Background Infection with Bartonella quintana can cause trenchfever, endocarditis, bacillary angiomatosis, and peliosis. Anoutbreak of bacteremia due to B. quintana has been reportedamong homeless people in Seattle, and the seroprevalence ishigh among homeless people in both the United States and Europe.Body lice are known to be the vectors of B. quintana.
Methods We studied all the homeless people who presented in1997 to the emergency departments of the University Hospital,Marseilles, France. Blood was collected for microimmunofluorescencetesting for antibodies against B. quintana and for culture ofthe bacterium. Body lice were collected and analyzed by thepolymerase chain reaction and sequencing of a portion of thecitrate synthase gene of B. quintana.
Results In 10 of 71 homeless patients (14 percent), blood cultureswere positive for B. quintana, and 21 of the patients (30 percent)had high titers of antibody against the organism. A total of17 patients (24 percent) had evidence of recent infection (bacteremiaor seroconversion). Tests of lice from 3 of the 15 patientsfrom whom they were collected were positive for B. quintana.The homeless people with B. quintana bacteremia were more likelyto have been exposed to lice (P=0.002), were more likely tohave headaches (P=0.03) and severe leg pain (P<0.001), andhad lower platelet counts (P=0.006) than the homeless peoplewho were seronegative for B. quintana and did not have bacteremia;8 of the 10 patients with bacteremia were afebrile. Five patientshad chronic bacteremia, as indicated by positive blood culturesover a period of several weeks.
Conclusions In an outbreak of urban trench fever among homelesspeople in Marseilles, B. quintana infections were associatedwith body lice in patients with nonspecific symptoms or no symptoms.
Trench fever, the first reported clinical manifestation of infectionwith Bartonella quintana, was first recognized during WorldWar I, when it is estimated to have affected more than 1 millionpeople, with outbreaks reported in Russia and on the Europeanfronts.1 The disease was described as a five-day fever withclinical manifestations ranging from fever alone to seriousillness with severe headaches and leg pain. Body lice were shownto be the vector, and improvements in hygienic conditions haveprevented large outbreaks since that time. New manifestationsof infection with B. quintana were described in 1992 in patientswith bacillary angiomatosis who were infected with the humanimmunodeficiency virus (HIV).2 Since then, we and others haveshown that the organism may also cause endocarditis with bacteremia.3,4Homeless people and people with alcoholism are at risk for B.quintana infection. The reemergence of trench fever has beenconfirmed in Marseilles, France,5 in Seattle,6 in Baltimore(among injection-drug users),7 and in Burundi.8 However, thecurrent clinical spectrum of the disease and the vector involvedin urban trench fever have yet to be determined. After completinga two-year seroepidemiologic study in Marseilles, we investigatedB. quintana infections and their relation to lice among homelesspeople who presented to the emergency department.
Methods
Patients
From January 1 to December 31, 1997, we studied all the homelesspeople (people without a personal address) who presented tothe emergency departments of the University Hospital in Marseilles.Informed consent was provided by all patients. On initial presentationthey were given a full physical examination, and blood was collectedfor culture for B. quintana and serologic testing. An informationform with clinical and epidemiologic data was completed, andlice, if present, were collected. Routine laboratory tests,including serologic tests for HIV, were performed. If theirsymptoms warranted hospitalization, patients could be admitted.Patients who were discharged and who returned to the emergencydepartment were hospitalized if they were found to have bacteremiaor to have positive results on serologic testing for B. quintana.
All the hospitalized patients were examined by one of us, andadditional samples were collected for culture for B. quintanaand serial serologic tests. Hospitalized patients were thentreated with doxycycline at a dosage of 200 mg per day for 15days, except in the case of Patient 9, who had high antibodytiters and who was treated with doxycycline as well as gentamicin(3 mg per kilogram of body weight once per day) for 4 weeks.In patients with antibody titers greater than 1:400 (Patients7, 9, and 11), transesophageal echocardiography was performedto determine whether endocarditis was present. Persons who werenot homeless who presented to the emergency department wereused as control subjects and were matched for sex, age (withinfour years), clinical presentation, and date of presentation(within one week) with the homeless patients. For serologicstudies, an additional 250 serum samples were randomly obtainedfrom healthy blood donors.
