tollenaar, R. A. E. M., Tanke, H. J.
(2003). Automated Analysis of Multiple Sections for the Detection of Occult Cells in Lymph Nodes. Clin. Cancer Res.
9: 4826-4834
[Abstract][Full Text]
Cserni, G
(2003). Nodal staging of colorectal carcinomas and sentinel nodes. J. Clin. Pathol.
56: 327-335
[Abstract][Full Text]
Bilchik, A. J., Nora, D. T., Sobin, L. H., Turner, R. R., Trocha, S., Krasne, D., Morton, D. L.
(2003). Effect of Lymphatic Mapping on the New Tumor-Node-Metastasis Classification for Colorectal Cancer. JCO
21: 668-672
[Abstract][Full Text]
Nieuwenhuis, E. J. C., Jaspars, L. H., Castelijns, J. A., Bakker, B., Wishaupt, R. G. A., Denkers, F., Leemans, C. R., Snow, G. B., Brakenhoff, R. H.
(2003). Quantitative Molecular Detection of Minimal Residual Head and Neck Cancer in Lymph Node Aspirates. Clin. Cancer Res.
9: 755-761
[Abstract][Full Text]
Jakub, J. W., Pendas, S., Reintgen, D. S.
(2003). Current Status of Sentinel Lymph Node Mapping and Biopsy: Facts and Controversies. The Oncologist
8: 59-68
[Abstract][Full Text]
Bilchik, A. J., Nora, D. T., Saha, S., Turner, R., Wiese, D., Kuo, C., Ye, X., Morton, D. L., Hoon, D. S. B.
(2002). The Use of Molecular Profiling of Early Colorectal Cancer to Predict Micrometastases. Arch Surg
137: 1377-1383
[Abstract][Full Text]
Weihrauch, M. R., Skibowski, E., Koslowsky, T. C., Voiss, W., Re, D., Kuhn-Regnier, F., Bannwarth, C., Siedek, M., Diehl, V., Bohlen, H.
(2002). Immunomagnetic Enrichment and Detection of Micrometastases in Colorectal Cancer: Correlation With Established Clinical Parameters. JCO
20: 4338-4343
[Abstract][Full Text]
Noura, S., Yamamoto, H., Ohnishi, T., Masuda, N., Matsumoto, T., Takayama, O., Fukunaga, H., Miyake, Y., Ikenaga, M., Ikeda, M., Sekimoto, M., Matsuura, N., Monden, M.
(2002). Comparative Detection of Lymph Node Micrometastases of Stage II Colorectal Cancer by Reverse Transcriptase Polymerase Chain Reaction and Immunohistochemistry. JCO
20: 4232-4241
[Abstract][Full Text]
Yamashita, J.-i., Matsuo, A., Kurusu, Y., Saishoji, T., Hayashi, N., Ogawa, M.
(2002). Preoperative evidence of circulating tumor cells by means of reverse transcriptase-polymerase chain reaction for carcinoembryonic antigen messenger RNA is an independent predictor of survival in non-small cell lung cancer: A prospective study. J. Thorac. Cardiovasc. Surg.
124: 299-305
[Abstract][Full Text]
Raja, S., El-Hefnawy, T., Kelly, L. A., Chestney, M. L., Luketich, J. D., Godfrey, T. E.
(2002). Temperature-controlled Primer Limit for Multiplexing of Rapid, Quantitative Reverse Transcription-PCR Assays: Application to Intraoperative Cancer Diagnostics. Clin. Chem.
48: 1329-1337
[Abstract][Full Text]
Vlems, F A, Diepstra, J H S, Cornelissen, I M H A, Ruers, T J M, Ligtenberg, M J L, Punt, C J A, van Krieken, J H J M, Wobbes, T., van Muijen, G N P
(2002). Limitations of cytokeratin 20 RT-PCR to detect disseminated tumour cells in blood and bone marrow of patients with colorectal cancer: expression in controls and downregulation in tumour tissue. Mol. Pathol.
55: 156-163
[Abstract][Full Text]
Silva, J M, Rodriguez, R, Garcia, J M, Munoz, C, Silva, J, Dominguez, G, Provencio, M, Espana, P, Bonilla, F
(2002). Detection of epithelial tumour RNA in the plasma of colon cancer patients is associated with advanced stages and circulating tumour cells. Gut
50: 530-534
[Abstract][Full Text]
Wong, J. H., Steinemann, S., Tom, P., Morita, S., Tauchi-Nishi, P.
