Background In patients infected with human immunodeficiencyvirus type 1 (HIV-1), combination antiretroviral therapy canresult in sustained suppression of plasma levels of the virus.However, replication-competent virus can still be recoveredfrom latently infected resting memory CD4 lymphocytes; thisfinding raises serious doubts about whether antiviral treatmentcan eradicate HIV-1.
Methods We looked for evidence of residual HIV-1 replicationin eight patients who began treatment soon after infection andin whom plasma levels of HIV-1 RNA were undetectable after twoto three years of antiretroviral therapy. We examined whetherthere had been changes over time in HIV-1 proviral sequencesin peripheral-blood mononuclear cells, which would indicateresidual viral replication. We also performed in situ hybridizationstudies on tissues from one patient to identify cells activelyexpressing HIV-1 RNA. We estimated the rate of decrease of latent,replication-competent HIV-1 in resting CD4 lymphocytes on thebasis of the decrease in the numbers of proviral sequences identifiedduring primary infection and direct sequential measurementsof the size of the latent reservoir.
Results Six of the eight patients had no significant variationsin proviral sequences during treatment. However, in two patientsthere was sequence evolution but no evidence of drug-resistantviral genotypes. In one patient, extensive in situ studies providedadditional evidence of persistent viral replication in lymphoidtissues. Using two independent approaches, we estimated thatthe half-life of the latent, replication-competent virus inresting CD4 lymphocytes was approximately six months.
Conclusions These findings suggest that combination antiretroviralregimens suppress HIV-1 replication in some but not all patients.Given the half-life of latently infected CD4 lymphocytes ofabout six months, it may require many years of effective antiretroviraltreatment to eliminate this reservoir of HIV-1.
Better understanding of the dynamics of the replication of humanimmunodeficiency virus type 1 (HIV-1) in vivo1,2,3,4 has providedan important rationale for early and aggressive treatment ofthis infection. The advent of combination antiretroviral therapyhas made it possible to suppress the replication of HIV-1 ininfected persons to such an extent that the virus becomes undetectablein the plasma for more than two years.4,5,6 For the first timein the history of this epidemic, the eradication of HIV-1 froman infected person is a real scientific objective.4,7 However,a major obstacle to the elimination of HIV-1 became apparentwhen latent, replication-competent virus was found within restingmemory CD4 lymphocytes,8 which have a long life span.9,10,11
In addition, this latent reservoir of HIV-1 is established earlyin infection and persists after two years of seemingly effectivecombination antiretroviral therapy,12,13 even when treatmentis initiated during the primary phase of infection.14 But thetrue size of the latent reservoir cannot be properly assessedunless it is known whether viral replication has been completelystopped by the drug regimen. In other words, unrecognized residualreplication of HIV-1 would result in an overestimation of thesize of the latent reservoir. We therefore undertook a studyto look for evidence of ongoing HIV-1 replication as well asa decrease in the size of the latent reservoir in a select groupof patients who began treatment early and in whom the HIV-1RNA had been completely undetectable in plasma for approximatelytwo to three years during combination therapy with three orfour drugs.
Methods
Patients
Eight men ranging in age from 30 to 37 years were chosen forthe study (Figure 1) from over 100 subjects enrolled in ourclinical trials, because they had had complete suppression ofHIV-1 in plasma while being fully compliant with the prescribedantiretroviral therapy. At base line they had a mean CD4 lymphocytecount of 533 per cubic millimeter and an average plasma viralload of 174,000 RNA copies per milliliter. The level of HIV-1in plasma was measured by a commercial reverse-transcriptase–polymerase-chain-reaction(PCR) assay (Amplicor Ultrasensitive HIV-1 Monitor assay, RocheMolecular Diagnostic Systems, Branchburg, N.J.), which has alimit of detection of 50 HIV-1 RNA copies per milliliter ofplasma. All patients were enrolled in treatment protocols withinthe first 90 days after acute infection. The antiviral regimensconsisted of zidovudine (600 mg per day) and lamivudine (300mg per day), along with either ritonavir (1200 mg per day) orindinavir (2400 mg per day) or with both ritonavir (800 or 1200mg per day) and saquinavir (1200 mg per day). As shown in Figure 1,each patient had a steep decline in plasma HIV-1 RNA levelsduring treatment; levels below 50 RNA copies per milliliterwere quickly reached and then sustained for 20 to 35 monthsof therapy. After month 5, plasma viremia was not detected inany of the patients. As compared with base-line values, therewas an average increase in the mean CD4 lymphocyte count ofapproximately 300 cells per cubic millimeter for the last fourmeasurements.
Figure 1. Changes in Plasma Viral Load and CD4 Lymphocyte Count during Combination Antiretroviral Therapy in the Eight Men.
Patients 1, 2, and 5 were taking zidovudine, lamivudine, and ritonavir; Patients 3, 4, and 6 were taking zidovudine, lamivudine, and indinavir; and Patients 7 and 8 were taking zidovudine, lamivudine, ritonavir, and saquinavir. Patients 3 and 6 were 30 years old, Patients 1 and 5 were 32 years old, Patient 4 was 34 years old, Patient 7 was 35 years old, Patient 2 was 36 years old, and Patient 8 was 37 years old. The arrowheads indicate the days on which peripheral-blood mononuclear cells were obtained for DNA-sequence analysis.
Amplification, Sequencing, and Sequence Analysis
DNA was extracted from peripheral-blood mononuclear cells aspreviously described.15 Single molecules of the provirus wereamplified after limiting-dilution analysis and sequenced directlywith an automated sequencer (Prism 377, Applied Biosystems,Foster City, Calif.) to avoid errors introduced by the amplificationof DNA in vitro.15 The region amplified in gp120 spanned theV3, V4, and V5 hypervariable domains. The outer env primer sequences,with their positions in HIV-1 clone NL4-3 indicated in parentheses,were V3a 5'CCAATTCCCATACATTATTG3' (nucleotide 6848) for theforward primer and V3i 5'GCGTTATTGACGCTGCGCCCAT3' (nucleotide7823) for the reverse primer, and the respective inner primerswere V3e 5'GTACAATGTACACATGGAAT3' (nucleotide 6947) and V3h5'AATTCACTTCTCCAATTGTC3' (nucleotide 7662). The outer primersfor protease and reverse transcriptase were PRouter 5'GAGCAGACCAGAGCCAACAGCCCA3'(nucleotide 2139) for the forward primer and RTouter 5'GCCCCTGCTTCTGTATTTCTGC3'(nucleotide 3549) for the reverse primer, respectively, andthe inner primers were PRinner 5'GAAGCAGGAGCCGATAGACAAGG3' (nucleotide2211) and RTinner 5'GTGGTACTACTTCTGTTAGTGC3' (nucleotide 3432),respectively. Each round of PCR consisted of 30 cycles, withthe first 5 cycles at 94°C for one minute, 52°C forone minute, and 72°C for one minute, followed by 25 cyclesat 94°C for one minute, 55°C for one minute, and 72°Cfor one minute.
All DNA extractions and amplification reactions were carriedout with appropriate negative controls in parallel to detectcontamination at each step of the procedure. Nucleotide sequenceswere aligned with use of the Clustal V program.16 Pairwise distancesamong sequences were estimated by the DNADIST program in thePHYLIP package.17 Phylogenetic analysis of the nucleotide sequenceswas carried out with use of the neighbor-joining method.18 Bootstrapanalysis was also performed on 1000 replicates to evaluate thereliability of the neighbor-joining results (PHYLIP programsSEQBOOT and CONSENSE).
Quantitative Viral Culture
The virus was cultured after quantitative limiting-dilutionanalysis according to the method of Finzi et al.13 in CD4-enrichedperipheral-blood mononuclear cells that had been depleted ofCD8 lymphocytes with the use of immunomagnetic beads (Dynal,Lake Success, N.Y.). Cells were serially diluted (up to sixreplicates for each inoculum size) and plated in medium containingphytohemagglutinin (2 µg per milliliter) and interleukin-2(10 U per milliliter) with gamma-irradiated allogeneic (donor)CD4 peripheral-blood mononuclear cells in a concentration thatwas 2 to 10 times the concentration of CD4 cells in the patient.The culture supernatant was replaced the next day by mediumcontaining only interleukin-2. On day 2, CD8-depleted, phytohemagglutinin-stimulatedblasts from an HIV-1–seronegative donor were added. Thereafter,half of the medium was changed every three to four days andfresh CD8-depleted, stimulated blasts were added weekly untilday 28. The serial-culture supernatant was then examined forHIV-1 by measuring the p24 antigen concentration with use ofan enzyme immunoassay (Abbott Laboratories, Abbott Park, Ill.).The infectious titer of latent, replication-competent viruswas then determined according to the maximum-likelihood method.4The sensitivity of the assay was limited by the number of cellsavailable for multiple replicate cultures.