Collection of Specimens and Isolation Procedures
Blood-culture bottles (Bactec Plus, Becton Dickinson DiagnosticInstrument Systems, Sparks, Md.) were used. If no bacterialgrowth was detected after 7 days, 1 ml of inoculated blood-culturebroth was plated onto sheep-blood agar plates (Columbia, Biomérieux,Marcy l'Etoile, France) and incubated for 45 days before theculture was deemed negative.9
Identification of Isolates
The polymerase chain reaction (PCR) was performed with the extractedDNA from agar-grown B. quintana (QIAmp Tissue Kit, Qiagen, Hilden,Germany) and primers CS 44310 and CS 979 (TGCATGATTTTTGCACGTGG),which permit the amplification of a citrate synthase (gltA)gene fragment (unpublished data). Sequencing of the PCR productwas carried out with the AmpliCycle sequencing kit (Perkin Elmer,Foster City, Calif.) and fluorescein-labeled forms of the aboveprimers. Molecular detection of B. quintana from lice was performedas reported elsewhere.8
Serologic Testing
Serum samples were tested for IgM and IgG by indirect immunofluorescenceassay. B. quintana Oklahoma, a reference strain (provided byD.F. Welch, University of Oklahoma, Oklahoma City), B. henselaeHouston (American Type Culture Collection 49882), and B. henselaeserotype Marseilles11 were used as described previously.12 Seroconversionwas considered to have occurred if a high titer (greater than1:100) was observed in a previously seronegative patient.
Results
Blood Cultures
A total of 186 blood samples, from 71 homeless people who presented120 times at emergency departments and of whom 46 were hospitalized,were cultured. Most of the blood cultures (112, or 60.2 percent)were prepared and tested between October 1 and December 31,1997 (Table 1); 36 cultures from 10 patients were positive forB. quintana, and 5 of these 10 patients had chronic bacteremia(Table 2). In the case of Patient 4, 11 of 19 blood cultureswere positive over a one-month period; in the case of Patient6, 5 of 8 blood cultures were positive over a two-week period;in the case of Patient 7, 2 of 7 blood cultures were positiveover a five-week period; in that of Patient 8, 4 of 7 bloodcultures were positive over a five-week period; and in thatof Patient 9, 7 of 10 blood cultures were positive over a six-weekperiod. The mean length of time required for isolation of thepathogen in culture was 24 days (range, 5 to 42 days), but 2of the 36 positive cultures were identified by the automatedblood-culture system in less than 7 days. None of the culturesof blood samples from the 31 control subjects were positive(P<0.02). No other important organisms were recovered fromblood culture.
Table 2. Results of Laboratory Tests in Patients with Evidence of B. quintana Infection.
Serologic Testing
Of the 134 serum samples tested from the 71 homeless patients,34 samples from 21 patients (30 percent) had positive resultson immunofluorescence assay for B. quintana, 3 had positiveresults for B. henselae Houston, and none had positive resultsfor B. henselae Marseilles. The three patients with positiveresults for B. henselae were those with B. quintana antibodytiters of up to 1:400. In 10 patients (14 percent), 4 of whomhad positive blood cultures, seroconversion was demonstrated.Altogether, 17 homeless patients had evidence of acute infection(bacteremia or seroconversion) during the year. The 31 controlpatients (P<0.001 for the comparison with homeless patients)and the 250 blood donors had negative titers (<1:100) ofantibodies to B. quintana. All the homeless patients and allthe control patients were seronegative for HIV.
Detection of B. quintana in Lice
Lice from 15 homeless patients were tested. In none of the licesamples were inhibitors of the PCR present. B. quintana DNAwas detected in lice from three homeless patients, of whom two(Patients 6 and 10) had bacteremia and one (Patient 11) wasseropositive but negative on blood culture. No DNA amplificationwas observed in uninfected control lice.
Patients
Clinical observations in 10 patients with bacteremia are summarizedin Table 3. To determine risk factors, patients were groupedaccording to the data collected (Table 4). Group A consistedof homeless patients with bacteremia; group B consisted of patientswithout bacteremia but with high titers of antibody againstB. quintana; group C combined groups A and B and consisted ofpatients who had been exposed to B. quintana, as shown by thepresence of bacteremia or reactive antibodies to B. quintana;and group D consisted of homeless people without bacteremiawho were seronegative for antibody against B. quintana. Amongthe 71 homeless people studied, blood cultures were positivefor B. quintana in 10 patients (14 percent). These patientswith bacteremia (group A) were more likely to have leg pain(P<0.001), headaches (P<0.03), thrombocytopenia (plateletcount, <150,000 per cubic millimeter) (P=0.006), and weremore frequently infested with body lice (P<0.002) than homelesspeople who were seronegative for B. quintana (group D). Comparisonof patients with bacteremia (group A) and patients with onlypositive serologic results (group B) demonstrated that leg pain(P=0.01) and thrombocytopenia (P=0.017) were more prevalentin patients with bacteremia. Only one patient described thetypical pain in the shin. For homeless people, the risk of exposureto B. quintana (i.e., of being in group C) is associated withthe presence of body lice (P=0.002).