(2002). Volume of Lymphatic Metastases Does Not Independently Influence Prognosis in Colorectal Cancer. JCO
20: 1506-1511
[Abstract][Full Text]
Raja, S., Luketich, J. D., Kelly, L. A., Gooding, W. E., Finkelstein, S. D., Godfrey, T. E.
(2002). Rapid, quantitative reverse transcriptase-polymerase chain reaction: Application to intraoperative molecular detection of occult metastases in esophageal cancer. J. Thorac. Cardiovasc. Surg.
123: 475-483
[Abstract][Full Text]
D'Cunha, J., Corfits, A. L., Herndon, J. E. II, Kern, J. A., Kohman, L. J., Patterson, G. A., Kratzke, R. A., Maddaus, M. A.
(2002). Molecular staging of lung cancer: Real-time polymerase chain reaction estimation of lymph node micrometastatic tumor cell burden in stage I non-small cell lung cancer--preliminary results of cancer and leukemia group B trial 9761. J. Thorac. Cardiovasc. Surg.
123: 484-491
[Abstract][Full Text]
Noura, S., Yamamoto, H., Miyake, Y., no Kim, B., Takayama, O., Seshimo, I., Ikenaga, M., Ikeda, M., Sekimoto, M., Matsuura, N., Monden, M.
(2002). Immunohistochemical Assessment of Localization and Frequency of Micrometastases in Lymph Nodes of Colorectal Cancer. Clin. Cancer Res.
8: 759-767
[Abstract][Full Text]
Rosenberg, R., Hoos, A., Mueller, J., Baier, P., Stricker, D., Werner, M., Nekarda, H., Siewert, J.-R.
(2002). Prognostic Significance of Cytokeratin-20 Reverse Transcriptase Polymerase Chain Reaction in Lymph Nodes of Node-Negative Colorectal Cancer Patients. JCO
20: 1049-1055
[Abstract][Full Text]
Godfrey, T. E., Raja, S., Finkelstein, S. D., Gooding, W. E., Kelly, L. A., Luketich, J. D.
(2001). Prognostic Value of Quantitative Reverse Transcription-Polymerase Chain Reaction in Lymph Node-negative Esophageal Cancer Patients. Clin. Cancer Res.
7: 4041-4048
[Abstract][Full Text]
Zealley, I. A., Skehan, S. J., Rawlinson, J., Coates, G., Nahmias, C., Somers, S.
(2001). Selection of Patients for Resection of Hepatic Metastases: Improved Detection of Extrahepatic Disease with FDG PET. RadioGraphics
21: S55-69
[Abstract][Full Text]
Miyake, Y., Yamamoto, H., Fujiwara, Y., Ohue, M., Sugita, Y., Tomita, N., Sekimoto, M., Matsuura, N., Shiozaki, H., Monden, M.
(2001). Extensive Micrometastases to Lymph Nodes as a Marker for Rapid Recurrence of Colorectal Cancer: A Study of Lymphatic Mapping. Clin. Cancer Res.
7: 1350-1357
[Abstract][Full Text]
Bilchik, A. J., Saha, S., Wiese, D., Stonecypher, J. A., Wood, T. F., Sostrin, S., Turner, R. R., Wang, H.-J., Morton, D. L., Hoon, D. S.B.
(2001). Molecular Staging of Early Colon Cancer on the Basis of Sentinel Node Analysis: A Multicenter Phase II Trial. JCO
19: 1128-1136
[Abstract][Full Text]
Moesta, K. T., Ebert, B., Handke, T., Nolte, D., Nowak, C., Haensch, W. E., Pandey, R. K., Dougherty, T. J., Rinneberg, H., Schlag, P. M.
(2001). Protoporphyrin IX Occurs Naturally in Colorectal Cancers and Their Metastases. Cancer Res.
61: 991-999
[Abstract][Full Text]
Clayton, S. J., Scott, F. M., Walker, J., Callaghan, K., Haque, K., Liloglou, T., Xinarianos, G., Shawcross, S., Ceuppens, P., Field, J. K., Fox, J. C.
(2000). K-ras Point Mutation Detection in Lung Cancer: Comparison of Two Approaches to Somatic Mutation Detection Using ARMS Allele-specific Amplification. Clin. Chem.
46: 1929-1938
[Abstract][Full Text]
Masuda, N., Tamaki, Y., Sakita, I., Ooka, M., Ohnishi, T., Kadota, M., Aritake, N., Okubo, K., Monden, M.
(2000). Clinical Significance of Micrometastases in Axillary Lymph Nodes Assessed by Reverse Transcription-Polymerase Chain Reaction in Breast Cancer Patients. Clin. Cancer Res.