Tissue Collection and Processing and in Situ Hybridization
We obtained multiple biopsy samples from Patient 5 to look forcells actively expressing HIV-1 RNA. The tissue samples werefixed in 10 percent buffered formalin for approximately 24 hoursand then embedded in paraffin with use of an automated tissueprocessor under heat and vacuum pressure. Tissue sections wereprocessed and examined by in situ hybridization, as describedpreviously.19
Statistical Analysis
We used least-squares analysis to estimate the best-fit slopefor each patient so as to determine the exponential rate ofdecrease in the numbers of replication-competent HIV-1 withinresting memory CD4 lymphocytes and of parental proviral sequencesidentified during the primary infection. We calculated the averageand standard error of the slopes, using data points from month8 to month 28 of therapy. For the estimates of the half-livesof the virus, we used the 95 percent confidence intervals, whichwe calculated as the mean values ±2 SE for the averageslopes.
Results
Residual HIV-1 Replication
Four sequential samples of peripheral-blood mononuclear cellswere obtained from each patient and examined to determine whetherthere were changes in the DNA sequences, which would indicateongoing replication of HIV-1. A total of 414 amplicons (10 to21 fragments per sample of peripheral-blood mononuclear cells;42 to 64 fragments per patient) that ranged from 612 to 669bp in length were obtained at the limits of the serial-dilutionPCR. These nucleotide sequences, deposited in GenBank (accessionnumbers AF093912 to AF094325), were matched with available sequencesin the Los Alamos Database with use of the Clustal V program.16When analyzed phylogenetically by the neighbor-joining method,18sequences from each patient formed a tight cluster within cladeB (Figure 2) and were distinct from those of control subjectsor other patients (data not shown). Thus, there is no indicationthat the sequences examined were the result of contaminationduring PCR amplification.
Figure 2. Phylogenetic Tree Depicting HIV-1 env Sequences Found in the Eight Patients.
All sequences fall within HIV-1 clade B and are shown with ELI subtype D (GenBank accession no. K03454) as the outgroup. Sequences from each patient clustered together, as expected for a population of viruses that are highly related. The genetic relatedness of two different sequences in the phylogenetic tree is represented only by the horizontal distance that separates them, with the length of the bar at the bottom denoting a sequence divergence of 0.10 (or 10 percent). Vertical distances in the tree are not counted since they are drawn arbitrarily for the sake of clarity. Sequences containing hypermutations are shown in red, whereas evolving sequences are shown in blue. All other sequences are within three mutations from the dominant form at point 1 (the time at which the initial sample of peripheral-blood mononuclear cells was obtained). The numbers 1, 2, 3, and 4 denote the times at which the sequences were obtained and match the times indicated by the arrowheads in Figure 1. Each number represents one sequence.
As described previously,20,21 viral sequences obtained duringor shortly after primary HIV-1 infection (time 1) were extremelyhomogeneous (Figure 2). Four patients (Patients 3, 4, 6, and7) had no sequence variation at the initial time point; in nopatient did the sequence differ by more than two mutations fromthe predominant form. The mean variation within samples forthe eight patients at time 1 was 0.03 percent, with the highestdegree of variation (0.14 percent) found in Patient 8. In threepatients (Patients 2, 3, and 7), there were no appreciable increasesin the degree of sequence variation (differing by no more thantwo mutations from the parental sequence). Greater divergencewas found in samples obtained at subsequent points from theother patients. However, in Patients 1, 4, and 6, the more divergentsequences were the results of hypermutations, typically a clusterof mutations in which A had been substituted for G (Figure 2).Since hypermutations are believed to be the product of a singlereplication cycle,22,23 they cannot be regarded as evidenceof gradual sequence evolution. Thus, there was no genetic evidenceto indicate continued replication of HIV-1 in these three patients.
On the other hand, substantial sequence divergence, exclusiveof hypermutated forms, was found in Patients 5 and 8 (Figure 2).Up to 16 and 25 nucleotide substitutions were found in Patients5 and 8, respectively. Such diversity is possible only throughcontinued viral replication. However, most of the variationhad occurred by the time of the second analysis (at months 16and 9, respectively), suggesting that much of the replicationof residual virus may have occurred during the early phase oftreatment. We also extensively sequenced proviruses from varioustissues from Patient 5. Divergent proviral sequences similarto those found in peripheral-blood mononuclear cells were identifiedin the lymph node and tonsil but not in the sigmoid colon orrectum 15 months after treatment began (data not shown).
To determine whether the residual replication in Patients 5and 8 was due to the emergence of drug-resistant HIV-1, we lookedfor genotypic evidence of drug-resistant virus in the DNA fromperipheral-blood mononuclear cells obtained at the fourth measurementin each patient (months 29 and 18, respectively). Again, weused limiting-dilution PCR to amplify the relevant regions ofthe protease and reverse transcriptase genes. Twelve of 16 proteaseclones and 11 to 12 reverse transcriptase clones were obtainedfrom each patient for nucleotide sequencing. All sequences encodefor wild-type amino acids at protease or reverse transcriptaseresidues that are involved in conferring resistance to ritonavir,indinavir, saquinavir, zidovudine, and lamivudine (GenBank accessionnumbers AF097943 to AF097992). Thus, the residual replicationof HIV-1 does not appear to be under any appreciable selectivepressure exerted by the antiretroviral agents. This conclusion,in turn, implies that the virus might be replicating withina small compartment free from the influence of the antiretroviralagents. This compartment could be a specific anatomical locationor diffusely scattered cell populations that are not reachedor affected by the antiretroviral agents for pharmacokineticreasons or because of aberrant drug metabolism by the cells.
Next, we studied tissue samples and body fluids from Patient5 to confirm the presence of residual HIV-1 replication as wellas to search for anatomical sites where the virus continuedto be expressed. Biopsies of the rectum, sigmoid colon, anddescending colon were performed at months 12 and 15 of treatment.In addition, semen samples were obtained during months 13 and15, and a sample of cerebrospinal fluid was obtained duringmonth 15. A cervical-lymph-node biopsy was also performed duringmonth 15, and tonsillar biopsies during months 15 and 20. HIV-1RNA was undetectable (<50 RNA copies per milliliter) in theseminal or cerebrospinal fluid. A total of 175 tissue sectionsfrom the lymph node, tonsil, and gastrointestinal tract wereprocessed and examined by in situ hybridization as describedpreviously.19
In contrast to the findings in lymphoid tissues from an untreatedpatient with HIV infection (Figure 3A, 3B, and 3C), in 162 tissuesections from Patient 5, there was a complete absence of cellsexpressing viral RNA in the network of follicular dendriticcells in germinal centers (Figure 3D, 3E, and 3F). The lymphoidarchitecture was also largely intact. However, in 13 tissuesections (6 lymph-node sections, 5 tonsillar sections, and 2gastrointestinal sections), 19 cells expressing viral RNA wereidentified (Figure 3G, 3H, and 3I). Morphologically, every RNA-positivecell resembled a lymphocyte; the grain count generated fromthe isotope-labeled probes ranged from 15 to 60 per cell (insetsin Figure 3G and Figure 3H), which is markedly lower than typicalgrain counts in untreated patients.19 Interestingly, many ofthe RNA-positive lymphocytes were found in lymphoid sinuses,suggesting that they might be in transit.
Figure 3. In Situ Hybridization Studies of Tissue from an Untreated Patient with HIV Infection (Panels A, B, and C) and Patient 5 (Panels D through I).
There is extensive expression of HIV-1 (blue staining) in the network of follicular dendritic cells in germinal centers found in the lymph node (Panel A), tonsil (Panel B), and sigmoid colon (Panel C) from the untreated patient. Cells expressing viral RNA are indicated by arrowheads. Most tissue sections from Patient 5 had no RNA-positive cells (Panels D, E, and F), but some sections had a few RNA-positive cells (arrowheads in Panels G, H, and I). The RNA-positive cells had the morphologic appearance of lymphocytes (insets in Panels G and H). (Panels A, B, C, E, F, and G, x200; Panels D, H, and I, x800; insets, x1260.)
No evidence of viral trapping in follicular dendritic cellswas found, even in the sections containing RNA-positive cells.Taken together, these results not only confirm the presenceof ongoing HIV-1 replication in Patient 5, but also demonstratethat this residual activity was occurring in the lymphocytepopulation usually affected and in the expected anatomical sites.
