Background Obstetrical complications such as severe preeclampsia,abruptio placentae, fetal growth retardation, and stillbirthare associated with intervillous or spiral-artery thrombosisand inadequate placental perfusion. Whether these complicationsare associated with an increased frequency of thrombophilicmutations is not known.
Methods We studied 110 women who had one of the above-mentionedobstetrical complications and 110 women who had one or morenormal pregnancies. The women were tested several days afterdelivery for the mutation of adenine to guanine at nucleotide506 in the factor V gene (factor V Leiden), the mutation ofcytosine to thymine at nucleotide 677 in the gene encoding methylenetetrahydrofolatereductase, and the mutation of guanine to adenine at nucleotide20210 in the prothrombin gene. Two to three months after deliverythe women were tested for deficiency of protein C, protein S,or antithrombin III and for the presence of anticardiolipinantibodies.
Results The mutation at nucleotide 506 in the factor V genewas detected in 22 of the women with obstetrical complicationsand in 7 of the women with normal pregnancies (20 percent and6 percent, respectively; P=0.003). Twenty-four women with complications,as compared with nine women without complications, were homozygousfor the C677T mutation in the gene encoding methylenetetrahydrofolatereductase (22 percent and 8 percent, respectively; P=0.005).The G20210A mutation in the prothrombin gene was found in 11women with complications as compared with 3 women without complications(10 percent and 3 percent, respectively; P=0.03). Overall, 57women with obstetrical complications had a thrombophilic mutation,as compared with 19 women with normal pregnancies (52 percentand 17 percent, respectively; P<0.001). Deficiency of proteinS, protein C, or antithrombin III or anticardiolipin antibodieswere detected in an additional 14 women with complications,as compared with 1 woman with a normal pregnancy (13 percentand 1 percent, respectively; P<0.001).
Conclusions Women with serious obstetrical complications havean increased incidence of mutations predisposing them to thrombosisand other inherited and acquired forms of thrombophilia.
Severe preeclampsia, abruptio placentae, fetal growth retardation,and stillbirth contribute greatly to maternal and fetal morbidityand mortality. Their causes are unknown, but all of them maybe associated with abnormal placental vasculature and disturbancesof hemostasis, leading to inadequate maternalfetal circulation.1,2,3,4,5,6,7
Several thrombophilic mutations are associated with an increasedrisk of thromboembolic complications. Resistance to activatedprotein C caused by an adenine-to-guanine mutation at nucleotide506 in the factor V gene (the factor V Leiden mutation) hasbeen linked with an increased risk of venous thromboembolism.8,9,10Homozygosity for the mutation of cytosine to thymine at nucleotide677 in the gene encoding methylenetetrahydrofolate reductaseresults in decreased synthesis of 5-methyltetrahydrofolate,the primary methyl donor in the conversion of homocysteine tomethionine, and the resulting increase in plasma homocysteineconcentrations is a risk factor for venous and arterial thrombosis.11,12A recently described guanine-to-adenine mutation at nucleotide20210 in the prothrombin gene is associated with higher plasmaconcentrations of prothrombin and an increased risk of venousthromboembolism,13 myocardial infarction,14 and cerebral-veinthrombosis.15
We hypothesized that the mutations predisposing patients tothrombosis may be important risk factors for obstetrical complicationsthat are related to inadequate maternalfetal circulation.We therefore studied the relation between severe preeclampsia,abruptio placentae, fetal growth retardation, and stillbirth,on the one hand, and several thrombophilic mutations, on theother. We also searched for deficiency of protein S, proteinC, or antithrombin III and for the presence of anticardiolipinantibodies and lupus anticoagulant, which are also associatedwith thrombophilia.
Methods
Study Subjects
Between September 1996 and November 1997, we studied 110 consecutivewomen who had pregnancies complicated by severe preeclampsia,abruptio placentae, fetal growth retardation, or stillbirth.Severe preeclampsia was defined by a blood pressure higher than160/110 mm Hg; urinary protein excretion greater than 5 g per24 hours; a platelet count of less than 100,000 per cubic millimeter;the combination of hemolysis, high serum aminotransferase concentrations,and a platelet count below 100,000 per cubic millimeter; oreclampsia.16 Abruptio placentae was diagnosed on the basis ofclinical criteria, and only women with grade 2 or 3 abruption(abruption associated with vaginal bleeding or concealed hemorrhage;uterine tenderness; and fetal distress, maternal shock, or maternalcoagulopathy) were included.6 Fetal growth retardation was definedby a birth weight below the 5th percentile for gestational age,according to the criteria of Brenner et al.17 The exclusioncriteria for women whose pregnancies were complicated by fetalgrowth retardation were the presence of congenital malformationsor chromosomal abnormalities in the fetus, recent cytomegalovirusinfection (defined by the presence of IgM anticytomegalovirusantibodies or increasing titers of IgG anticytomegalovirus antibodiesin paired blood samples obtained three to four weeks apart,as well as cytomegalovirus in the urine of the newborn), ordrug or alcohol abuse during pregnancy. Stillbirth was definedas fetal death after 23 weeks' gestation. Exclusion criteriain cases of stillbirth were abnormal results of karyotypingof the stillborn fetus or congenital anomalies detected at autopsy,Venereal Disease Research Laboratory results positive for syphilis,positive tests for antibodies against red-cell antigens, recentcytomegalovirus infection, positive cultures for Listeria monocytogenesin samples from the fetus and placenta, and abnormal resultson the oral glucose-tolerance test.
Women who had more than one complication during pregnancy (forexample, severe preeclampsia and fetal growth retardation) wereassigned to one of the four groups according to the followinghierarchy: severe preeclampsia was considered the most importantcomplication, followed by abruptio placentae, fetal growth retardation,and then stillbirth.