Table 4. Epidemiologic, Clinical, and Laboratory Information for 71 Homeless and 31 Control Patients.
To evaluate the prevalence of nonspecific clinical signs associatedwith homelessness, we compared all the homeless patients (groupE in Table 4) to a control group of patients who were not homeless(group F), and to homeless patients without evidence of exposureto B. quintana (group D). Common among the homeless people (groupE) were headaches, leg pain, body lice, alcoholism, and theabsence of Achilles reflexes, and those among them who werehospitalized for leg pain were more likely to be infected withB. quintana. Acute bacteremic trench fever among the homelesspatients was associated with the presence of body lice, headaches,and thrombocytopenia, but not fever. Fever was also not significantlyassociated with the presence of antibodies against B. quintana.No cardiac vegetations were observed in the patients who underwentechocardiography (Patients 7, 9, and 11), and none of thosepatients have been hospitalized since for endocarditis.
Discussion
The various species of bartonella share common characteristics,such as the ability to cause chronic infections, especiallybacteremia, in their natural hosts13,14 and close associationwith their hosts' cells, especially erythrocytes.15,16 To date,humans are the only known hosts of B. quintana,17 but in ourstudy we found relatively few overt manifestations of B. quintanainfection in homeless people. The bacteremia was chronic infive of our patients, however, indicating that the infectioncan be chronic in humans, as is the case with B. henselae infectionin cats.
Primary isolation of bartonella from the blood of infected patients,which can be accomplished by a variety of techniques,3,4,18,19,20,21is difficult, and it may take up to 45 days before coloniesbecome apparent. In our study, an automated blood-culture systemproved to be highly effective, enabling us to isolate B. quintanafrom 10 of 71 homeless patients. Seropositivity for B. quintanawas clearly associated with homelessness: 21 of 71 homelesspatients (30 percent) had titers of antibody to B. quintanagreater than 1:100, whereas none of the 31 control patientsor 250 blood donors were seropositive. Seroconversion was observedin 10 of 21 of the homeless patients, and of these 10 patients,4 had a blood culture that was positive for the bacterium. Theseroprevalence of 30 percent is much higher than the 16 percentseroprevalence we reported previously5 and confirms the existenceof an outbreak in Marseilles.
The detection of B. quintana in lice from patients with bacteremiastrongly suggests that body lice play a part in the infectionof humans, as they did in trench fever under wartime conditions.22B. quintana infections in lice are thought to evolve over periodsas long as a year,1 so infestation of humans with infected licecannot be considered indicative of transmission of infection.Nevertheless, the persistence of bacteremia, as in Patients4, 6, 7, 8, and 9 in our study, probably facilitates the transmissionof B. quintana to other lice. In experimental infection, licemay become infected while feeding on patients with bacteremiaup to 76 days after the onset of disease.23 The use of techniquesbased on the PCR to detect pathogens in arthropod vectors hasbecome common,24 and we have used this approach to demonstratethe presence of Rickettsia prowazekii and B. quintana in licefrom patients with fever during an outbreak of epidemic typhusin Burundi.8 The PCR is rapid and is indicative of active infection,yielding positive results in 3 of 5 lice from recently or currentlyinfected patients as compared with 0 of 10 lice from uninfectedpatients (P<0.02).
Currently, our understanding of the epidemiology of B. quintanainfections is limited, although the occurrence of the diseaseis strongly associated with poor living conditions. In a previousstudy, we showed that the incidence of endocarditis due to B.quintana is significantly associated with homelessness and alcoholism.18Koehler et al.2 showed that there was a significant associationbetween the incidence of bacillary angiomatosis due to B. quintanaand the presence of lice and homelessness. Jackson et al.6 foundthat 20 percent of homeless people in Seattle had positive serologictests for B. quintana. Similarly, Comer et al.7 found that 33percent of people in Baltimore who abused intravenous drugshad antibodies to bartonella. Of 104 people who worked withlice in a laboratory, trench fever developed in 90, and of 14apparently healthy people, chronic bacteremia and low antibodytiters developed in 5.25
In early reports of trench fever, the outstanding features oftypical cases were the sudden onset of marked headaches, generalbody pain, polymorphonucleosis, and spiking, relapsing fevers.26,27In contrast to these observations, which were supported by thefindings of Spach et al.3 in Seattle, there was no significantassociation in our patients between febrile reactions and acutebacteremic trench fever or recent infection. In experimentalinfections in human volunteers, the incubation period of trenchfever was two to nine weeks23 and the clinical manifestationswere extremely variable, ranging from low-grade fever to typical,severe trench fever.