Changes in the Latent Virus
The genetic data also allowed us to measure the decrease inthe level of the parental virus (the dominant form at time 1,or form 1) in peripheral-blood mononuclear cells during treatment.At each of the three subsequent times the sequences were analyzed,the fraction of sequences identical to form 1 was determinedfor each patient. In addition, at each time, the number of copiesof proviral DNA in peripheral-blood mononuclear cells was determinedby quantitative PCR-based assays.24 These two sets of resultsallowed us to calculate the absolute number of form 1 at eachpoint in time. Figure 4A shows that in every patient there wasa gradual loss of the parental sequence, with a mean half-lifeof 6.4 months (95 percent confidence interval, 4.9 to 8.9 months).Why is this half-life important? Although much of the proviralDNA does not yield infectious HIV-1, it is primarily harboredwithin resting memory CD4 lymphocytes, the same cell populationin which latent, replication-competent HIV-1 is found.8 Thus,the decrease in levels of the parental proviral DNA providesan indirect assessment of the turnover rate of the latent virus.
Figure 4. Changes in the Levels of the Parental Proviral Sequence in Peripheral-Blood Mononuclear Cells (Panel A) and in the Numbers of Latent, Replication-Competent HIV-1 (Panel B) during Antiretroviral Therapy in the Eight Patients.
The linear regression line for each data set is shown. In Panel B, the arrows indicate values below the limit of detection. No regression lines are shown for Patients 1 and 3, who had no detectable reservoir of latent virus. PBMC denotes peripheral-blood mononuclear cells.
The decrease in the numbers of latent, replication-competentHIV-1 was also measured directly with use of a limiting-dilutionculture technique based on the method initially described byFinzi et al.13 As shown in Figure 4B, Patients 1 and 3 had nodetectable replication-competent virus in cultures of up to10 million to 50 million CD4 lymphocytes. In the other six patients,there was a gradual decrease in the levels of latent, replication-competentHIV-1, with a mean half-life of 6.2 months (95 percent confidenceinterval, 5.3 to 7.5 months). This turnover rate is remarkablyclose to that determined by the indirect method and to the averagelife span of resting memory CD4 lymphocytes.9,10,11
Discussion
We studied eight patients who had had undetectable levels ofHIV-1 RNA in plasma for up to 35 months during potent combinationantiretroviral therapy. There was no evolution of the viralsequence during treatment in six of these patients. This findingsuggests that treatment decreased the rate of replication ofHIV-1 to an undetectable level. Two patients, however, did havesequence changes. It could be argued that the new sequencesresulted from the selection of variant viruses not found initially.But such a possibility is unlikely for two reasons. First, thevariant forms were not detected among the large number of independentHIV-1 clones examined at the beginning of treatment. Second,the extent of the sequence differences (up to 16 and 25 substitutionsin fragments of approximately 650 bp) would be unusual duringprimary infection.20,21 Thus, we believe that the sequence changesare more likely due to ongoing residual replication, albeitat an exceedingly low level. This conclusion is supported byevidence of continued expression of viral RNA in lymphoid tissues,detected by in situ hybridization, in one patient. Almost certainly,most patients treated in the usual clinical setting would havegreater degrees of residual viral activity, since they typicallydo not have the sustained suppression of plasma viremia seenin our highly selected study subjects. The continued replicationof HIV-1 in two patients seems to be due to the presence ofdrug-sensitive viruses within lymphoid tissues. We are unable,however, to explain why drug-sensitive HIV-1 is capable of replicatingat low levels during treatment with three or four drugs. Butit is essential to the therapeutic effort that the answer, beit pharmacokinetic or cellular in nature, be obtained promptly.
That there is unrecognized residual replication of HIV-1 insome patients despite apparently effective combination therapyis both good and bad news. On the one hand, this finding tellsus that the extent of the persistence of a latent reservoirof virus8,12,13,14 may be overestimated, because there is unrecognizedreplenishment of the pool by active viral replication. But,on the other hand, it is sobering to realize that the so-calledhighly active antiretroviral therapy is actually not alwaysactive enough. As we strive to eradicate HIV-1 infection orinduce a remission,7 we must focus on the possibility of furtherintensifying antiretroviral treatment, even though current therapiesare already toxic, costly, and complex.
What does our estimate of the half-life of latent, replication-competentHIV-1 imply about the duration of effective treatment that isrequired to eliminate this pool? The size of the latent reservoirranges from 10,000 to 1 million cells7,8 (Figure 4B). Therefore,as a crude estimate, it will take 14 to 20 half-lives for thepool to decrease to a size of less than 1. If the half-lifeis 6 months, roughly 7 to 10 years of continuous, truly effectivetherapy will be necessary to eliminate this reservoir. It willbe difficult to maintain treatment for such a long time; thus,we must find ways to facilitate a decrease in the size of thepool of latent virus.
Supported by grants from the National Institutes of Health (AI40387and AI41534), the General Clinical Research Center of RockefellerUniversity (MO1-RR00102), the Department of Energy, the Bristol-MyersSquibb Foundation, the German Ministry of Education and Research(BMBF 01-K1-9469), the Korber Foundation, the Belotsky Foundation,and the Irene Diamond Fund.
We are indebted to the patients for their participation; toAbbott, Merck, Roche, and Glaxo Wellcome for sponsoring theclinical studies; to M. Yaman and M.R. Chaudhry for performinglymph-node and tonsillar biopsies; to R. Kost, O. Ford, andR. Schluger for clinical assistance; to G. Großschupffand B. Raschdorff for technical help; and to J. Moore and R.Connor for their critical reading of the manuscript.
Source Information
From the Aaron Diamond AIDS Research Center, Rockefeller University, New York (L.Z., B.R., Y.H., M.V., S.L., A.T., M.M., D.D.H.); Bernhard-Nocht-Institut fur Tropenmedizin, Hamburg, Germany (K.T.-R., P.R.); and the Theoretical Division, Los Alamos National Laboratory, Los Alamos, N.M. (A.S.P., B.T.K.). Other authors were Yong Guo, M.Sc., Margarita Duran, M.Sc., Arlene Hurley, R.N., John Tsay, B.Sc., Yu-Ching Huang, B.Sc., and Chia-Ching Wang, B.Sc. (Aaron Diamond AIDS Research Center, Rockefeller University, New York).
Address reprint requests to Dr. Ho at the Aaron Diamond AIDS Research Center, 455 First Ave., New York, NY 10016, or at dho{at}adarc.org.
References
Wei X, Ghosh SK, Taylor ME, et al. Viral dynamics in human immunodeficiency virus type 1 infection. Nature 1995;373:117-122. [CrossRef][Medline]
Ho DD, Neumann AU, Perelson AS, Chen W, Leonard JM, Markowitz M. Rapid turnover of plasma virions and CD4 lymphocytes in HIV-1 infection. Nature 1995;373:123-126. [CrossRef][Medline]
Perelson AS, Neumann AU, Markowitz M, Leonard JM, Ho DD. HIV-1 dynamics in vivo: virion clearance rate, infected cell life-span, and viral generation time. Science 1996;271:1582-6.