We also studied 110 women who had normal pregnancies and nohistory of thromboembolic complications during any pregnancy.Each of these women was matched for age and for the geographicorigin of each parent with a woman with normal pregnancy. Allthe women were of Jewish origin and were classified as Ashkenazi,non-Ashkenazi, or mixed Ashkenazi and non-Ashkenazi accordingto their family origin. The study was approved by the ethicscommittee of the Tel Aviv Sourasky Medical Center, and informedconsent was obtained from each woman. The women in both groupswere enrolled while in the hospital after delivery.
At enrollment, blood was drawn from all the women for DNA analysisfor thrombophilic mutations. Investigation of women whose pregnancieswere complicated by fetal growth retardation or stillbirth wasinitiated at that time (e.g., a cytomegalovirus test and autopsyof stillborn infants were performed). The women were then askedto return at least two months after the delivery, at which timeblood was drawn for the assessment of protein S, protein C,antithrombin III, anticardiolipin antibodies, and lupus anticoagulant.All the women had received prenatal care, which is covered bythe health insurance mandated by law for all the citizens ofIsrael.
Molecular Diagnosis
Molecular diagnosis of the factor V Leiden mutation was performedas described by Brenner et al.18 The mutation in the methylenetetrahydrofolatereductase gene was detected as described by Frosst et al.11The mutation in the prothrombin gene was detected with use ofa slight modification of the method of Poort et al.13 The forwardprimer was 5'CAACCGCTGGTATCAAATGG3', and the reverse primerwas as reported by Poort et al.13 This method yielded a DNAfragment of 253 base pairs, which was digested with Hin dIII.
Assays
Free protein S in plasma was measured with a specific enzyme-linkedimmunosorbent assay (Asserachrom free protein S assay, DiagnosticaStago, Asnières, France). Levels of protein C antigenand antithrombin III antigen were determined by rocket electroimmunoassaywith rabbit antihuman protein C (Sigma, Rehovot, Israel) andrabbit antihuman antithrombin III (Diagnostica Stago), respectively.The antithrombin III activity in plasma was determined by achromogenic assay (Dade Diagnostica, Munich, Germany). Levelsof IgG and IgM anticardiolipin antibodies were determined withan enzyme-linked immunosorbent assay (ORGenTec, Mainz, Germany);measurement of more than 15 IgG phospholipid units was consideredto be a positive result. The presence of lupus anticoagulantwas determined as described elsewhere.19 For all these assays,the intraassay and interassay coefficients of variation wereless than 6 percent.
Statistical Analysis
Results for the two groups were compared with use of two-tailedStudent's t-tests, Fisher's exact tests, and Pearson's chi-squaretests. Odds ratios and 95 percent confidence intervals werecalculated. Statistical analyses were performed with the StatisticalPackage for the Social Sciences for Windows, version 6 (SPSS,Chicago).
Results
The characteristics of the women with obstetrical complicationsand those with normal pregnancies are shown in Table 1. Thegestational ages at delivery and the birth weight of the infantswere significantly lower and the number of primiparous womenwas significantly higher in the group with complications. Ofthe 18 multiparous women with complications, 12 had had obstetricalcomplications in a previous pregnancy, 3 had had one normalpregnancy and one complicated pregnancy, and 3 had had normalpregnancies.
Table 1. Clinical Characteristics of the Study Women.
Thirty-four of the 110 women with complications (31 percent)had severe preeclampsia, indicated by a blood pressure higherthan 160/110 mm Hg in 26 women; urinary protein excretion inexcess of 5 g per 24 hours in 2; a platelet count below 100,000per cubic millimeter in 2; the combination of hemolysis, highserum aminotransferase concentrations, and a platelet countbelow 100,000 per cubic millimeter in 3; and eclampsia in 1.Twenty women with complications (18 percent) had abruptio placentae,of whom three also had mild preeclampsia and seven had antepartumor postpartum hypertension. Eleven of the neonates in this grouphad birth weights below the 10th percentile for gestationalage.17 Forty-four women (40 percent) had fetuses with growthretardation; 15 of these 44 women had mild hypertension (bloodpressure elevated but not greater than 150/100 mm Hg). Twelvewomen (11 percent) had stillbirths. Two of these women had mildhypertension.
Overall, 57 of the 110 women with obstetrical complications(52 percent) had at least one of the three thrombophilic mutations,as compared with 19 of the 110 women with normal pregnancies(17 percent; odds ratio, 5.2; 95 percent confidence interval,2.8 to 9.6) (Table 2). In addition, 14 other women in the groupwith complications (13 percent) had other types of inheritedor acquired thrombophilia, as compared with only 1 woman inthe group without complications (1 percent; odds ratio, 15.9;95 percent confidence interval, 2.0 to 123.1). Seven of thewomen with complications had protein S deficiency, one had proteinC deficiency, and one had antithrombin III deficiency, whereasamong the women with normal pregnancies, one had protein S deficiencyand none were deficient in protein C or antithrombin III. Lupusanticoagulant was detected in one of five women with complicationsin whom the test for anticardiolipin antibodies was positiveand in none of the women with uncomplicated pregnancies. Thecombined prevalence of all the inherited and acquired typesof thrombophilia in the women with obstetrical complicationswas 65 percent, as compared with 18 percent in the women withoutcomplications (odds ratio, 8.2; 95 percent confidence interval,4.4 to 15.3) (Table 2).
Table 2. Prevalence of Inherited and Acquired Thrombophilia in the Study Women.
Five women with complications and one woman with a normal pregnancyhad multiple thrombophilic mutations (Table 2). Combinationsof other types of thrombophilia were found in another five womenin the study group and in none of the women with normal pregnancies.Each of the women with combined thrombophilia was consideredonly once in the statistical analysis.
The odds ratios for the prevalence of thrombophilic mutationsin the women with obstetrical complications as compared withthe women without complications are shown in Table 3. The prevalenceof the three mutations was 53 percent among the women with severepreeclampsia, 60 percent among those with abruptio placentae,50 percent for women who had fetuses with growth retardation,and 42 percent for women who had stillbirths. The prevalenceof all the types of inherited and acquired thrombophilia thatwe studied was 68 percent in women with severe preeclampsia,70 percent in women with abruptio placentae, 61 percent in womenwhose fetuses had growth retardation, and 58 percent in womenwho had stillbirths.