Our study has shown, however, that the absence of fever doesnot preclude the possibility of infection with B. quintana.Only 2 of 10 of our patients with bacteremia had fever (temperatureabove 38°C) when blood cultures were performed, and in allthese patients the febrile reaction may have had other causes,mainly tonsillitis and erysipelas. However, homeless peoplein Marseilles can present with typical manifestations of trenchfever,28 suggesting that the disease may have two main clinicalpresentations. The first is an acute form characterized by high-gradefever, leg pain, granulocytosis, and a rapid antibody response,whereas the second is chronic, without fever, and is characterizedby prolonged bacteremia and delayed antibody responses.
A chronic form of trench fever was described in early reportsof B. quintana infections. In an experimental model in whichthree volunteers were inoculated with B. quintana, two of thesubjects had no febrile reaction, seroconversion occurred inonly one, and all three had chronic bacteremia lasting 38 to76 days.23 Kostrzewski reported the isolation of B. quintanafrom the blood of people who had had trench fever up to eightyears previously.25 He studied a group of 39 patients who hadchronic bacteremia, 10 of whom had no clinical signs of infectionand, surprisingly, as in our study, 1 of whom had tonsillitis.
The natural history of B. quintana infection could be describedtentatively as follows. The bacteria are transmitted to peopleafter infestation by infected body lice. After inoculation withB. quintana, acute trench fever develops in some patients,26,28who also may have moderate titers of antibody to B. quintana.Other patients have a chronic infection, with clinical signsincluding chronic lymphadenopathy,20,29 and if the immune systemis compromised, especially in patients infected with HIV, bacillaryangiomatosis characterized by subcutaneous and lytic bone lesionswithout peliosis hepatis may develop.30 As previously observedin the United States3 and also as observed in our study, homelesspeople are at risk for chronic bacteremia associated with apaucity of clinical signs and, in particular, an absence offever. In the chronic forms of the disease, no antibody responsescan be detected, and the detection of low antibody titers seemsto indicate recovery. High antibody titers in chronically infectedpeople could be associated with the presence of endocarditis.4,18
We believe that B. quintana infections are far more prevalentthan is currently recognized. The potential for outbreaks ofother louse-borne infections, such as epidemic typhus and relapsingfever, cannot be ignored, and active surveillance programs shouldbe encouraged.
We are indebted to K. Barrau, V. Lafay, P. Jean, and L. Gwanzurafor their help in collecting data; to H. Tissot-Dupont for statisticaltesting; and to P. Kelly for reviewing the manuscript.
Source Information
From the Service des Maladies Infectieuses et Tropicales, Centre Hospitalier Universitaire Félix Houphouët-Boigny, Assistance PubliqueHôpitaux de Marseille (P.B.), and the Unité des Rickettsies, Centre National de la Recherche Sciéntifique, Unité Propre de Recherche de l'Enseignement Superieur Associé 6020, Faculté de Médecine (P.B., B.L., V.R., D.R.) both in Marseilles, France.
Address reprint requests to Dr. Raoult at the Unité des Rickettsies, CNRS UPRES A 6020, Faculté de Médecine, 27 Blvd. J Moulin, 13885 Marseilles, France, or at didier.raoult{at}medecine.univ-mrs.fr.