Perelson AS, Essunger P, Cao Y, et al. Decay characteristics of HIV-1 infected compartments during combination therapy. Nature 1997;387:188-191. [CrossRef][Medline]
Hammer SM, Squires KE, Hughes MD, et al. A controlled trial of two nucleoside analogues plus indinavir in persons with human immunodeficiency virus infection and CD4 cell counts of 200 per cubic millimeter or less. N Engl J Med 1997;337:725-733. [Free Full Text]
Gulick RM, Mellors JW, Havlir D, et al. Treatment with indinavir, zidovudine, and lamivudine in adults with human immunodeficiency virus infection and prior antiretroviral therapy. N Engl J Med 1997;337:734-739. [Free Full Text]
Ho DD. Toward HIV eradication or remission: the tasks ahead. Science 1998;280:1866-1867. [Free Full Text]
Chun T-W, Carruth L, Finzi D, et al. Quantification of latent tissue reservoirs and total body viral load in HIV-1 infection. Nature 1997;387:183-188. [CrossRef][Medline]
Michie CA, McLean A, Alcock C, Beverley PC. Lifespan of human lymphocyte subsets defined by CD45 isoforms. Nature 1992;360:264-265. [CrossRef][Medline]
Tough DF, Sprent J. Turnover of naïve- and memory-phenotype T cells. J Exp Med 1994;179:1127-1135. [Free Full Text]
Mohri H, Bonhoeffer S, Monard S, Perelson AS, Ho DD. Rapid turnover of T lymphocytes in SIV-infected rhesus macaques. Science 1998;279:1223-1227. [Free Full Text]
Wong JK, Hezareh M, Gunthard HF, et al. Recovery of replication-competent HIV despite prolonged suppression of plasma viremia. Science 1997;278:1291-1295. [Free Full Text]
Finzi D, Hermankova M, Pierson T, et al. Identification of a reservoir for HIV-1 in patients on highly active antiretroviral therapy. Science 1997;278:1295-1300. [Free Full Text]
Chun T-W, Engel D, Berrey MM, Shea T, Corey L, Fauci AS. Early establishment of a pool of latently infected, resting CD4+ T cells during primary HIV-1 infection. Proc Natl Acad Sci U S A 1998;95:8869-8873. [Free Full Text]
Simmonds P, Balfe P, Peutherer JF, Ludlam CA, Bishop JO, Brown AJ. Human immunodeficiency virus-infected individuals contain provirus in small numbers of peripheral mononuclear cells and at low copy numbers. J Virol 1990;64:864-872. [Free Full Text]
Higgins DG, Thompson JD, Gibson TJ. Using CLUSTAL for multiple sequence alignments. Methods Enzymol 1996;266:383-402. [Medline]
Felsenstein J. Phylogenies from molecular sequences: inference and reliability. Ann Rev Genet 1988;22:521-65.
Saitou N, Nei M. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 1987;4:406-425. [Abstract]
Tenner-Racz K, Stellbrink HJ, van Lunzen J, et al. The unenlarged lymph nodes of HIV-1 infected, asymptomatic patients with high CD4 T cell counts are sites for virus replication and CD4 T cell proliferation: the impact of highly active antiretroviral therapy. J Exp Med 1998;187:949-959. [Free Full Text]
Zhang LQ, MacKenzie P, Cleland A, Holmes EC, Brown AJ, Simmonds P. Selection for specific sequences in the external envelope protein of human immunodeficiency virus type 1 upon primary infection. J Virol 1993;67:3345-3356. [Free Full Text]
Zhu T, Mo H, Wang N, et al. Genotypic and phenotypic characterization of HIV-1 patients with primary infection. Science 1993;261:1179-1181.
Vartanian JP, Meyerhans A, Sala M, Wain-Hobson S. GA hypermutation of the human immunodeficiency virus type 1 genome: evidence for dCTP pool imbalance during reverse transcription. Proc Natl Acad Sci U S A 1994;91:3092-3096. [Free Full Text]
Martinez MA, Vartanian JP, Wain-Hobson S. Hypermutagenesis of RNA using human immunodeficiency virus type 1 reverse transcriptase and biased dNTP concentrations. Proc Natl Acad Sci U S A 1994;91:11787-11791. [Free Full Text]
Vesanen M, Stevens CE, Taylor PE, Rubinstein P, Saksela K. Stability in controlling viral replication identifies long-term nonprogressors as a distinct subgroup among human immunodeficiency virus type 1-infected persons. J Virol 1996;70:9035-9040. [Abstract]
Richman, D. D., Margolis, D. M., Delaney, M., Greene, W. C., Hazuda, D., Pomerantz, R. J.
(2009). The Challenge of Finding a Cure for HIV Infection. Science
323: 1304-1307
[Abstract][Full Text]
Joos, B., Fischer, M., Kuster, H., Pillai, S. K., Wong, J. K., Boni, J., Hirschel, B., Weber, R., Trkola, A., Gunthard, H. F., The Swiss HIV Cohort Study,
(2008). HIV rebounds from latently infected cells, rather than from continuing low-level replication. Proc. Natl. Acad. Sci. USA
105: 16725-16730
[Abstract][Full Text]
Palmer, S., Maldarelli, F., Wiegand, A., Bernstein, B., Hanna, G. J., Brun, S. C., Kempf, D. J., Mellors, J. W., Coffin, J. M., King, M. S.
(2008). Low-level viremia persists for at least 7 years in patients on suppressive antiretroviral therapy. Proc. Natl. Acad. Sci. USA
105: 3879-3884
[Abstract][Full Text]
Saleh, S., Solomon, A., Wightman, F., Xhilaga, M., Cameron, P. U., Lewin, S. R.
(2007). CCR7 ligands CCL19 and CCL21 increase permissiveness of resting memory CD4+ T cells to HIV-1 infection: a novel model of HIV-1 latency. Blood
110: 4161-4164
[Abstract][Full Text]
Janneh, O., Jones, E., Chandler, B., Owen, A., Khoo, S. H.
(2007). Inhibition of P-glycoprotein and multidrug resistance-associated proteins modulates the intracellular concentration of lopinavir in cultured CD4 T cells and primary human lymphocytes. J Antimicrob Chemother
60: 987-993
[Abstract][Full Text]
Mehandru, S., Vcelar, B., Wrin, T., Stiegler, G., Joos, B., Mohri, H., Boden, D., Galovich, J., Tenner-Racz, K., Racz, P., Carrington, M., Petropoulos, C., Katinger, H., Markowitz, M.
(2007). Adjunctive Passive Immunotherapy in Human Immunodeficiency Virus Type 1-Infected Individuals Treated with Antiviral Therapy during Acute and Early Infection. J. Virol.
81: 11016-11031
[Abstract][Full Text]
Kaiser, P., Joos, B., Niederost, B., Weber, R., Gunthard, H. F., Fischer, M., the Swiss HIV Cohort Study,
(2007). Productive Human Immunodeficiency Virus Type 1 Infection in Peripheral Blood Predominantly Takes Place in CD4/CD8 Double-Negative T Lymphocytes. J. Virol.
81: 9693-9706
[Abstract][Full Text]
Ellery, P. J., Tippett, E., Chiu, Y.-L., Paukovics, G., Cameron, P. U., Solomon, A., Lewin, S. R., Gorry, P. R., Jaworowski, A., Greene, W. C., Sonza, S., Crowe, S. M.
(2007). The CD16+ Monocyte Subset Is More Permissive to Infection and Preferentially Harbors HIV-1 In Vivo. J. Immunol.
178: 6581-6589
[Abstract][Full Text]
Llewellyn, N., Zioni, R., Zhu, H., Andrus, T., Xu, Y., Corey, L., Zhu, T.
(2006). Continued evolution of HIV-1 circulating in blood monocytes with antiretroviral therapy: genetic analysis of HIV-1 in monocytes and CD4+ T cells of patients with discontinued therapy.. J. Leukoc. Biol.
80: 1118-1126
[Abstract][Full Text]
Cervasi, B., Paiardini, M., Serafini, S., Fraternale, A., Menotta, M., Engram, J., Lawson, B., Staprans, S. I., Piedimonte, G., Perno, C. F., Silvestri, G., Magnani, M.
(2006). Administration of Fludarabine-Loaded Autologous Red Blood Cells in Simian Immunodeficiency Virus-Infected Sooty Mangabeys Depletes pSTAT-1-Expressing Macrophages and Delays the Rebound of Viremia after Suspension of Antiretroviral Therapy.. J. Virol.
80: 10335-10345
[Abstract][Full Text]
Chou, T.-C.
(2006). Theoretical Basis, Experimental Design, and Computerized Simulation of Synergism and Antagonism in Drug Combination Studies. Pharmacol. Rev.
58: 621-681
[Abstract][Full Text]
Chen, K., Huang, J., Zhang, C., Huang, S., Nunnari, G., Wang, F.-x., Tong, X., Gao, L., Nikisher, K., Zhang, H.
(2006). Alpha Interferon Potently Enhances the Anti-Human Immunodeficiency Virus Type 1 Activity of APOBEC3G in Resting Primary CD4 T Cells.. J. Virol.
80: 7645-7657
[Abstract][Full Text]
Bailey, J. R., Sedaghat, A. R., Kieffer, T., Brennan, T., Lee, P. K., Wind-Rotolo, M., Haggerty, C. M., Kamireddi, A. R., Liu, Y., Lee, J., Persaud, D., Gallant, J. E., Cofrancesco, J. Jr., Quinn, T. C., Wilke, C. O., Ray, S. C., Siliciano, J. D., Nettles, R. E., Siliciano, R. F.
(2006). Residual Human Immunodeficiency Virus Type 1 Viremia in Some Patients on Antiretroviral Therapy Is Dominated by a Small Number of Invariant Clones Rarely Found in Circulating CD4+ T Cells.. J. Virol.