Table 3. Prevalence of Inherited Thrombophilias in Women with Specific Obstetrical Complications, as Compared with Women with Normal Pregnancies.
The 23 women with severe preeclampsia and thrombophilia deliveredinfants at an earlier mean (±SD) gestational age andwith a lower mean birth weight than the 11 women with severepreeclampsia and no thrombophilia (gestational age, 31.7±3.8vs. 35.1±3.6 weeks; P=0.03; birth weight, 1375±684vs. 1975±504 g; P=0.01). There were no differences inthese variables between the women with and those without thrombophiliain the other three subgroups (those with abruptio placentae,fetal growth retardation, or stillbirth).
Of the 15 multiparous women with obstetrical complications whohad also had complications during previous pregnancies, thrombophiliawas found in 10 (67 percent).
Discussion
In this casecontrol study, we found a high prevalence(52 percent) of mutations in the genes encoding factor V, methylenetetrahydrofolatereductase, and prothrombin in otherwise healthy women who hadsevere complications of pregnancy. The incidence of these mutationsin women with normal pregnancies who were matched with the womenwith complications for age and the geographic origin of eachparent was only 17 percent. This study included only women whohad severe obstetrical complications associated with abnormalitiesin the maternalfetal circulation, and none of the womenhad a history of a previous thromboembolic event.
The factor V Leiden mutation was detected in 20 percent of thewomen with obstetrical complications, as compared with 6 percentof the women without complications. The rate of 6 percent issimilar to the reported incidence of this mutation in healthywhite people20 and in the Israeli population.21 This mutationwas significantly more prevalent in women with severe preeclampsia,abruptio placentae, or stillbirth than in the women with uncomplicatedpregnancies. In previous studies, resistance to activated proteinC was detected in 16 percent22 and the factor V Leiden mutationin 9 to 22 percent23,24,25 of women with preeclampsia. In twoof these studies, the prevalence of the mutation was significantlygreater in women with preeclampsia than in women without complications.23,24Of the women with abruptio placentae or stillbirth, 25 percenthad the factor V Leiden mutation. In two other studies of womenwho delivered stillborn infants, 17 percent and 49 percent hadthe factor V Leiden mutation.19,26 In our study, 11 percentof women with fetuses affected by growth retardation had thefactor V Leiden mutation, a prevalence that did not differ significantlyfrom that among women with normal pregnancies; these findingsconfirm an earlier report.27 The factor V Leiden mutation wasrecently found to be associated with a reduction in the riskof intrapartum bleeding, conferring a possible survival advantagein carriers of this mutation.27
Homozygosity for the mutation in the methylenetetrahydrofolatereductase gene was found in 22 percent of the women with obstetricalcomplications, as compared with 8 percent of the women withnormal pregnancies. This 8 percent prevalence is similar tothat reported for the Israeli population21 and other groups.11,28,29An increase in homozygosity for the methylenetetrahydrofolatereductase mutation associated with preeclampsia was reportedin Italy24 and Japan.30 Hyperhomocysteinemia was found in 31percent of women with abruptio placentae or placental infarction,as compared with 9 percent of a control group (P<0.05).31
The recently described mutation in the prothrombin gene is associatedwith an increased risk of venous and arterial thromboembolism.13,14We found the prevalence of this mutation to be 10 percent inthe group with complications, as compared with 3 percent inthe group without complications. The latter value is similarto that found in a study of 474 normal subjects (2 percent).13The prothrombin mutation was significantly more frequent inwomen with abruptio placentae and fetal growth retardation,but not in those with severe preeclampsia.
Fourteen women with obstetrical complications had other typesof inherited or acquired thrombophilia, which were diagnosedat least two months after delivery. The most frequent abnormalitywas protein S deficiency (seven women), which was found mostoften in women who had stillbirths (17 percent), as previouslyreported by others.26,32
Altogether, 65 percent of the women with complications had someform of inherited or acquired thrombophilia, as compared with18 percent of the women with normal pregnancies. The presenceof these abnormalities in association with hypercoagulabilityfurther supports the proposed relation between impaired placentaldevelopment and perfusion and abnormal hemostasis. The knownthrombotic features of placental vascular lesions and the increasedrisk of thrombosis associated with the presence of thrombophiliastrongly suggest a cause-and-effect relation between these inheritedand acquired anomalies and serious obstetrical complications.
In conclusion, our findings suggest that women with severe complicationsof pregnancy should be tested for markers of thrombophilia,even in the absence of a history of thromboembolism. Becausethese complications tend to recur6,32,33 (for instance, preeclampsiarecurs at a rate of 20 percent33), the presence of thrombophiliain these women may be an important consideration in planningfuture pregnancies. Although it is not known whether complicationsof pregnancy are more likely to recur in women with thrombophilia,the high rate of recurrence found in the 15 multiparous womenin our study who had obstetrical complications in previous pregnanciessuggests that this possibility should be evaluated further.
Supported by a Leu-Mintz grant from the Sackler Faculty of Medicine,Tel Aviv University, Tel Aviv, Israel.
We are indebted to Eti Zwang and Ruja Eichel of the CoagulationLaboratory for their dedicated assistance in performing thethrombophilia assays, and to Eshter Eshkol for her skillfuleditorial assistance.
Source Information
From the Department of Obstetrics and Gynecology, Lis Maternity Hospital (M.J.K., N.S., A.M., A.B.-A., A.J., G.F., J.B.L.), and the Department of Hematology (A.E.), Tel Aviv Sourasky Medical Center, Sackler Faculty of Medicine, Tel Aviv University, Tel Aviv, Israel.