References
Maurin M, Raoult D. Bartonella (Rochalimaea) quintana infections. Clin Microbiol Rev 1996;9:273-292. [Free Full Text]
Koehler JE, Quinn FD, Berger TG, LeBoit PE, Tappero JW. Isolation of rochalimaea species from cutaneous and osseous lesions of bacillary angiomatosis. N Engl J Med 1992;327:1625-1631. [Abstract]
Spach DH, Kanter AS, Dougherty MJ, et al. Bartonella (Rochalimaea) quintana bacteremia in inner-city patients with chronic alcoholism. N Engl J Med 1995;332:424-428. [Free Full Text]
Drancourt M, Mainardi JL, Brouqui P, et al. Bartonella (Rochalimaea) quintana endocarditis in three homeless men. N Engl J Med 1995;332:419-423. [Free Full Text]
Brouqui P, Houpikian P, Dupont HT, et al. Survey of the seroprevalence of Bartonella quintana in homeless people. Clin Infect Dis 1996;23:756-759. [Medline]
Jackson LA, Spach DH, Kippen DA, et al. Seroprevalence to Bartonella quintana among patients at a community clinic in downtown Seattle. J Infect Dis 1996;173:1023-1026. [Medline]
Comer JA, Flynn C, Regnery RL, Vlahov D, Childs JE. Antibodies to Bartonella species in inner-city intravenous drug users in Baltimore, Md. Arch Intern Med 1996;156:2491-2495. [Free Full Text]
Raoult D, Ndihokubwayo JB, Tissot-Dupont H, et al. Outbreak of epidemic typhus associated with trench fever in Burundi. Lancet 1998;352:353-358. [CrossRef][Medline]
Brenner SA, Rooney JA, Manzewitsch P, Regnery RL. Isolation of Bartonella (Rochalimaea) henselae: effects of methods of blood collection and handling. J Clin Microbiol 1997;35:544-547. [Free Full Text]
Birtles RJ, Raoult D. Comparison of partial citrate synthase gene (gltA) sequences for phylogenetic analysis of Bartonella species. Int J Syst Bacteriol 1996;46:891-897. [Free Full Text]
Drancourt M, Birtles R, Chaumentin G, Vandenesch F, Etienne J, Raoult D. New serotype of Bartonella henselae in endocarditis and cat-scratch disease. Lancet 1996;347:441-443. [Erratum, Lancet 1996;347:842.] [CrossRef][Medline]
La Scola B, Raoult D. Serological cross-reactions between Bartonella quintana, Bartonella henselae, and Coxiella burnetii. J Clin Microbiol 1996;34:2270-2274. [Free Full Text]
Koehler JE, Glaser CA, Tappero JW. Rochalimaea henselae infection: a new zoonosis with the domestic cat as reservoir. JAMA 1994;271:531-535. [Free Full Text]
Chomel BB, Abbot RC, Kasten RW, et al. Bartonella henselae prevalence in domestic cats in California: risk factors and association between bacteremia and antibody titers. J Clin Microbiol 1995;33:2445-2450. [Free Full Text]
Kordick DL, Wilson KH, Sexton DJ, Hadfield TL, Berkhoff HA, Breitschwerdt EB. Prolonged Bartonella bacteremia in cats associated with cat-scratch disease patients. J Clin Microbiol 1995;33:3245-3251. [Free Full Text]
Kordick DL, Breitschwerdt EB. Intraerythrocytic presence of Bartonella henselae. J Clin Microbiol 1995;33:1655-1656. [Free Full Text]
Mooser H. The etiology of trench fever. In: Proceedings of the Sixth International Congresses on Tropical Medicine and Malaria. Vol. 5. Lisbon, Portugal: Instituto de Medicina Tropical, 1959:631-5.
Raoult D, Fournier PE, Drancourt M, et al. Diagnosis of 22 new cases of Bartonella endocarditis. Ann Intern Med 1996;125:646-652. [Erratum, Ann Intern Med 1997;127:249.] [Free Full Text]
Welch DF, Pickett DA, Slater LN, Steigerwalt AG, Brenner DJ. Rochalimaea henselae sp. nov., a cause of septicemia, bacillary angiomatosis, and parenchymal bacillary peliosis. J Clin Microbiol 1992;30:275-280. [Free Full Text]
Raoult D, Drancourt M, Carta A, Gastaut JA. Bartonella (Rochalimaea) quintana isolation in patient with chronic adenopathy, lymphopenia, and a cat. Lancet 1994;343:977-977. [CrossRef][Medline]
Larson AM, Dougherty MJ, Nowowiejski DJ, et al. Detection of Bartonella (Rochalimaea) quintana by routine acridine orange staining of broth blood cultures. J Clin Microbiol 1994;32:1492-1496. [Free Full Text]
Byam W, Carroll JH, Churchill JH, et al. Trench fever: a louse-borne disease. London: Oxford University Press, 1919.
Vinson JW, Varela G, Molina-Pasquel C. Trench fever. 3. Induction of clinical disease in volunteers inoculated with Rickettsia quintana propagated on blood agar. Am J Trop Med Hyg 1969;18:713-722.
Azad AF, Sacci JB Jr, Nelson WM, Dasch GA, Schmidtmann ET, Carl M. Genetic characterization and transovarial transmission of a typhus-like rickettsia found in cat fleas. Proc Natl Acad Sci U S A 1992;89:43-46. [Free Full Text]
Kostrzewski J. The epidemiology of trench fever. Bull Acad Polonaise Sci Lett Cl Med 1949;10:233-63.
Swift HF. Trench fever. Arch Intern Med 1920;26:76-98. [Free Full Text]
McNee JW, Renshaw A, Brunt EH. Trench fever: a relapsing fever occurring with the British forces in France. BMJ 1916;225:34-34.