80: 6441-6457
[Abstract][Full Text]
Popovic, M., Tenner-Racz, K., Pelser, C., Stellbrink, H.-J., van Lunzen, J., Lewis, G., Kalyanaraman, V. S., Gallo, R. C., Racz, P.
(2005). Persistence of HIV-1 structural proteins and glycoproteins in lymph nodes of patients under highly active antiretroviral therapy. Proc. Natl. Acad. Sci. USA
102: 14807-14812
[Abstract][Full Text]
Monie, D., Simmons, R. P., Nettles, R. E., Kieffer, T. L., Zhou, Y., Zhang, H., Karmon, S., Ingersoll, R., Chadwick, K., Zhang, H., Margolick, J. B., Quinn, T. C., Ray, S. C., Wind-Rotolo, M., Miller, M., Persaud, D., Siliciano, R. F.
(2005). A Novel Assay Allows Genotyping of the Latent Reservoir for Human Immunodeficiency Virus Type 1 in the Resting CD4+ T Cells of Viremic Patients. J. Virol.
79: 5185-5202
[Abstract][Full Text]
Sharkey, M., Triques, K., Kuritzkes, D. R., Stevenson, M.
(2005). In Vivo Evidence for Instability of Episomal Human Immunodeficiency Virus Type 1 cDNA. J. Virol.
79: 5203-5210
[Abstract][Full Text]
Casazza, J. P., Betts, M. R., Hill, B. J., Brenchley, J. M., Price, D. A., Douek, D. C., Koup, R. A.
(2005). Immunologic Pressure within Class I-Restricted Cognate Human Immunodeficiency Virus Epitopes during Highly Active Antiretroviral Therapy. J. Virol.
79: 3653-3663
[Abstract][Full Text]
Zhang, L., Chen, Z., Cao, Y., Yu, J., Li, G., Yu, W., Yin, N., Mei, S., Li, L., Balfe, P., He, T., Ba, L., Zhang, F., Lin, H.-H., Yuen, M.-F., Lai, C.-L., Ho, D. D.
(2004). Molecular Characterization of Human Immunodeficiency Virus Type 1 and Hepatitis C Virus in Paid Blood Donors and Injection Drug Users in China. J. Virol.
78: 13591-13599
[Abstract][Full Text]
Coberley, C. R., Kohler, J. J., Brown, J. N., Oshier, J. T., Baker, H. V., Popp, M. P., Sleasman, J. W., Goodenow, M. M.
(2004). Impact on Genetic Networks in Human Macrophages by a CCR5 Strain of Human Immunodeficiency Virus Type 1. J. Virol.
78: 11477-11486
[Abstract][Full Text]
Biancotto, A., Grivel, J.-C., Gondois-Rey, F., Bettendroffer, L., Vigne, R., Brown, S., Margolis, L. B., Hirsch, I.
(2004). Dual Role of Prostratin in Inhibition of Infection and Reactivation of Human Immunodeficiency Virus from Latency in Primary Blood Lymphocytes and Lymphoid Tissue. J. Virol.
78: 10507-10515
[Abstract][Full Text]
Fondere, J.-M., Petitjean, G., Huguet, M.-F., Salhi, S. L., Baillat, V., Macura-Biegum, A., Becquart, P., Reynes, J., Vendrell, J.-P.
(2004). Human Immunodeficiency Virus Type 1 (HIV-1) Antigen Secretion by Latently Infected Resting CD4+ T Lymphocytes from HIV-1-Infected Individuals. J. Virol.
78: 10536-10542
[Abstract][Full Text]
Di Mascio, M., Markowitz, M., Louie, M., Hurley, A., Hogan, C., Simon, V., Follmann, D., Ho, D. D., Perelson, A. S.
(2004). Dynamics of Intermittent Viremia during Highly Active Antiretroviral Therapy in Patients Who Initiate Therapy during Chronic versus Acute and Early Human Immunodeficiency Virus Type 1 Infection. J. Virol.
78: 10566-10573
[Abstract][Full Text]
Potter, S. J., Lemey, P., Achaz, G., Chew, C. B., Vandamme, A.-M., Dwyer, D. E., Saksena, N. K.
(2004). HIV-1 compartmentalization in diverse leukocyte populations during antiretroviral therapy. J. Leukoc. Biol.
76: 562-570
[Abstract][Full Text]
Saavedra-Lozano, J., McCoig, C. C., Cao, Y., Vitetta, E. S., Ramilo, O.
(2004). Zidovudine, Lamivudine, and Abacavir Have Different Effects on Resting Cells Infected with Human Immunodeficiency Virus In Vitro. Antimicrob. Agents Chemother.
48: 2825-2830
[Abstract][Full Text]
Scheller, C., Ullrich, A., McPherson, K., Hefele, B., Knoferle, J., Lamla, S., Olbrich, A. R. M., Stocker, H., Arasteh, K., Meulen, V. t., Rethwilm, A., Koutsilieri, E., Dittmer, U.
(2004). CpG Oligodeoxynucleotides Activate HIV Replication in Latently Infected Human T Cells. J. Biol. Chem.
279: 21897-21902
[Abstract][Full Text]
Kinloch-de Loes, S.
(2004). Role of therapeutic vaccines in the control of HIV-1. J Antimicrob Chemother
53: 562-566
[Abstract][Full Text]
Levy, D. N., Aldrovandi, G. M., Kutsch, O., Shaw, G. M.
(2004). From The Cover: Dynamics of HIV-1 recombination in its natural target cells. Proc. Natl. Acad. Sci. USA
101: 4204-4209
[Abstract][Full Text]
Saavedra-Lozano, J., Cao, Y., Callison, J., Sarode, R., Sodora, D., Edgar, J., Hatfield, J., Picker, L., Peterson, D., Ramilo, O., Vitetta, E. S.
(2004). An anti-CD45RO immunotoxin kills HIV-latently infected cells from individuals on HAART with little effect on CD8 memory. Proc. Natl. Acad. Sci. USA
101: 2494-2499
[Abstract][Full Text]
Persaud, D., Siberry, G. K., Ahonkhai, A., Kajdas, J., Monie, D., Hutton, N., Watson, D. C., Quinn, T. C., Ray, S. C., Siliciano, R. F.
(2004). Continued Production of Drug-Sensitive Human Immunodeficiency Virus Type 1 in Children on Combination Antiretroviral Therapy Who Have Undetectable Viral Loads. J. Virol.
78: 968-979
[Abstract][Full Text]
Di Mascio, M., Markowitz, M., Louie, M., Hogan, C., Hurley, A., Chung, C., Ho, D. D., Perelson, A. S.
(2003). Viral Blip Dynamics during Highly Active Antiretroviral Therapy. J. Virol.
77: 12165-12172
[Abstract][Full Text]
Crowe, S., Zhu, T., Muller, W. A.
(2003). The contribution of monocyte infection and trafficking to viral persistence, and maintenance of the viral reservoir in HIV infection. J. Leukoc. Biol.
74: 635-641
[Abstract][Full Text]
Havlir, D. V., Strain, M. C., Clerici, M., Ignacio, C., Trabattoni, D., Ferrante, P., Wong, J. K.
(2003). Productive Infection Maintains a Dynamic Steady State of Residual Viremia in Human Immunodeficiency Virus Type 1-Infected Persons Treated with Suppressive Antiretroviral Therapy for Five Years. J. Virol.
77: 11212-11219
[Abstract][Full Text]
Kaufmann, G. R., Perrin, L., Pantaleo, G., Opravil, M., Furrer, H., Telenti, A., Hirschel, B., Ledergerber, B., Vernazza, P., Bernasconi, E., Rickenbach, M., Egger, M., Battegay, M.
(2003). CD4 T-Lymphocyte Recovery in Individuals With Advanced HIV-1 Infection Receiving Potent Antiretroviral Therapy for 4 Years: The Swiss HIV Cohort Study. Arch Intern Med
163: 2187-2195
[Abstract][Full Text]
Saag, M.
(2003). Is It Time To Proactively Switch Successful Antiretroviral Therapy? Carefully Check Your SWATCH. ANN INTERN MED
139: 148-149
[Full Text]
Hermankova, M., Siliciano, J. D., Zhou, Y., Monie, D., Chadwick, K., Margolick, J. B., Quinn, T. C., Siliciano, R. F.
(2003). Analysis of Human Immunodeficiency Virus Type 1 Gene Expression in Latently Infected Resting CD4+ T Lymphocytes In Vivo. J. Virol.