Address reprint requests to Dr. Kupferminc at the Department of Obstetrics and Gynecology, Lis Maternity Hospital, Tel Aviv Sourasky Medical Center, 6 Weizman St., Tel Aviv 64239, Israel, or at tmcobgyn{at}tasmc.health.gov.il.
References
Roberts JM, Taylor RN, Musci TJ, Rodgers GM, Hubel CA, McLaughlin MK. Preeclampsia: an endothelial cell disorder. Am J Obstet Gynecol 1989;161:1200-1204. [Medline]
Salafia CM, Pezzullo JC, Lopez-Zeno JA, Simmens S, Minior VK, Vintzileos AM. Placental pathologic features of preterm preeclampsia. Am J Obstet Gynecol 1995;173:1097-1105. [CrossRef][Medline]
Shanklin DR, Sibai BM. Ultrastructural aspects of preeclampsia. I. Placental bed and uterine boundary vessels. Am J Obstet Gynecol 1989;161:735-741. [Medline]
Khong TY, Pearce JM, Robertson WB. Acute atherosis in preeclampsia: maternal determinants and fetal outcome in the presence of the lesion. Am J Obstet Gynecol 1987;157:360-363. [Medline]
Salafia CM, Minior VK, Pezzullo JC, Popek EJ, Rosenkrantz TS, Vintzileos AM. Intrauterine growth restriction in infants of less than thirty-two weeks' gestation: associated placental pathologic features. Am J Obstet Gynecol 1995;173:1049-1057. [CrossRef][Medline]
Infante-Rivard C, David M, Gauthier R, Rivard GE. Lupus anticoagulants, anticardiolipin antibodies, and fetal loss: a case-control study. N Engl J Med 1991;325:1063-1066. [Abstract]
Dahlback B. Inherited resistance to activated protein C, a major cause of venous thrombosis, is due to a mutation in the factor V gene. Haemostasis 1994;24:139-151. [Medline]
Bertina RM, Koeleman BPC, Koster T, et al. Mutation in blood coagulation factor V associated with resistance to activated protein C. Nature 1994;369:64-67. [CrossRef][Medline]
Svensson PJ, Dahlbäck B. Resistance to activated protein C as a basis for venous thrombosis. N Engl J Med 1994;330:517-522. [Free Full Text]
Frosst P, Blom HJ, Milos R, et al. A candidate genetic risk factor for vascular disease: a common mutation in methylenetetrahydrofolate reductase. Nat Genet 1995;10:111-113. [CrossRef][Medline]
Kluijtmans LAJ, van den Heuvel LPWJ, Boers GHJ, et al. Molecular genetic analysis in mild hyperhomocysteinemia: a common mutation in the methylenetetrahydrofolate reductase gene is a genetic risk factor for cardiovascular disease. Am J Hum Genet 1996;58:35-41. [Medline]
Poort SR, Rosendaal FR, Reitsma PH, Bertina RM. A common genetic variation in the 3'-untranslated region of the prothrombin gene is associated with elevated plasma prothrombin levels and an increase in venous thrombosis. Blood 1996;88:3698-3703. [Free Full Text]
Rosendaal FR, Siscovick DS, Schwartz SM, Psaty BM, Raghunathan TE, Vos HL. A common prothrombin variant (20210 G to A) increases the risk of myocardial infarction in young women. Blood 1997;90:1747-1750. [Free Full Text]
Martinelli I, Sacchi E, Landi G, Taioli E, Duca F, Mannucci PM. High risk of cerebral-vein thrombosis in carriers of a prothrombin-gene mutation and in users of oral contraceptives. N Engl J Med 1998;338:1793-1797. [Free Full Text]
Hypertension in pregnancy. Technical bulletin no. 219. Washington, D.C.: American College of Obstetricians and Gynecologists, January 1996.
Brenner WE, Edelman DA, Hendricks CH. A standard of fetal growth for the United States of America. Am J Obstet Gynecol 1976;126:555-564. [Medline]
Brenner B, Zivelin A, Lanir N, Greengard JS, Griffin JH, Seligsohn U. Venous thromboembolism associated with double heterozygosity for R506Q mutation of factor V and for T298M mutation of protein C in a large family of a previously described homozygous protein C-deficient newborn with massive thrombosis. Blood 1996;88:877-880. [Free Full Text]
Brenner B, Mandel H, Lanir N, et al. Activated protein C resistance can be associated with recurrent fetal loss. Br J Haematol 1997;97:551-554. [CrossRef][Medline]
Rees DC, Cox M, Clegg JB. World distribution of factor V Leiden. Lancet 1995;346:1133-1134. [CrossRef][Medline]
Seligsohn U, Zivelin A. Thrombophilia as a multigenic disorder. Thromb Haemost 1997;78:297-301. [Medline]
Dekker GA, de Vries JI, Doelitzsch PM, et al. Underlying disorders associated with severe early-onset preeclampsia. Am J Obstet Gynecol 1995;173:1042-1048. [CrossRef][Medline]
Dizon-Townson DS, Nelson LM, Easton K, Ward K. The factor V Leiden mutation may predispose women to severe preeclampsia. Am J Obstet Gynecol 1996;175:902-905. [CrossRef][Medline]
Grandone E, Margaglione M, Colaizzo D, et al. Factor V Leiden, C>T MTHFR polymorphism and genetic susceptibility to preeclampsia. Thromb Haemost 1997;77:1052-1054. [Medline]
Lindoff C, Ingemarsson I, Martinsson G, Segelmark M, Thysell H, Astedt B. Preeclampsia is associated with a reduced response to activated protein C. Am J Obstet Gynecol 1997;176:457-460. [CrossRef][Medline]
