Background Patients with idiopathic pulmonary fibrosis haveprogressive scarring of the lung and usually die within fourto five years after symptoms develop. Treatment with oral glucocorticoidsis often ineffective. We conducted an open, randomized trialof treatment with a combination of interferon gamma-1b, whichhas antifibrotic properties, and an oral glucocorticoid.
Methods We studied 18 patients with idiopathic pulmonary fibrosiswho had not had responses to glucocorticoids or other immunosuppressiveagents. Nine patients were treated for 12 months with oral prednisolonealone (7.5 mg daily, which could be increased to 25 to 50 mgdaily), and nine with a combination of 200 µg of interferongamma-1b (given three times per week subcutaneously) and 7.5mg of prednisolone (given once a day).
Results All the patients completed the study. Lung functiondeteriorated in all nine patients in the group given prednisolonealone: total lung capacity decreased from a mean (±SD)of 66±8 percent of the predicted value at base line to62±6 percent at 12 months. In contrast, in the groupreceiving interferon gamma-1b plus prednisolone, total lungcapacity increased (from 70±6 percent of the predictedvalue at base line to 79±12 percent at 12 months, P<0.001for the difference between the groups). In the group that receivedinterferon gamma-1b plus prednisolone, the partial pressureof arterial oxygen at rest increased from 65±9 mm Hgat base line to 76±8 mm Hg at 12 months, whereas in thegroup that received prednisolone alone it decreased from 65±6to 62±4 mm Hg (P<0.001 for the difference in the changefrom base-line values between the two groups); on maximal exertion,the value increased from 55±6 to 65±8 mm Hg inthe group that received combined treatment and decreased from55±6 mm Hg to 52±5 mm Hg in the group given prednisolonealone (P<0.001). The side effects of interferon gamma-1b,such as fever, chills, and muscle pain, subsided within thefirst 9 to 12 weeks.
Conclusions In a preliminary study, 12 months of treatment withinterferon gamma-1b plus prednisolone was associated with substantialimprovements in the condition of patients with idiopathic pulmonaryfibrosis who had had no response to glucocorticoids alone.
Idiopathic pulmonary fibrosis is characterized by a fibroproliferativeresponse with only minor signs of inflammation, and it almostalways causes rapid fibrotic destruction of the lung.1 Regardlessof treatment, the median survival is four to five years afterthe onset of symptoms.2 The standard treatment for idiopathicpulmonary fibrosis is oral glucocorticoids. However, lung functionimproves in less than 30 percent of patients who receive thistreatment.2
The proliferation of fibroblasts and the accumulation of interstitialcollagens are the hallmarks of progressive organ fibrosis.3In vitro studies have demonstrated that interferon- inhibitsthe proliferation of lung fibroblasts in a dose-dependent mannerand reduces the synthesis of protein in fibroblasts.4,5 Moreover,in a bleomycin-induced model of lung fibrosis, exogenous interferon-down-regulated the transcription of the gene for transforminggrowth factor ß1.6 This growth factor has been demonstratedto cause severe lung fibrosis in rats with adenovirus vector–mediatedoverexpression of the cytokine.7 It also has a major role incollagen synthesis as well as in the proliferation and activationof fibroblasts. In contrast to the immunomodulatory functionof transforming growth factor ß1, the effects of thisgrowth factor on the regulation of wound healing and fibrosisare mediated by the action of connective-tissue growth factor.8A study of various forms of pulmonary fibrosis, including idiopathicpulmonary fibrosis, has indicated that there may be a generalimpairment of the production of interferon- in patients withpulmonary fibrosis.9 In addition, another study reported thattreatment of progressive pulmonary fibrosis with interferongamma-1b was effective in patients who had idiopathic pulmonaryfibrosis, scleroderma, or sarcoidosis that was resistant tothree months of treatment with high doses of glucocorticoids.10
On the basis of these observations and the slow turnover rateof connective tissue, we hypothesized that 12 months of treatmentwith interferon gamma-1b, in combination with prednisolone ata dose that does not affect the clinical course of idiopathicpulmonary fibrosis when given alone, would slow or even stopthe progression of disease.