77: 7383-7392
[Abstract][Full Text]
Frenkel, L. M., Wang, Y., Learn, G. H., McKernan, J. L., Ellis, G. M., Mohan, K. M., Holte, S. E., De Vange, S. M., Pawluk, D. M., Melvin, A. J., Lewis, P. F., Heath, L. M., Beck, I. A., Mahalanabis, M., Naugler, W. E., Tobin, N. H., Mullins, J. I.
(2003). Multiple Viral Genetic Analyses Detect Low-Level Human Immunodeficiency Virus Type 1 Replication during Effective Highly Active Antiretroviral Therapy. J. Virol.
77: 5721-5730
[Abstract][Full Text]
Nickle, D. C., Jensen, M. A., Shriner, D., Brodie, S. J., Frenkel, L. M., Mittler, J. E., Mullins, J. I.
(2003). Evolutionary Indicators of Human Immunodeficiency Virus Type 1 Reservoirs and Compartments. J. Virol.
77: 5540-5546
[Abstract][Full Text]
Strain, M. C., Gunthard, H. F., Havlir, D. V., Ignacio, C. C., Smith, D. M., Leigh-Brown, A. J., Macaranas, T. R., Lam, R. Y., Daly, O. A., Fischer, M., Opravil, M., Levine, H., Bacheler, L., Spina, C. A., Richman, D. D., Wong, J. K.
(2003). Heterogeneous clearance rates of long-lived lymphocytes infected with HIV: Intrinsic stability predicts lifelong persistence. Proc. Natl. Acad. Sci. USA
100: 4819-4824
[Abstract][Full Text]
Pion, M., Jordan, A., Biancotto, A., Dequiedt, F., Gondois-Rey, F., Rondeau, S., Vigne, R., Hejnar, J., Verdin, E., Hirsch, I.
(2003). Transcriptional Suppression of In Vitro-Integrated Human Immunodeficiency Virus Type 1 Does Not Correlate with Proviral DNA Methylation. J. Virol.
77: 4025-4032
[Abstract][Full Text]
Parolin, C., Gatto, B., Del Vecchio, C., Pecere, T., Tramontano, E., Cecchetti, V., Fravolini, A., Masiero, S., Palumbo, M., Palu, G.
(2003). New Anti-Human Immunodeficiency Virus Type 1 6-Aminoquinolones: Mechanism of Action. Antimicrob. Agents Chemother.
47: 889-896
[Abstract][Full Text]
Dybul, M., Daucher, M., Jensen, M. A., Hallahan, C. W., Chun, T.-W., Belson, M., Hidalgo, B., Nickle, D. C., Yoder, C., Metcalf, J. A., Davey, R. T., Ehler, L., Kress-Rock, D., Nies-Kraske, E., Liu, S., Mullins, J. I., Fauci, A. S.
(2003). Genetic Characterization of Rebounding Human Immunodeficiency Virus Type 1 in Plasma during Multiple Interruptions of Highly Active Antiretroviral Therapy. J. Virol.
77: 3229-3237
[Abstract][Full Text]
Chun, T.-W., Justement, J. S., Lempicki, R. A., Yang, J., Dennis, G. Jr., Hallahan, C. W., Sanford, C., Pandya, P., Liu, S., McLaughlin, M., Ehler, L. A., Moir, S., Fauci, A. S.
(2003). Gene expression and viral prodution in latently infected, resting CD4+ T cells in viremic versus aviremic HIV-infected individuals. Proc. Natl. Acad. Sci. USA
100: 1908-1913
[Abstract][Full Text]
Persaud, D., Zhou, Y., Siliciano, J. M., Siliciano, R. F.
(2003). Latency in Human Immunodeficiency Virus Type 1 Infection: No Easy Answers. J. Virol.
77: 1659-1665
[Full Text]
Di Mascio, M., Dornadula, G., Zhang, H., Sullivan, J., Xu, Y., Kulkosky, J., Pomerantz, R. J., Perelson, A. S.
(2003). In a Subset of Subjects on Highly Active Antiretroviral Therapy, Human Immunodeficiency Virus Type 1 RNA in Plasma Decays from 50 to <5 Copies per Milliliter, with a Half-Life of 6 Months. J. Virol.
77: 2271-2275
[Abstract][Full Text]
Scripture-Adams, D. D., Brooks, D. G., Korin, Y. D., Zack, J. A.
(2002). Interleukin-7 Induces Expression of Latent Human Immunodeficiency Virus Type 1 with Minimal Effects on T-Cell Phenotype. J. Virol.
76: 13077-13082
[Abstract][Full Text]
Martinez-Picado, J., Frost, S. D. W., Izquierdo, N., Morales-Lopetegi, K., Marfil, S., Puig, T., Cabrera, C., Clotet, B., Ruiz, L.
(2002). Viral Evolution during Structured Treatment Interruptions in Chronically Human Immunodeficiency Virus-Infected Individuals. J. Virol.
76: 12344-12348
[Abstract][Full Text]
Khoo, S. H., Hoggard, P. G., Williams, I., Meaden, E. R., Newton, P., Wilkins, E. G., Smith, A., Tjia, J. F., Lloyd, J., Jones, K., Beeching, N., Carey, P., Peters, B., Back, D. J.
(2002). Intracellular Accumulation of Human Immunodeficiency Virus Protease Inhibitors. Antimicrob. Agents Chemother.
46: 3228-3235
[Abstract][Full Text]
Zhang, L., Rowe, L., He, T., Chung, C., Yu, J., Yu, W., Talal, A., Markowitz, M., Ho, D. D.
(2002). Compartmentalization of Surface Envelope Glycoprotein of Human Immunodeficiency Virus Type 1 during Acute and Chronic Infection. J. Virol.
76: 9465-9473
[Abstract][Full Text]
Ruff, C. T., Ray, S. C., Kwon, P., Zinn, R., Pendleton, A., Hutton, N., Ashworth, R., Gange, S., Quinn, T. C., Siliciano, R. F., Persaud, D.
(2002). Persistence of Wild-Type Virus and Lack of Temporal Structure in the Latent Reservoir for Human Immunodeficiency Virus Type 1 in Pediatric Patients with Extensive Antiretroviral Exposure. J. Virol.
76: 9481-9492
[Abstract][Full Text]
Pierson, T. C., Zhou, Y., Kieffer, T. L., Ruff, C. T., Buck, C., Siliciano, R. F.
(2002). Molecular Characterization of Preintegration Latency in Human Immunodeficiency Virus Type 1 Infection. J. Virol.
76: 8518-8531
[Abstract][Full Text]
Muller, V., Vigueras-Gomez, J. F., Bonhoeffer, S.
(2002). Decelerating Decay of Latently Infected Cells during Prolonged Therapy for Human Immunodeficiency Virus Type 1 Infection. J. Virol.
76: 8963-8965
[Abstract][Full Text]
Yeni, P. G., Hammer, S. M., Carpenter, C. C. J., Cooper, D. A., Fischl, M. A., Gatell, J. M., Gazzard, B. G., Hirsch, M. S., Jacobsen, D. M., Katzenstein, D. A., Montaner, J. S. G., Richman, D. D., Saag, M. S., Schechter, M., Schooley, R. T., Thompson, M. A., Vella, S., Volberding, P. A.
(2002). Antiretroviral Treatment for Adult HIV Infection in 2002: Updated Recommendations of the International AIDS Society-USA Panel. JAMA
288: 222-235
[Abstract][Full Text]
Walmsley, S., Loutfy, M.
(2002). Can Structured Treatment Interruptions (STIs) Be Used as a Strategy to Decrease Total Drug Requirements and Toxicity in HIV Infection?. J Int Assoc Physicians AIDS Care (Chic Ill)
1: 95-103
[Abstract]
Kijak, G. H., Simon, V., Balfe, P., Vanderhoeven, J., Pampuro, S. E., Zala, C., Ochoa, C., Cahn, P., Markowitz, M., Salomon, H.
(2002). Origin of Human Immunodeficiency Virus Type 1 Quasispecies Emerging after Antiretroviral Treatment Interruption in Patients with Therapeutic Failure. J. Virol.
76: 7000-7009
[Abstract][Full Text]
Demeter, L. M., Bosch, R. J., Coombs, R. W., Fiscus, S., Bremer, J., Johnson, V. A., Erice, A., Jackson, J. B., Spector, S. A., Squires, K. M., Fischl, M. A., Hughes, M. D., Hammer, S. M.
(2002). Detection of Replication-Competent Human Immunodeficiency Virus Type 1 (HIV-1) in Cultures from Patients with Levels of HIV-1 RNA in Plasma Suppressed to Less Than 500 or 50 Copies Per Milliliter. J. Clin. Microbiol.