Preston FE, Rosendaal FR, Walker ID, et al. Increased fetal loss in women with heritable thrombophilia. Lancet 1996;348:913-916. [CrossRef][Medline]
Lindqvist PG, Svensson PJ, Dahlbäck B, Marál K. Factor V Q506 mutation (activated protein C resistance) associated with reduced intrapartum blood loss -- a possible evolutionary selection mechanism. Thromb Haemost 1998;79:69-73. [Medline]
Kang S-S, Wong PWK, Susmano A, Sora J, Norusis M, Ruggie N. Thermolabile methylenetetrahydrofolate reductase: an inherited risk factor for coronary artery disease. Am J Hum Genet 1991;48:536-545. [Medline]
Molloy AM, Daly S, Mills JL, et al. Thermolabile variant of 5,10-methylenetetrahydrofolate reductase associated with low red-cell folates: implications for folate intake recommendations. Lancet 1997;349:1591-1593. [CrossRef][Medline]
Sohda S, Arinami T, Hamada HM, Yamada N, Hamaguchi H, Kubo T. Methylenetetrahydrofolate reductase polymorphism and pre-eclampsia. J Med Genet 1997;34:525-526. [Free Full Text]
Goddijn-Wessel TA, Wouters MG, van de Molen EF, et al. Hyperhomocysteinemia: a risk factor for placental abruption or infarction. Eur J Obstet Gynecol Reprod Biol 1996;66:23-29. [CrossRef][Medline]
de Vries JI, Dekker GA, Huijgens PC, Jakobs C, Blomberg BM, van Geijn HP. Hyperhomocysteinaemia and protein S deficiency in complicated pregnancies. Br J Obstet Gynaecol 1997;104:1248-1254. [Medline]
Caritis S, Sibai B, Hauth J, et al. Low-dose aspirin to prevent preeclampsia in women at high risk. N Engl J Med 1998;338:701-705. [Free Full Text]
Sucker, C., Kurschat, C., Farokhzad, F., Hetzel, G. R., Grabensee, B., Maruhn-Debowski, B., Loncar, R., Scharf, R. E., Zotz, R. B.
(2009). The TT Genotype of the C677T Polymorphism in the Methylentetrahydrofolate Reductase as a Risk Factor in Thrombotic Microangiopathies: Results From a Pilot Study. CLIN APPL THROMB HEMOST
15: 283-288
[Abstract]
Lykke, J. A., Langhoff-Roos, J., Sibai, B. M., Funai, E. F., Triche, E. W., Paidas, M. J.
(2009). Hypertensive Pregnancy Disorders and Subsequent Cardiovascular Morbidity and Type 2 Diabetes Mellitus in the Mother. Hypertension
53: 944-951
[Abstract][Full Text]
GIBSON, P. S., POWRIE, R.
(2009). Anticoagulants and pregnancy: When are they safe?. Cleveland Clinic Journal of Medicine
76: 113-127
[Abstract][Full Text]
Bianca, S, Barrano, B, Cutuli, N, Indaco, L, Ingegnosi, C, Cataliotti, A, Milana, G, Ettore, G
(2008). Recurrent pregnancy loss and inherited thrombophilia: who should be tested?. J. Clin. Pathol.
61: 1149-1150
[Full Text]
Roach, E. S., Golomb, M. R., Adams, R., Biller, J., Daniels, S., deVeber, G., Ferriero, D., Jones, B. V., Kirkham, F. J., Scott, R. M., Smith, E. R.
(2008). Management of Stroke in Infants and Children: A Scientific Statement From a Special Writing Group of the American Heart Association Stroke Council and the Council on Cardiovascular Disease in the Young. Stroke
39: 2644-2691
[Abstract][Full Text]
Ghosh, K., Shetty, S., Vora, S., Salvi, V.
(2008). Successful Pregnancy Outcome in Women With Bad Obstetric History and Recurrent Fetal Loss Due to Thrombophilia: Effect of Unfractionated Heparin and Low--Molecular Weight Heparin. CLIN APPL THROMB HEMOST
14: 174-179
[Abstract]
Bellver, J., Soares, S. R., Alvarez, C., Munoz, E., Ramirez, A., Rubio, C., Serra, V., Remohi, J., Pellicer, A.
(2008). The role of thrombophilia and thyroid autoimmunity in unexplained infertility, implantation failure and recurrent spontaneous abortion. Hum Reprod
23: 278-284
[Abstract][Full Text]
Ganapathy, R., Whitley, G. S. J., Cartwright, J.E., Dash, P.R., Thilaganathan, B.
(2007). Effect of heparin and fractionated heparin on trophoblast invasion. Hum Reprod
22: 2523-2527
[Abstract][Full Text]
Dawood, F., Mountford, R., Farquharson, R., Quenby, S.
(2007). Genetic polymorphisms on the factor V gene in women with recurrent miscarriage and acquired APCR. Hum Reprod
22: 2546-2553
[Abstract][Full Text]
Passamonti, F., Randi, M. L., Rumi, E., Pungolino, E., Elena, C., Pietra, D., Scapin, M., Arcaini, L., Tezza, F., Moratti, R., Pascutto, C., Fabris, F., Morra, E., Cazzola, M., Lazzarino, M.
(2007). Increased risk of pregnancy complications in patients with essential thrombocythemia carrying the JAK2 (617V>F) mutation. Blood
110: 485-489
[Abstract][Full Text]
Lim, W., Eikelboom, J. W, Ginsberg, J. S
(2007). Inherited thrombophilia and pregnancy associated venous thromboembolism. BMJ
334: 1318-1321
[Full Text]
Chen, L.-K., Huang, C.-H., Yeh, H.-M., Lee, C.-N., Shyu, M.-K., Hsieh, F.-J., Lai, L.-P., Sun, W.-Z.
(2007). Polymorphisms in the Endothelial Nitric Oxide Synthase Gene May Be Protective Against Preeclampsia in a Chinese Population. Reproductive Sciences
14: 175-181
[Abstract]
Tanaka, M., Jaamaa, G., Kaiser, M., Hills, E., Soim, A., Zhu, M., Shcherbatykh, I. Y., Samelson, R., Bell, E., Zdeb, M., McNutt, L.-A.