6: 4176-4185
[Abstract][Full Text]
van Houten, V. M. M., Tabor, M. P., van den Brekel, M. W. M., Denkers, F., Wishaupt, R. G. A., Kummer, J. A., Snow, G. B., Brakenhoff, R. H.
(2000). Molecular Assays for the Diagnosis of Minimal Residual Head-and-Neck Cancer: Methods, Reliability, Pitfalls, and Solutions. Clin. Cancer Res.
6: 3803-3816
[Abstract][Full Text]
Cascinu, S., Staccioli, M. P., Gasparini, G., Giordani, P., Catalano, V., Ghiselli, R., Rossi, C., Baldelli, A. M., Graziano, F., Saba, V., Muretto, P., Catalano, G.
(2000). Expression of Vascular Endothelial Growth Factor Can Predict Event-free Survival in Stage II Colon Cancer. Clin. Cancer Res.
6: 2803-2807
[Abstract][Full Text]
Takemasa, I., Yamamoto, H., Sekimoto, M., Ohue, M., Noura, S., Miyake, Y., Matsumoto, T., Aihara, T., Tomita, N., Tamaki, Y., Sakita, I., Kikkawa, N., Matsuura, N., Shiozaki, H., Monden, M.
(2000). Overexpression of CDC25B Phosphatase as a Novel Marker of Poor Prognosis of Human Colorectal Carcinoma. Cancer Res.
60: 3043-3050
[Abstract][Full Text]
Okami, J., Dohno, K., Sakon, M., Iwao, K., Yamada, T., Yamamoto, H., Fujiwara, Y., Nagano, H., Umeshita, K., Matsuura, N., Nakamori, S., Monden, M.
(2000). Genetic Detection for Micrometastasis in Lymph Node of Biliary Tract Carcinoma. Clin. Cancer Res.
6: 2326-2332
[Abstract][Full Text]
Lindblom, A., Liljegren, A.
(2000). Regular review: Tumour markers in malignancies. BMJ
320: 424-427
[Full Text]
Guan, R. J., Ford, H. L., Fu, Y., Li, Y., Shaw, L. M., Pardee, A. B.
(2000). Drg-1 as a Differentiation-related, Putative Metastatic Suppressor Gene in Human Colon Cancer. Cancer Res.
60: 749-755
[Abstract][Full Text]
Cagir, B., Gelmann, A., Park, J., Fava, T., Tankelevitch, A., Bittner, E. W., Weaver, E. J., Palazzo, J. P., Weinberg, D., Fry, R. D., Waldman, S. A.
(1999). Guanylyl Cyclase C Messenger RNA Is a Biomarker for Recurrent Stage II Colorectal Cancer. ANN INTERN MED
131: 805-812
[Abstract][Full Text]
Sanchez-Cespedes, M., Esteller, M., Hibi, K., Cope, F. O., Westra, W. H., Piantadosi, S., Herman, J. G., Jen, J., Sidransky, D.
(1999). Molecular Detection of Neoplastic Cells in Lymph Nodes of Metastatic Colorectal Cancer Patients Predicts Recurrence. Clin. Cancer Res.
5: 2450-2454
[Abstract][Full Text]
Ghossein, R. A., Bhattacharya, S., Rosai, J.
(1999). Molecular Detection of Micrometastases and Circulating Tumor Cells in Solid Tumors. Clin. Cancer Res.
5: 1950-1960
[Abstract][Full Text]
Pantel, K., Cote, R. J., Fodstad, O.
(1999). Detection and Clinical Importance of Micrometastatic Disease. JNCI J Natl Cancer Inst
91: 1113-1124
[Abstract][Full Text]
Weitz, J., Kienle, P., Magener, A., Koch, M., Schrodel, A., Willeke, F., Autschbach, F., Lacroix, J., Lehnert, T., Herfarth, C., Doeberitz, M. v. K.
(1999). Detection of Disseminated Colorectal Cancer Cells in Lymph Nodes, Blood and Bone Marrow. Clin. Cancer Res.
5: 1830-1836
[Abstract][Full Text]
Merrie, A. E.H., Yun, K., McCall, J. L., Ghossein, R. A., Bostick, P. J., Hoon, D. S.B., Cote, R. J., Liefers, G.-J., Cleton-Jansen, A.-M., Tollenaar, R. A.E.M.
(1998). Detection of Carcinoembryonic Antigen Messenger RNA in Lymph Nodes from Patients with Colorectal Cancer. NEJM
339: 1642-1644
[Full Text]
Lindblom, A.
(1998). Improved Tumor Staging in Colorectal Cancer. NEJM
339: 264-265
[Full Text]
Previous