Stein A, Raoult D. Return of trench fever. Lancet 1995;345:450-451. [Medline]
Drancourt M, Moal V, Brunet P, Dussol B, Berland Y, Raoult D. Bartonella (Rochalimaea) quintana infection in a seronegative hemodialyzed patient. J Clin Microbiol 1996;34:1158-1160. [Free Full Text]
Koehler JE, Sanchez MA, Garrido CS, et al. Molecular epidemiology of bartonella infections in patients with bacillary angiomatosis-peliosis. N Engl J Med 1997;337:1876-1883. [Free Full Text]
Liu, Q., Sun, J., Lu, L., Fu, G., Ding, G., Song, X., Meng, F., Wu, H., Yang, T., Ren, Z., Chen, E., Lin, J., Lv, H., Chai, C.
(2010). DETECTION OF BARTONELLA SPECIES IN SMALL MAMMALS FROM ZHEJIANG PROVINCE, CHINA. J Wildl Dis
46: 179-185
[Abstract][Full Text]
Badiaga, S., Richet, H., Azas, P., Zandotti, C., Rey, F., Charrel, R., Benabdelkader, E.-h., Drancourt, M., Raoult, D., Brouqui, P.
(2009). Contribution of a shelter-based survey for screening respiratory diseases in the homeless. Eur J Public Health
19: 157-160
[Abstract][Full Text]
MacKichan, J. K., Gerns, H. L., Chen, Y.-T., Zhang, P., Koehler, J. E.
(2008). A SacB Mutagenesis Strategy Reveals that the Bartonella quintana Variably Expressed Outer Membrane Proteins Are Required for Bloodstream Infection of the Host. Infect. Immun.
76: 788-795
[Abstract][Full Text]
Popa, C., Abdollahi-Roodsaz, S., Joosten, L. A. B., Takahashi, N., Sprong, T., Matera, G., Liberto, M. C., Foca, A., van Deuren, M., Kullberg, B. J., van den Berg, W. B., van der Meer, J. W. M., Netea, M. G.
(2007). Bartonella quintana Lipopolysaccharide Is a Natural Antagonist of Toll-Like Receptor 4. Infect. Immun.
75: 4831-4837
[Abstract][Full Text]
Schulte, B., Linke, D., Klumpp, S., Schaller, M., Riess, T., Autenrieth, I. B., Kempf, V. A. J.
(2006). Bartonella quintana Variably Expressed Outer Membrane Proteins Mediate Vascular Endothelial Growth Factor Secretion but Not Host Cell Adherence. Infect. Immun.
74: 5003-5013
[Abstract][Full Text]
HOUHAMDI, L., RAOULT, D.
(2006). EXPERIMENTALLY INFECTED HUMAN BODY LICE (PEDICULUS HUMANUS HUMANUS) AS VECTORS OF RICKETTSIA RICKETTSII AND RICKETTSIA CONORII IN A RABBIT MODEL. Am J Trop Med Hyg
74: 521-525
[Abstract][Full Text]
MARIE, J.-L., FOURNIER, P.-E., ROLAIN, J.-M., BRIOLANT, S., DAVOUST, B., RAOULT, D.
(2006). MOLECULAR DETECTION OF BARTONELLA QUINTANA, B. ELIZABETHAE, B. KOEHLERAE, B. DOSHIAE, B. TAYLORII, AND RICKETTSIA FELIS IN RODENT FLEAS COLLECTED IN KABUL, AFGHANISTAN.. Am J Trop Med Hyg
74: 436-439
[Abstract][Full Text]
Mandle, T., Einsele, H., Schaller, M., Neumann, D., Vogel, W., Autenrieth, I. B., Kempf, V. A. J.
(2005). Infection of human CD34+ progenitor cells with Bartonella henselae results in intraerythrocytic presence of B henselae. Blood
106: 1215-1222
[Abstract][Full Text]
Maggi, R. G., Duncan, A. W., Breitschwerdt, E. B.
(2005). Novel Chemically Modified Liquid Medium That Will Support the Growth of Seven Bartonella Species. J. Clin. Microbiol.
43: 2651-2655
[Abstract][Full Text]
BADIAGA, S., BROUQUI, P., RAOULT, D.
(2005). AUTOCHTHONOUS EPIDEMIC TYPHUS ASSOCIATED WITH BARTONELLA QUINTANA BACTEREMIA IN A HOMELESS PERSON. Am J Trop Med Hyg
72: 638-639
[Abstract][Full Text]
PONS, I., SANFELIU, I., QUESADA, M., ANTON, E., SAMPERE, M., FONT, B., PLA, J., SEGURA, F.