(2007). Racial Disparity in Hypertensive Disorders of Pregnancy in New York State: A 10-Year Longitudinal Population-Based Study. AJPH
97: 163-170
[Abstract][Full Text]
Tamura, T., Picciano, M. F.
(2006). Folate and human reproduction. Am. J. Clin. Nutr.
83: 993-1016
[Abstract][Full Text]
Nurk, E., Tell, G.S., Refsum, H., Ueland, P.M., Vollset, S.E.
(2006). Factor V Leiden, pregnancy complications and adverse outcomes: the Hordaland Homocysteine Study. QJM
99: 289-298
[Abstract][Full Text]
Mello, G., Parretti, E., Marozio, L., Pizzi, C., Lojacono, A., Frusca, T., Facchinetti, F., Benedetto, C.
(2005). Thrombophilia Is Significantly Associated With Severe Preeclampsia: Results of a Large-Scale, Case-Controlled Study. Hypertension
46: 1270-1274
[Abstract][Full Text]
Glueck, C. J., Wang, P., Bell, H., Rangaraj, V., Goldenberg, N.
(2005). Associations of Thrombophilia, Hypofibrinolysis, and Retinal Vein Occlusion. CLIN APPL THROMB HEMOST
11: 375-389
[Abstract]
Golomb, M. R., Garg, B. P., Walsh, L. E., Williams, L. S.
(2005). Perinatal stroke in baby, prothrombotic gene in mom: Does this affect maternal health insurance?. Neurology
65: 13-16
[Abstract][Full Text]
Lentz, S. R.
(2005). Another Lesson From the Factor V Leiden Mouse: Thrombin Generation Drives Arterial Disease. Circulation
111: 1733-1734
[Full Text]
Stanley-Christian, H., Ghidini, A., Sacher, R., Shemirani, M.
(2005). Fetal Genotype for Specific Inherited Thrombophilias Is Not Associated With Severe Preeclampsia. Reproductive Sciences
12: 198-201
[Abstract]
Lee, J., Croen, L. A., Backstrand, K. H., Yoshida, C. K., Henning, L. H., Lindan, C., Ferriero, D. M., Fullerton, H. J., Barkovich, A. J., Wu, Y. W.
(2005). Maternal and Infant Characteristics Associated With Perinatal Arterial Stroke in the Infant. JAMA
293: 723-729
[Abstract][Full Text]
Spaanderman, M. E. A., Aardenburg, R., Ekhart, T. H. A., van Eyndhoven, H. W. F., de Leeuw, P. W., Peeters, L. L. H.
(2005). Pre-pregnant Prediction of Recurrent Preeclampsia in Normotensive Thrombophilic Formerly Preeclamptic Women Receiving Prophylactic Antithrombotic Medication. Reproductive Sciences
12: 112-117
[Abstract]
Mello, G., Parretti, E., Fatini, C., Riviello, C., Gensini, F., Marchionni, M., Scarselli, G. F., Gensini, G. F., Abbate, R.
(2005). Low-Molecular-Weight Heparin Lowers the Recurrence Rate of Preeclampsia and Restores the Physiological Vascular Changes in Angiotensin-Converting Enzyme DD Women. Hypertension
45: 86-91
[Abstract][Full Text]
Glueck, C. J., Goldenberg, N., Wang, P., Aregawi, D.
(2004). Ramifications of Four Concurrent Thrombophilic Mutations and One Hypofibrinolytic Mutation. CLIN APPL THROMB HEMOST
10: 365-371
[Abstract]
Bank, I., Libourel, E. J., Middeldorp, S., van Pampus, E. C. M., Koopman, M. M. W., Hamulyak, K., Prins, M. H., van der Meer, J., Buller, H. R.
(2004). Prothrombin 20210A Mutation: A Mild Risk Factor for Venous Thromboembolism but Not for Arterial Thrombotic Disease and Pregnancy-Related Complications in a Family Study. Arch Intern Med
164: 1932-1937
[Abstract][Full Text]
Spaanderman, M. E. A., Ekhart, T. H. A., de Leeuw, P. W., Peeters, L. L. H.
(2004). Angiotensin II Sensitivity in Nonpregnant Formerly Preeclamptic Women and Halthy Parous Contorls. Reproductive Sciences
11: 416-422
[Abstract]
Wu, Y. W., March, W. M., Croen, L. A., Grether, J. K., Escobar, G. J., Newman, T. B.
(2004). Perinatal Stroke in Children With Motor Impairment: A Population-Based Study. Pediatrics
114: 612-619
[Abstract][Full Text]
Brenner, B.
(2004). Clinical management of thrombophilia-related placental vascular complications. Blood
103: 4003-4009
[Abstract][Full Text]
O'Gara, P. T., Greenfield, A. J., Afridi, N. A., Houser, S. L.
(2004). Case 12-2004 - A 38-Year-Old Woman with Acute Onset of Pain in the Chest. NEJM
350: 1666-1674
[Full Text]
Kovalevsky, G., Gracia, C. R., Berlin, J. A., Sammel, M. D., Barnhart, K. T.
(2004). Evaluation of the Association Between Hereditary Thrombophilias and Recurrent Pregnancy Loss: A Meta-analysis. Arch Intern Med
164: 558-563
[Abstract][Full Text]
Sabet, H. Y., Blake, P., Nguyen, D.
(2004). Alexia without Agraphia in a Postpartum Eclamptic Patient with Factor V Leiden Deficiency. Am. J. Neuroradiol.
25: 419-420
[Abstract][Full Text]
Yamada, H., Sata, F., Kato, E. H., Saijo, Y., Kataoka, S., Morikawa, M., Shimada, S., Yamada, T., Kishi, R., Minakami, H.
(2004). A polymorphism in the CYP17 gene and intrauterine fetal growth restriction. Mol Hum Reprod
10: 49-53
[Abstract][Full Text]
Rai, R., Tuddenham, E., Backos, M., Jivraj, S., El'Gaddal, S., Choy, S., Cork, B., Regan, L.