40: 2089-2094
[Abstract][Full Text]
Valentin, A., Rosati, M., Patenaude, D. J., Hatzakis, A., Kostrikis, L. G., Lazanas, M., Wyvill, K. M., Yarchoan, R., Pavlakis, G. N.
(2002). Persistent HIV-1 infection of natural killer cells in patients receiving highly active antiretroviral therapy. Proc. Natl. Acad. Sci. USA
99: 7015-7020
[Abstract][Full Text]
Appay, V., Papagno, L., Spina, C. A., Hansasuta, P., King, A., Jones, L., Ogg, G. S., Little, S., McMichael, A. J., Richman, D. D., Rowland-Jones, S. L.
(2002). Dynamics of T Cell Responses in HIV Infection. J. Immunol.
168: 3660-3666
[Abstract][Full Text]
Jin, X., Ramanathan, M. Jr., Barsoum, S., Deschenes, G. R., Ba, L., Binley, J., Schiller, D., Bauer, D. E., Chen, D. C., Hurley, A., Gebuhrer, L., El Habib, R., Caudrelier, P., Klein, M., Zhang, L., Ho, D. D., Markowitz, M.
(2002). Safety and Immunogenicity of ALVAC vCP1452 and Recombinant gp160 in Newly Human Immunodeficiency Virus Type 1-Infected Patients Treated with Prolonged Highly Active Antiretroviral Therapy. J. Virol.
76: 2206-2216
[Abstract][Full Text]
Piccinini, G., Foli, A., Comolli, G., Lisziewicz, J., Lori, F.
(2002). Complementary Antiviral Efficacy of Hydroxyurea and Protease Inhibitors in Human Immunodeficiency Virus-Infected Dendritic Cells and Lymphocytes. J. Virol.
76: 2274-2278
[Abstract][Full Text]
Edwards, B. H., Bansal, A., Sabbaj, S., Bakari, J., Mulligan, M. J., Goepfert, P. A.
(2002). Magnitude of Functional CD8+ T-Cell Responses to the Gag Protein of Human Immunodeficiency Virus Type 1 Correlates Inversely with Viral Load in Plasma. J. Virol.
76: 2298-2305
[Abstract][Full Text]
Smith-Franklin, B. A., Keele, B. F., Tew, J. G., Gartner, S., Szakal, A. K., Estes, J. D., Thacker, T. C., Burton, G. F.
(2002). Follicular Dendritic Cells and the Persistence of HIV Infectivity: The Role of Antibodies and Fc{gamma} Receptors. J. Immunol.
168: 2408-2414
[Abstract][Full Text]
van Rij, R. P., Visser, J. A., van Praag, R. M. E., Rientsma, R., Prins, J. M., Lange, J. M. A., Schuitemaker, H.
(2002). Both R5 and X4 Human Immunodeficiency Virus Type 1 Variants Persist during Prolonged Therapy with Five Antiretroviral Drugs. J. Virol.
76: 3054-3058
[Abstract][Full Text]
Frost, S. D. W., Martinez-Picado, J., Ruiz, L., Clotet, B., Leigh Brown, A. J.
(2002). Viral Dynamics during Structured Treatment Interruptions of Chronic Human Immunodeficiency Virus Type 1 Infection. J. Virol.
76: 968-979
[Abstract][Full Text]
Zhu, T., Muthui, D., Holte, S., Nickle, D., Feng, F., Brodie, S., Hwangbo, Y., Mullins, J. I., Corey, L.
(2002). Evidence for Human Immunodeficiency Virus Type 1 Replication In Vivo in CD14+ Monocytes and Its Potential Role as a Source of Virus in Patients on Highly Active Antiretroviral Therapy. J. Virol.
76: 707-716
[Abstract][Full Text]
Ortiz, G. M., Hu, J., Goldwitz, J. A., Chandwani, R., Larsson, M., Bhardwaj, N., Bonhoeffer, S., Ramratnam, B., Zhang, L., Markowitz, M. M., Nixon, D. F.
(2002). Residual Viral Replication during Antiretroviral Therapy Boosts Human Immunodeficiency Virus Type 1-Specific CD8+ T-Cell Responses in Subjects Treated Early after Infection. J. Virol.
76: 411-415
[Abstract][Full Text]
Fraser, C., Ferguson, N. M., Anderson, R. M.
(2001). Quantification of intrinsic residual viral replication in treated HIV-infected patients. Proc. Natl. Acad. Sci. USA
10.1073/pnas.261283598v1
[Abstract][Full Text]
Dybul, M., Chun, T.-W., Yoder, C., Hidalgo, B., Belson, M., Hertogs, K., Larder, B., Dewar, R. L., Fox, C. H., Hallahan, C. W., Justement, J. S., Migueles, S. A., Metcalf, J. A., Davey, R. T., Daucher, M., Pandya, P., Baseler, M., Ward, D. J., Fauci, A. S.
(2001). Short-cycle structured intermittent treatment of chronic HIV infection with highly active antiretroviral therapy: Effects on virologic, immunologic, and toxicity parameters. Proc. Natl. Acad. Sci. USA
10.1073/pnas.261568398v1
[Abstract][Full Text]
Lum, J. J., Pilon, A. A., Sanchez-Dardon, J., Phenix, B. N., Kim, J. E., Mihowich, J., Jamison, K., Hawley-Foss, N., Lynch, D. H., Badley, A. D.
(2001). Induction of Cell Death in Human Immunodeficiency Virus-Infected Macrophages and Resting Memory CD4 T Cells by TRAIL/Apo2L. J. Virol.
75: 11128-11136
[Abstract][Full Text]
Kulkosky, J., Culnan, D. M., Roman, J., Dornadula, G., Schnell, M., Boyd, M. R., Pomerantz, R. J.
(2001). Prostratin: activation of latent HIV-1 expression suggests a potential inductive adjuvant therapy for HAART. Blood
98: 3006-3015
[Abstract][Full Text]
Cole, S. W., Naliboff, B. D., Kemeny, M. E., Griswold, M. P., Fahey, J. L., Zack, J. A.
(2001). Impaired response to HAART in HIV-infected individuals with high autonomic nervous system activity. Proc. Natl. Acad. Sci. USA
98: 12695-12700
[Abstract][Full Text]
Jolles, S, Tyrer, M, Johnson, M, Webster, D
(2001). Long term recovery of IgG and IgM production during HIV infection in a patient with common variable immunodeficiency (CVID). J. Clin. Pathol.
54: 713-715
[Abstract][Full Text]
Havlir, D. V., Bassett, R., Levitan, D., Gilbert, P., Tebas, P., Collier, A. C., Hirsch, M. S., Ignacio, C., Condra, J., Gunthard, H. F., Richman, D. D., Wong, J. K.
(2001). Prevalence and Predictive Value of Intermittent Viremia With Combination HIV Therapy. JAMA
286: 171-179
[Abstract][Full Text]
Hermankova, M., Ray, S. C., Ruff, C., Powell-Davis, M., Ingersoll, R., D'Aquila, R. T., Quinn, T. C., Siliciano, J. D., Siliciano, R. F., Persaud, D.
(2001). HIV-1 Drug Resistance Profiles in Children and Adults With Viral Load of <50 Copies/mL Receiving Combination Therapy. JAMA
286: 196-207
[Abstract][Full Text]
Deeks, S. G.
(2001). Durable HIV Treatment Benefit Despite Low-Level Viremia: Reassessing Definitions of Success or Failure. JAMA
286: 224-226
[Full Text]
Hogan, C. M., Hammer, S. M.
(2001). Host Determinants in HIV Infection and Disease: Part 2: Genetic Factors and Implications for Antiretroviral Therapeutics. ANN INTERN MED
134: 978-996
[Abstract][Full Text]
Mittler, J., Essunger, P., Yuen, G. J., Clendeninn, N., Markowitz, M., Perelson, A. S.
(2001). Short-Term Measures of Relative Efficacy Predict Longer-Term Reductions in Human Immunodeficiency Virus Type 1 RNA Levels following Nelfinavir Monotherapy. Antimicrob. Agents Chemother.
45: 1438-1443
[Abstract][Full Text]
Martín, J., LaBranche, C. C., González-Scarano, F.
(2001). Differential CD4/CCR5 Utilization, gp120 Conformation, and Neutralization Sensitivity between Envelopes from a Microglia-Adapted Human Immunodeficiency Virus Type 1 and Its Parental Isolate. J. Virol.