(2005). PREVALENCE OF BARTONELLA HENSELAE IN CATS IN CATALONIA, SPAIN. Am J Trop Med Hyg
72: 453-457
[Abstract][Full Text]
Maggi, R. G., Breitschwerdt, E. B.
(2005). Potential Limitations of the 16S-23S rRNA Intergenic Region for Molecular Detection of Bartonella Species. J. Clin. Microbiol.
43: 1171-1176
[Abstract][Full Text]
Foucault, C., La Scola, B., Lindroos, H., Andersson, S. G. E., Raoult, D.
(2005). Multispacer Typing Technique for Sequence-Based Typing of Bartonella quintana. J. Clin. Microbiol.
43: 41-48
[Abstract][Full Text]
Zhang, P., Chomel, B. B., Schau, M. K., Goo, J. S., Droz, S., Kelminson, K. L., George, S. S., Lerche, N. W., Koehler, J. E.
(2004). A family of variably expressed outer-membrane proteins (Vomp) mediates adhesion and autoaggregation in Bartonella quintana. Proc. Natl. Acad. Sci. USA
101: 13630-13635
[Abstract][Full Text]
Rolain, J. M., Brouqui, P., Koehler, J. E., Maguina, C., Dolan, M. J., Raoult, D.
(2004). Recommendations for Treatment of Human Infections Caused by Bartonella Species. Antimicrob. Agents Chemother.
48: 1921-1933
[Full Text]
Rolain, J.-M., Locatelli, C., Chabanne, L., Davoust, B., Raoult, D.
(2004). Prevalence of Bartonella clarridgeiae and Bartonella henselae in Domestic Cats from France and Detection of the Organisms in Erythrocytes by Immunofluorescence. CVI
11: 423-425
[Abstract][Full Text]
Breitschwerdt, E. B., Blann, K. R., Stebbins, M. E., Munana, K. R., Davidson, M. G., Jackson, H. A., Willard, M. D.
(2004). Clinicopathological Abnormalities and Treatment Response in 24 Dogs Seroreactive to Bartonella vinsonii (berkhoffii) Antigens. Journal of the American Animal Hospital Association
40: 92-101
[Abstract][Full Text]
Levy, P. Y., Fournier, P. E., Carta, M., Raoult, D.
(2003). Pericardial Effusion in a Homeless Man Due to Bartonella quintana. J. Clin. Microbiol.
41: 5291-5293
[Abstract][Full Text]
Foucault, C., Raoult, D., Brouqui, P.
(2003). Randomized Open Trial of Gentamicin and Doxycycline for Eradication of Bartonella quintana from Blood in Patients with Chronic Bacteremia. Antimicrob. Agents Chemother.
47: 2204-2207
[Abstract][Full Text]
Rolain, J. M., Gouriet, F., Enea, M., Aboud, M., Raoult, D.
(2003). Detection by Immunofluorescence Assay of Bartonella henselae in Lymph Nodes from Patients with Cat Scratch Disease. CVI
10: 686-691
[Abstract][Full Text]
Rolain, J.-M., Maurin, M., Mallet, M.-N., Parzy, D., Raoult, D.
(2003). Culture and Antibiotic Susceptibility of Bartonella quintana in Human Erythrocytes. Antimicrob. Agents Chemother.
47: 614-619
[Abstract][Full Text]
Houpikian, P., Raoult, D.
(2003). Western Immunoblotting for Bartonella Endocarditis. CVI
10: 95-102
[Abstract][Full Text]
Mexas, A. M., Hancock, S. I., Breitschwerdt, E. B.
(2002). Bartonella henselae and Bartonella elizabethae as Potential Canine Pathogens. J. Clin. Microbiol.
40: 4670-4674
[Abstract][Full Text]
GREUB, G., RAOULT, D.
(2002). Bartonella: new explanations for old diseases. J Med Microbiol
51: 915-923
[Full Text]
Maurin, M., Rolain, J. M., Raoult, D.
(2002). Comparison of In-House and Commercial Slides for Detection by Immunofluorescence of Immunoglobulins G and M against Bartonella henselae and Bartonella quintana. CVI
9: 1004-1009
[Abstract][Full Text]
La Scola, B., Liang, Z., Zeaiter, Z., Houpikian, P., Grimont, P. A. D., Raoult, D.
(2002). Genotypic Characteristics of Two Serotypes of Bartonella henselae. J. Clin. Microbiol.
40: 2002-2008
[Abstract][Full Text]
Jacomo, V., Kelly, P. J., Raoult, D.