(2003). Thromboelastography, whole-blood haemostasis and recurrent miscarriage. Hum Reprod
18: 2540-2543
[Abstract][Full Text]
Chabrier, S., Buchmuller, A.
(2003). Editorial Comment--Specificities of the Neonatal Stroke. Stroke
34: 2892-2893
[Full Text]
Buchholz, T., Lohse, P., Rogenhofer, N., Kosian, E., Pihusch, R., Thaler, C.J.
(2003). Polymorphisms in the ACE and PAI-1 genes are associated with recurrent spontaneous miscarriages. Hum Reprod
18: 2473-2477
[Abstract][Full Text]
Cattaneo, M.
(2003). Homocysteine and the Risk of Intrauterine Growth Retardation. Clin. Chem.
49: 1432-1433
[Full Text]
Dossenbach-Glaninger, A., van Trotsenburg, M., Dossenbach, M., Oberkanins, C., Moritz, A., Krugluger, W., Huber, J., Hopmeier, P.
(2003). Plasminogen Activator Inhibitor 1 4G/5G Polymorphism and Coagulation Factor XIII Val34Leu Polymorphism: Impaired Fibrinolysis and Early Pregnancy Loss. Clin. Chem.
49: 1081-1086
[Abstract][Full Text]
van Walraven, C., Mamdani, M., Cohn, A., Katib, Y., Walker, M., Rodger, M. A
(2003). Research pointers: Risk of subsequent thromboembolism for patients with pre-eclampsia. BMJ
326: 791-792
[Full Text]
Raijmakers, M T M, Roes, E M, te Morsche, R H M, Steegers, E A P, Peters, W H M
(2003). Haptoglobin and its association with the HELLP syndrome. J. Med. Genet.
40: 214-216
[Full Text]
Westrich, G. H., Weksler, B. B., Glueck, C. J., Blumenthal, B. F., Salvati, E. A.
(2002). Correlation of Thrombophilia and Hypofibrinolysis with Pulmonary Embolism Following Total Hip Arthroplasty: An Analysis of Genetic Factors. JBJS
84: 2161-2167
[Abstract][Full Text]
Kupferminc, M. J., Many, A., Lessing, J. B., Grandone, E., Margaglione, M., Infante-Rivard, C., Rivard, G.-E., Gauthier, R.
(2002). Thrombophilia Polymorphisms and Intrauterine Growth Restriction. NEJM
347: 1530-1531
[Full Text]
Hernandez-Diaz, S., Werler, M. M., Louik, C., Mitchell, A. A.
(2002). Risk of Gestational Hypertension in Relation to Folic Acid Supplementation during Pregnancy. Am J Epidemiol
156: 806-812
[Abstract][Full Text]
Burke, W., Atkins, D., Gwinn, M., Guttmacher, A., Haddow, J., Lau, J., Palomaki, G., Press, N., Richards, C. S., Wideroff, L., Wiesner, G. L.
(2002). Genetic Test Evaluation: Information Needs of Clinicians, Policy Makers, and the Public. Am J Epidemiol
156: 311-318
[Abstract][Full Text]
Infante-Rivard, C., Rivard, G.-E., Yotov, W. V., Genin, E., Guiguet, M., Weinberg, C., Gauthier, R., Feoli-Fonseca, J. C.
(2002). Absence of Association of Thrombophilia Polymorphisms with Intrauterine Growth Restriction. NEJM
347: 19-25
[Abstract][Full Text]
Roberts, D., Schwartz, R. S.
(2002). Clotting and Hemorrhage in the Placenta -- A Delicate Balance. NEJM
347: 57-59
[Full Text]
Bloomenthal, D., von Dadelszen, P., Liston, R., Magee, L., Tsang, P.
(2002). The effect of factor V Leiden carriage on maternal and fetal health. CMAJ
167: 48-54
[Abstract][Full Text]
Lain, K. Y., Roberts, J. M.
(2002). Contemporary Concepts of the Pathogenesis and Management of Preeclampsia. JAMA
287: 3183-3186
[Full Text]
Iwaki, T., Sandoval-Cooper, M. J., Paiva, M., Kobayashi, T., Ploplis, V. A., Castellino, F. J.
(2002). Fibrinogen Stabilizes Placental-Maternal Attachment During Embryonic Development in the Mouse. Am. J. Pathol.
160: 1021-1034
[Abstract][Full Text]
Rai, R., Backos, M., Elgaddal, S., Shlebak, A., Regan, L.
(2002). Factor V Leiden and recurrent miscarriage--prospective outcome of untreated pregnancies. Hum Reprod
17: 442-445
[Abstract][Full Text]
Irgens, H. U, Reisater, L., Irgens, L. M, Lie, R. T, Roberts, J. M
(2001). Long term mortality of mothers and fathers after pre-eclampsia: population based cohort study Pre-eclampsia and cardiovascular disease later in life: who is at risk?. BMJ
323: 1213-1217
[Abstract][Full Text]
O'Shaughnessy, K. M, Fu, B., Downing, S., Morris, N. H
(2001). Thrombophilic polymorphisms in pre-eclampsia: altered frequency of the functional 98C>T polymorphism of glycoprotein IIIa. J. Med. Genet.
38: 775-777
[Full Text]
Bauer, K. A.
(2001). The Thrombophilias: Well-Defined Risk Factors with Uncertain Therapeutic Implications. ANN INTERN MED
135: 367-373
[Abstract][Full Text]
Rai, R., Shlebak, A., Cohen, H., Backos, M., Holmes, Z., Marriott, K., Regan, L.
(2001). Factor V Leiden and acquired activated protein C resistance among 1000 women with recurrent miscarriage. Hum Reprod
16: 961-965
[Abstract][Full Text]
Pabinger, I., Grafenhofer, H., Kaider, A., Ilic, A., Eichinger, S., Quehenberger, P., Husslein, P., Mannhalter, C., Lechner, K.