75: 3568-3580
[Abstract][Full Text]
Engelmayer, J., Larsson, M., Lee, A., Lee, M., Cox, W. I., Steinman, R. M., Bhardwaj, N.
(2001). Mature Dendritic Cells Infected with Canarypox Virus Elicit Strong Anti-Human Immunodeficiency Virus CD8+ and CD4+ T-Cell Responses from Chronically Infected Individuals. J. Virol.
75: 2142-2153
[Abstract][Full Text]
Deeks, S. G., Wrin, T., Liegler, T., Hoh, R., Hayden, M., Barbour, J. D., Hellmann, N. S., Petropoulos, C. J., McCune, J. M., Hellerstein, M. K., Grant, R. M.
(2001). Virologic and Immunologic Consequences of Discontinuing Combination Antiretroviral-Drug Therapy in HIV-Infected Patients with Detectable Viremia. NEJM
344: 472-480
[Abstract][Full Text]
Chun, T.-W., Justement, J. S., Moir, S., Hallahan, C. W., Ehler, L. A., Liu, S., McLaughlin, M., Dybul, M., Mican, J. M., Fauci, A. S.
(2001). Suppression of HIV replication in the resting CD4+ T cell reservoir by autologous CD8+ T cells: Implications for the development of therapeutic strategies. Proc. Natl. Acad. Sci. USA
98: 253-258
[Abstract][Full Text]
Smith, B. A., Gartner, S., Liu, Y., Perelson, A. S., Stilianakis, N. I., Keele, B. F., Kerkering, T. M., Ferreira-Gonzalez, A., Szakal, A. K., Tew, J. G., Burton, G. F.
(2001). Persistence of Infectious HIV on Follicular Dendritic Cells. J. Immunol.
166: 690-696
[Abstract][Full Text]
Eugenio, K. R., Zeind, C. S.
(2000). Management of HIV-1 Infection in Adults and Adolescents. Journal of Pharmacy Practice
13: 426-441
[Abstract]
HART, C.A., BEECHING, N.J., DUERDEN, B.I.
(2000). Infections in AIDS: Proceedings of the Sixth Liverpool Tropical School Bayer Symposium on Microbial Diseases held on 6 February 1999. J Med Microbiol
49: 947-967
[Full Text]
BRUGGEMAN, L. A., ROSS, M. D., TANJI, N., CARA, A., DIKMAN, S., GORDON, R. E., BURNS, G. C., D'AGATI, V. D., WINSTON, J. A., KLOTMAN, M. E., KLOTMAN, P. E.
(2000). Renal Epithelium Is a Previously Unrecognized Site of HIV-1 Infection. J. Am. Soc. Nephrol.
11: 2079-2087
[Abstract][Full Text]
Badley, A. D., Pilon, A. A., Landay, A., Lynch, D. H.
(2000). Mechanisms of HIV-associated lymphocyte apoptosis. Blood
96: 2951-2964
[Abstract][Full Text]
Martinez-Picado, J., DePasquale, M. P., Kartsonis, N., Hanna, G. J., Wong, J., Finzi, D., Rosenberg, E., Gunthard, H. F., Sutton, L., Savara, A., Petropoulos, C. J., Hellmann, N., Walker, B. D., Richman, D. D., Siliciano, R., D'Aquila, R. T.
(2000). Antiretroviral resistance during successful therapy of HIV type 1 infection. Proc. Natl. Acad. Sci. USA
97: 10948-10953
[Abstract][Full Text]
Churdboonchart, V., Sakondhavat, C., Kulpradist, S., Na Ayudthya, B. I., Chandeying, V., Rugpao, S., Boonshuyar, C., Sukeepaisarncharoen, W., Sirawaraporn, W., Carlo, D. J., Moss, R.
(2000). A Double-Blind, Adjuvant-Controlled Trial of Human Immunodeficiency Virus Type 1 (HIV-1) Immunogen (Remune) Monotherapy in Asymptomatic, HIV-1-Infected Thai Subjects with CD4-Cell Counts of >300. CVI
7: 728-733
[Abstract][Full Text]
Crowe, S. M., Sonza, S.
(2000). HIV-1 can be recovered from a variety of cells including peripheral blood monocytes of patients receiving highly active antiretroviral therapy: a further obstacle to eradication. J. Leukoc. Biol.
68: 345-350
[Abstract][Full Text]
Brodie, S. J.
(2000). Nonlymphoid reservoirs of HIV replication in children with chronic-progressive disease. J. Leukoc. Biol.
68: 351-359
[Abstract][Full Text]
Pierson, T., Hoffman, T. L., Blankson, J., Finzi, D., Chadwick, K., Margolick, J. B., Buck, C., Siliciano, J. D., Doms, R. W., Siliciano, R. F.
(2000). Characterization of Chemokine Receptor Utilization of Viruses in the Latent Reservoir for Human Immunodeficiency Virus Type 1. J. Virol.
74: 7824-7833
[Abstract][Full Text]
Kacani, L., Prodinger, W. M., Sprinzl, G. M., Schwendinger, M. G., Spruth, M., Stoiber, H., Döpper, S., Steinhuber, S., Steindl, F., Dierich, M. P.
(2000). Detachment of Human Immunodeficiency Virus Type 1 from Germinal Centers by Blocking Complement Receptor Type 2. J. Virol.
74: 7997-8002
[Abstract][Full Text]
Weiden, M., Tanaka, N., Qiao, Y., Zhao, B. Y., Honda, Y., Nakata, K., Canova, A., Levy, D. E., Rom, W. N., Pine, R.
(2000). Differentiation of Monocytes to Macrophages Switches the Mycobacterium tuberculosis Effect on HIV-1 Replication from Stimulation to Inhibition: Modulation of Interferon Response and CCAAT/Enhancer Binding Protein {beta} Expression. J. Immunol.
165: 2028-2039
[Abstract][Full Text]
Erice, A., Brambilla, D., Bremer, J., Jackson, J. B., Kokka, R., Yen-Lieberman, B., Coombs, R. W.
(2000). Performance Characteristics of the QUANTIPLEX HIV-1 RNA 3.0 Assay for Detection and Quantitation of Human Immunodeficiency Virus Type 1 RNA in Plasma. J. Clin. Microbiol.
38: 2837-2845
[Abstract][Full Text]
Mori, K., Yasutomi, Y., Sawada, S., Villinger, F., Sugama, K., Rosenwith, B., Heeney, J. L., Überla, K., Yamazaki, S., Ansari, A. A., Rübsamen-Waigmann, H.
(2000). Suppression of Acute Viremia by Short-Term Postexposure Prophylaxis of Simian/Human Immunodeficiency Virus SHIV-RT-Infected Monkeys with a Novel Reverse Transcriptase Inhibitor (GW420867) Allows for Development of Potent Antiviral Immune Responses Resulting in Efficient Containment of Infection. J. Virol.
74: 5747-5753
[Abstract][Full Text]
Sewell, A. K., Price, D. A., Oxenius, A., Kelleher, A. D., Phillips, R. E.
(2000). Cytotoxic T Lymphocyte Responses to Human Immunodeficiency Virus: Control and Escape. Stem Cells
18: 230-244
[Abstract][Full Text]
Korber, B., Muldoon, M., Theiler, J., Gao, F., Gupta, R., Lapedes, A., Hahn, B. H., Wolinsky, S., Bhattacharya, T.
(2000). Timing the Ancestor of the HIV-1 Pandemic Strains. Science
288: 1789-1796
[Abstract][Full Text]
Clementi, M.
(2000). Quantitative Molecular Analysis of Virus Expression and Replication. J. Clin. Microbiol.
38: 2030-2036
[Full Text]
Kuster, H., Opravil, M., Ott, P., Schlaepfer, E., Fischer, M., Gunthard, H. F., Luthy, R., Weber, R., Cone, R. W.
(2000). Treatment-Induced Decline of Human Immunodeficiency Virus-1 p24 and HIV-1 RNA in Lymphoid Tissue of Patients with Early Human Immunodeficiency Virus-1 Infection. Am. J. Pathol.
156: 1973-1986
[Abstract][Full Text]
Sei, S., Yang, Q.-e., O'Neill, D., Yoshimura, K., Nagashima, K., Mitsuya, H.
(2000). Identification of a Key Target Sequence To Block Human Immunodeficiency Virus Type 1 Replication within the gag-pol Transframe Domain. J. Virol.
74: 4621-4633
[Abstract][Full Text]
A hypermutation of the human immunodeficiency virus type 1 genome: evidence for dCTP pool imbalance during reverse transcription. Proc Natl Acad Sci U S A 1994;91:3092-3096. 