Methods
Patients were eligible for the study if they had histologicallyverified idiopathic pulmonary fibrosis and if they had had adecrease in lung function of at least 10 percent during the12 months before the study began, despite continuous or repeatedtreatment with glucocorticoids, other immunosuppressive agents,or both for at least 6 of the 12 months. The main histopathologicalfeature used to identify idiopathic pulmonary fibrosis was thepresence of subpleural and periacinar fibrotic lesions, withonly minor cellular infiltration. The absence of bilateral patchyinfiltrates on high-resolution computed tomography and the demonstrationof a predominantly peripheral distribution of lesions were theradiologic criteria for identifying the disease. Patients witha history of exposure to organic or inorganic dust or drugsknown to cause pulmonary fibrosis and those with connective-tissuediseases or other chronic lung diseases causing pulmonary fibrosiswere excluded. Patients with end-stage idiopathic pulmonaryfibrosis, as identified on the basis of a total lung capacityof less than 45 percent of the predicted normal value, werealso excluded.
The study was conducted between May 1996 and February 1998.The protocol was approved by the ethics committee of the Universityof Vienna Medical School, and all the patients provided writteninformed consent. The patients were initially treated with 50mg of oral prednisolone per day for 4 weeks, with subsequenttapering of the dose to 10 mg per day over a 14-day period,regardless of any previous treatment. Complete lung-functiontests were performed after the initial four-week period in combinationwith high-resolution computed tomography. After obtaining additionalwritten consent from the patients, we performed fiberoptic bronchoscopyand obtained specimens of the lung during peripheral transbronchialbiopsy for the assessment of gene transcription.
If the additional glucocorticoid treatment was ineffective,the patients were randomly assigned to receive either 200 µgof interferon gamma-1b (Imukin, Boehringer Ingelheim, Vienna,Austria) subcutaneously three times per week plus 7.5 mg oforal prednisolone daily for 12 months or 7.5 mg of oral prednisoloneper day alone for 12 months. In the group of patients who wereassigned to receive prednisolone alone, the dose could be increasedto 25 to 50 mg per day in patients who had deterioration oflung function or worsening symptoms. Lung function was measuredat base line and after 3, 6, 9, and 12 months of treatment.Forced vital capacity, total lung capacity, and arterial-bloodgases were measured in patients at rest and after maximal exertionto assess lung function, since these measurements correlatewell with the extent of lung fibrosis.11 Predicted normal valueswere derived from the reference values of the Austrian Societyof Pulmonary Medicine.12 Each value represents the best of atleast two measurements. Spirometry and body plethysmographywere performed with the Autobox DL 6200 (SensorMedics, Vienna,Austria), and blood gas pressure was measured with a gas analyzer(model ABL 510, Radiometer, Copenhagen, Denmark).
For the assessment of the transcription of the genes for transforminggrowth factor ß1, connective-tissue growth factor,and interferon-, three transbronchial-biopsy specimens wereobtained from the same lung segment before and after six monthsof therapy. Approximately 1 µg of complementary DNA wasused for semiquantitative analysis by the reverse-transcriptionpolymerase chain reaction (RT-PCR). The constitutive controlwas glyceraldehyde-3-phosphate dehydrogenase. We amplified thegenes using the following primers: 5'GCCCTGGACACCAACTATTGC3'(sense) and 5'AGGCTCCAAATGTAGGGGCAG3' (antisense) for transforminggrowth factor ß1, 5'CCGACTGGAAGACACGTTTGG3' (sense)and 5'TCATGCCATGTCTCCGTACATCTT3' (antisense) for connective-tissuegrowth factor, and 5'GCATCGTTTTGGGTTCTCTTGGCTGTTACTGC3' (sense)and 5'CTCCTTTTTCGCTTCCCTGTTTTAGCTGCTGG3' (antisense) for interferon-.The specificity of the RT-PCR products was controlled by Southernblot hybridization. The RT-PCR assay was carried out in a totalvolume of 50 µl. Thirty cycles of a hot-start PCR assaywere performed on a Perkin–Elmer thermal cycler (model480, Perkin–Elmer, Norwalk, Conn.). Aliquots were separatedby electrophoresis on a NuSieve GTG agarose gel (FMC BioProducts,Rockland, Me.) and visualized with Vistagreen (Amersham International,Buckinghamshire, United Kingdom).
Analysis of variance was used to compare the mean changes invalues from base line to 12 months in the two treatment groups.The data were analyzed descriptively with Report (version 6.0.08,IDV, Munich, Germany) and statistically with Testimate (version5.2a, IDV).13 The model was interpreted only in the case ofa nonsignificant result according to Bartlett's test for homogeneityof variance. We used the Wilcoxon rank-sum test of variancefor the statistical evaluation of the results of the gene-transcriptionanalysis. All reported P values are two-sided.