(2002). Natural History of Bartonella Infections (an Exception to Koch's Postulate). CVI
9: 8-18
[Full Text]
Ciervo, A., Petrucca, A., Ciarrocchi, S., Pinto, A., Bonazzi, L., Fabio, A., Farnetti, E., Chomel, B. B., Ciceroni, L.
(2001). Molecular Characterization of First Human Bartonella Strain Isolated in Italy. J. Clin. Microbiol.
39: 4554-4557
[Abstract][Full Text]
Houpikian, P., Raoult, D.
(2001). 16S/23S rRNA Intergenic Spacer Regions for Phylogenetic Analysis, Identification, and Subtyping of Bartonella Species. J. Clin. Microbiol.
39: 2768-2778
[Abstract][Full Text]
Liang, Z., La Scola, B., Lepidi, H., Raoult, D.
(2001). Production of Bartonella Genus-Specific Monoclonal Antibodies. CVI
8: 847-849
[Abstract][Full Text]
Schulein, R., Seubert, A., Gille, C., Lanz, C., Hansmann, Y., Piemont, Y., Dehio, C.
(2001). Invasion and Persistent Intracellular Colonization of Erythrocytes: A Unique Parasitic Strategy of the Emerging Pathogen Bartonella. JEM
193: 1077-1086
[Abstract][Full Text]
La Scola, B., Fournier, P.-E., Brouqui, P., Raoult, D.
(2001). Detection and Culture of Bartonella quintana, Serratia marcescens, and Acinetobacter spp. from Decontaminated Human Body Lice. J. Clin. Microbiol.
39: 1707-1709
[Abstract][Full Text]
Fournier, P.-E., Minnick, M. F., Lepidi, H., Salvo, E., Raoult, D.
(2001). Experimental Model of Human Body Louse Infection Using Green Fluorescent Protein-Expressing Bartonella quintana. Infect. Immun.
69: 1876-1879
[Abstract][Full Text]
Bruneval, P, Choucair, J, Paraf, F, Casalta, J-P, Raoult, D, Scherchen, F, Mainardi, J-L
(2001). Detection of fastidious bacteria in cardiac valves in cases of blood culture negative endocarditis. J. Clin. Pathol.
54: 238-240
[Abstract][Full Text]
Renesto, P., Gouvernet, J., Drancourt, M., Roux, V., Raoult, D.
(2001). Use of rpoB Gene Analysis for Detection and Identification of Bartonella Species. J. Clin. Microbiol.
39: 430-437
[Abstract][Full Text]
Brouqui, P., Raoult, D.
(2001). Endocarditis Due to Rare and Fastidious Bacteria. Clin. Microbiol. Rev.
14: 177-207
[Abstract][Full Text]
Handley, S. A., Regnery, R. L.
(2000). Differentiation of Pathogenic Bartonella Species by Infrequent Restriction Site PCR. J. Clin. Microbiol.
38: 3010-3015
[Abstract][Full Text]
Liang, Z., Raoult, D.
(2000). Differentiation of Bartonella Species by a Microimmunofluorescence Assay, Sodium Dodecyl Sulfate-Polyacrylamide Gel Electrophoresis, and Western Immunoblotting. CVI
7: 617-624
[Abstract][Full Text]
Breitschwerdt, E. B., Kordick, D. L.
(2000). Bartonella Infection in Animals: Carriership, Reservoir Potential, Pathogenicity, and Zoonotic Potential for Human Infection. Clin. Microbiol. Rev.
13: 428-438
[Abstract][Full Text]
Ehrenborg, C., Wesslen, L., Jakobson, A., Friman, G., Holmberg, M.
(2000). Sequence Variation in the ftsZ Gene of Bartonella henselae Isolates and Clinical Samples. J. Clin. Microbiol.
38: 682-687
[Abstract][Full Text]
Liang, Z., Raoult, D.
(2000). Species-Specific Monoclonal Antibodies for Rapid Identification of Bartonella quintana. CVI
7: 21-24
[Abstract][Full Text]
Fenollar, F., Raoult, D.
(1999). Diagnosis of Rickettsial Diseases Using Samples Dried on Blotting Paper. CVI
6: 483-488
[Abstract][Full Text]
La Scola, B., Raoult, D.
(1999). Culture of Bartonella quintana and Bartonella henselae from Human Samples: a 5-Year Experience (1993 to 1998). J. Clin. Microbiol.
37: 1899-1905
[Abstract][Full Text]
(1999). Chronic Bartonellosis and Body Lice. JWatch Infect. Diseases
1999: 16-16
[Full Text]