(2001). Preeclampsia and Fetal Loss in Women With a History of Venous Thromboembolism. Arterioscler. Thromb. Vasc. Bio.
21: 874-879
[Abstract][Full Text]
Seligsohn, U., Lubetsky, A.
(2001). Genetic Susceptibility to Venous Thrombosis. NEJM
344: 1222-1231
[Full Text]
Chen, Z., Karaplis, A. C., Ackerman, S. L., Pogribny, I. P., Melnyk, S., Lussier-Cacan, S., Chen, M. F., Pai, A., John, S. W.M., Smith, R. S., Bottiglieri, T., Bagley, P., Selhub, J., Rudnicki, M. A., James, S. J., Rozen, R.
(2001). Mice deficient in methylenetetrahydrofolate reductase exhibit hyperhomocysteinemia and decreased methylation capacity, with neuropathology and aortic lipid deposition. Hum Mol Genet
10: 433-443
[Abstract][Full Text]
Ananth, C. V., Wilcox, A. J.
(2001). Placental Abruption and Perinatal Mortality in the United States. Am J Epidemiol
153: 332-337
[Abstract][Full Text]
Isermann, B, Hendrickson, S., Hutley, K, Wing, M, Weiler, H
(2001). Tissue-restricted expression of thrombomodulin in the placenta rescues thrombomodulin-deficient mice from early lethality and reveals a secondary developmental block. Development
128: 827-838
[Abstract]
McCrae, K. R., Bussel, J. B., Mannucci, P. M., Remuzzi, G., Cines, D. B.
(2001). Platelets: An Update on Diagnosis and Management of Thrombocytopenic Disorders. ASH Education Book
2001: 282-305
[Abstract][Full Text]
Macik, B. G., Rand, J. H., Konkle, B. A.
(2001). Thrombophilia: What's a Practitioner to Do?. ASH Education Book
2001: 322-338
[Abstract][Full Text]
Martinelli, I., Taioli, E., Cetin, I., Marinoni, A., Gerosa, S., Villa, M. V., Bozzo, M., Mannucci, P. M.
(2000). Mutations in Coagulation Factors in Women with Unexplained Late Fetal Loss. NEJM
343: 1015-1018
[Abstract][Full Text]
Rai, R., Backos, M., Baxter, N., Chilcott, I., Regan, L.
(2000). Recurrent miscarriage--an aspirin a day?. Hum Reprod
15: 2220-2223
[Abstract][Full Text]
Gunther, G., Junker, R., Strater, R., Schobess, R., Kurnik, K., Kosch, A., Nowak-Gottl, U., Group, f. t. C. S. S.
(2000). Symptomatic Ischemic Stroke in Full-Term Neonates : Role of Acquired and Genetic Prothrombotic Risk Factors. Stroke
31: 2437-2441
[Abstract][Full Text]
Walker, I. D
(2000). Thrombophilia in pregnancy. J. Clin. Pathol.
53: 573-580
[Abstract][Full Text]
Yoshimura, T., Yoshimura, M., Tabatal, A., Shimasaki, Y., Nakayama, M., Miyamoto, Y., Saito, Y., Nakao, K., Yasue, H., Okamura, H.
(2000). Association of the Missense Glu298Asp Variant of the Endothelial Nitric Oxide Syntahse Gene With Severe Preeclampsia. Reproductive Sciences
7: 238-241
[Abstract]
Angelopoulou, K., Nicolaides, A., Constantinou Deltas, C.
(2000). Prevalence of Genetic Mutations That Predispose to Thrombophilia in a Greek Cypriot Population. CLIN APPL THROMB HEMOST
6: 104-107
[Abstract]
Kupferminc, M. J., Yair, D., Bornstein, N. M., Lessing, J. B., Eldor, A.
(2000). Transient Focal Neurological Deficits During Pregnancy in Carriers of Inherited Thrombophilia. Stroke
31: 892-895
[Abstract][Full Text]
Greer, I. A.
(2000). The Challenge of Thrombophilia in Maternal-Fetal Medicine. NEJM
342: 424-425
[Full Text]
Munro, P. T
(2000). Management of eclampsia in the accident and emergency department. Emerg. Med. J.
17: 7-11
[Abstract][Full Text]
Murphy, R. P., Donoghue, C., Nallen, R. J., D'Mello, M., Regan, C., Whitehead, A. S., Fitzgerald, D. J.
(2000). Prospective Evaluation of the Risk Conferred by Factor V Leiden and Thermolabile Methylenetetrahydrofolate Reductase Polymorphisms in Pregnancy. Arterioscler. Thromb. Vasc. Bio.
20: 266-270
[Abstract][Full Text]
Hubel, C. A.
(1999). Oxidative Stress in the Pathogenesis of Preeclampsia. Exp. Biol. Med.
222: 222-235
[Abstract][Full Text]
Takakuwa, K., Honda, K., Ishii, K., Hataya, I., Yasuda, M., Tanaka, K.
(1999). Studies on the HLA-DRB1 genotypes in Japanese women with severe pre-eclampsia positive and negative for anticardiolipin antibody using a polymerase chain reaction-restriction fragment length polymorphism method. Hum Reprod
14: 2980-2986
[Abstract][Full Text]
Horstkamp, B.S., Kiess, H., Kramer, J., Riess, H., Henrich, W., Dudenhausen, J.W.
(1999). Activated protein C resistance shows an association with pregnancy-induced hypertension. Hum Reprod
14: 3112-3115
[Abstract][Full Text]
(1999). Perinatal Complications and Thrombophilic Disorders. JWatch Women's Health
1999: 6-6
[Full Text]
Sibai, B. M.
(1999). Thrombophilias and Adverse Outcomes of Pregnancy -- What Should a Clinician Do?. NEJM
340: 50-52
[Full Text]