Results
We screened 22 patients for the study and excluded 4 becausethey had end-stage pulmonary fibrosis. All 18 patients initiallyreceived 50 mg of oral prednisolone daily for four weeks, andnone had a response to this treatment.
Thus, we enrolled 18 patients (17 men and 1 woman, 9 patientsin each group). The main symptom related to their lung diseaseat the time of enrollment was breathlessness on exertion orat rest. None of the patients had clinically significant heartdisease. There were no significant differences between the groupsat base line (Table 1). All patients completed the study.
Table 1. Base-Line Characteristics of the Patients.
During the 1-year study period, total lung capacity decreased,though not significantly, in all nine patients in the groupgiven prednisolone alone, from a mean (±SD) of 66±8percent of the predicted value at base line to 62±6 percentat 12 months (Figure 1A). In contrast, ventilation and gas exchangeimproved significantly in the patients receiving the combinationof interferon gamma-1b and prednisolone. In this group, totallung capacity rose from a mean of 70±10 percent of thepredicted value at base line to 79±12 percent at 12 months(Figure 1A). In other words, the patients receiving prednisolonealone had an absolute decrease in total lung capacity of 4 percent,whereas the group receiving interferon gamma-1b plus prednisolonehad an absolute increase in total lung capacity of 9 percent(P<0.001). The results were similar for the changes in forcedvital capacity (data not shown). The increase in forced vitalcapacity and total lung capacity usually started after threemonths of treatment and was most pronounced over the next threeto six months (data not shown).
Figure 1. Total Lung Capacity and Partial Pressure of Oxygen before and after One Year of Treatment with Prednisolone Alone or in Combination with Interferon Gamma-1b.
Total lung capacity (Panel A) was measured after the initial four weeks of high-dose prednisolone treatment and before (Day 0) and after one year of treatment. Treatment with prednisolone alone did not significantly affect total lung capacity, whereas the combination of interferon gamma-1b and prednisolone significantly improved it. In contrast with the deterioration in the partial pressure of arterial oxygen at rest (Panel B) and on maximal exertion (Panel C) in the group that received prednisolone alone, pulmonary gas exchange improved significantly in the group that received interferon gamma-1b plus prednisolone. In each panel, individual values for the 18 patients and the mean (±SD) value for each group are shown. For each comparison, P<0.001 for the difference in the change from base-line values between the two groups.
In the group that received interferon gamma-1b plus prednisolone,the partial pressure of arterial oxygen at rest increased from64±9 mm Hg at base line to 76±8 mm Hg at 12 months,whereas in the group that received prednisolone alone it decreasedfrom 65±6 to 62±4 mm Hg (P<0.001 for the differencein the change from base-line values between the two groups)(Figure 1B). On maximal exertion, the partial pressure of arterialoxygen increased from 55±6 mm Hg at base line to 65±8mm Hg at 12 months in the group that received interferon gamma-1bplus prednisolone and decreased from 55±6 mm Hg to 52±5mm Hg in the group given prednisolone alone (P<0.001) (Figure 1C).There was a similar increase in the carbon monoxide diffusingcapacity (data not shown) among the patients receiving interferongamma-1b plus prednisolone.
As of July 1999, all patients in the study were alive. After12 months of treatment with interferon gamma-1b and prednisolone,only one of the three patients who initially required supplementaloxygen was still receiving it. After 12 months of treatmentwith prednisolone alone, four patients needed supplemental oxygen,as compared with two at base line. After 12 months, all ninepatients in the group given prednisolone alone were still breathlesson exertion, as compared with only one patient in the groupgiven interferon gamma-1b and prednisolone. All patients receivinginterferon gamma-1b and prednisolone reported an improved abilityto perform the activities of daily living. However, changesin the quality of life were not formally evaluated.
In an evaluation of the in vivo level of transcription of thegenes for transforming growth factor ß1, connective-tissuegrowth factor, and interferon- by RT-PCR, we found strikingdifferences before and after six months of therapy with interferongamma-1b plus prednisolone. Figure 2 shows the results of semiquantitativeRT-PCR analysis of the transcription of transforming growthfactor ß1 and connective-tissue growth factor in twopatients before and after six months of therapy. Figure 3 showsthe PCR results obtained after the initial four-week periodof treatment with prednisolone but before random assignmentto subsequent treatment in all 18 patients, and after six monthsof treatment in the 9 patients in the group receiving interferongamma-1b plus prednisolone, and in 4 patients in the group givenprednisolone alone who underwent a second bronchoscopy. Afterthe initial treatment with prednisolone, all the patients hadlevels of transcription of the genes for transforming growthfactor ß1 and connective-tissue growth factor thatwere approximately seven times and four times as high, respectively,as those in six normal subjects, and no transcription of thegene for interferon- could be detected. After six months oftherapy, levels of transcription of the gene for transforminggrowth factor ß1 and connective-tissue growth factordecreased significantly only in the group given interferon gamma-1bplus prednisolone (P=0.004 for both).
Figure 2. Semiquantitative Assessment of the Transcription of the Genes for Transforming Growth Factor ß1 (TGF-ß1) and Connective-Tissue Growth Factor (CTGF) by the Reverse-Transcriptase–Polymerase-Chain-Reaction (RT-PCR) Assay in Two Representative Patients before and after Six Months of Therapy with Interferon Gamma-1b plus Prednisolone.
Three transbronchial-biopsy specimens were obtained from identical lung segments before (lanes 2, 3, 6, and 7) and after (lanes 4, 5, 8, and 9) six months of treatment. PolyA RNA was isolated from a pooled mixture of the three specimens, and the RT-PCR assay was performed to detect transcription of the genes for TGF-ß1 and CTGF. The amplification products of TGF-ß1 and CTGF were 161 bp and 505 bp, respectively, with the amplification product of glyceraldehyde-3-phosphate dehydrogenase (G3PDH, 983 bp) serving as the internal RNA standard. Lane 1 shows the molecular-size marker.
Figure 3. Mean (±SD) Level of Transcription of the Genes for Transforming Growth Factor ß1 (TGF-ß1), Connective-Tissue Growth Factor (CTGF), and Interferon Gamma-1b (IFN-) before and after Six Months of Treatment.
Data are shown for all 18 patients before therapy (Panel A), for all 9 patients receiving treatment with interferon gamma-1b plus prednisolone (Panel B), and for 4 patients treated with prednisolone alone (Panel C). Analysis was performed on a Fluorlmager (model 595, Molecular Dynamics, Krefeld, Germany) with ImageQuant software (version 4.2a, Build 13, Molecular Dynamics). Values were compared with those in six normal subjects and are expressed as the number of times above the normal induction value. As compared with the normal levels, the levels of transcription of the genes for TGF-ß1 and CTGF were approximately seven times and four times as high, respectively, in all 18 patients with idiopathic pulmonary fibrosis before treatment. After six months of treatment, the levels of transcription of both genes were significantly diminished (P=0.004) only in the group given interferon gamma-1b plus prednisolone. Transcription of the gene for interferon- was virtually absent in all patients before treatment.
During the first two to three weeks of treatment with interferongamma-1b plus prednisolone, all nine patients had fever andchills of variable severity, and three had bone and muscle pain.Two patients reported brief, migraine-like headaches. All sideeffects subsided within the first 9 to 12 weeks of treatment.Fever and chills recurred after an interval of more than threemonths in two patients with respiratory tract infections. Thesymptoms resolved within 24 hours after treatment with interferongamma-1b was discontinued. Treatment with interferon gamma-1bwas resumed after two weeks, with no further adverse effects.Repeated laboratory tests showed mild lymphopenia in three patients(1400±500 cells per cubic millimeter; normal range, 1000to 4000 cells per cubic millimeter). To rule out the possibilitythat interferon gamma-1b might induce autoimmune disorders,we performed tests for antinuclear antibodies and immune complexesand measured complement activity. However, no elevation of thesemarkers was detected in any of the patients. The main side effectsamong those who received prednisolone alone were hyperglycemiain three patients, weight gain and skin changes in all patients,and aseptic necrosis of the femur in one patient.
Discussion
In a preliminary study, we found that one year of treatmentwith interferon gamma-1b plus low-dose prednisolone was associatedwith substantial improvement of pulmonary ventilation and gasexchange in patients with idiopathic pulmonary fibrosis whohad not had a response to glucocorticoids. A larger study isnow required to determine whether our results can be confirmed.
Molecular assessment of lung tissue from our patients showeda nearly complete lack of interferon-, with levels of transcriptionof the genes for transforming growth factor ß1 andconnective-tissue growth factor that far exceeded the levelsin normal tissue. This finding confirms the observation of intenseimmunohistochemical staining for transforming growth factorß1 in lung tissue from patients with idiopathic pulmonaryfibrosis.14 Our additional finding of a high level of in vivoexpression of both genes supports the idea that connective-tissuegrowth factor is one of the main mediators of transforming growthfactor ß1 during the development of fibrotic lesions.In vitro studies have shown that interferon- decreased the synthesisof both collagen I and III15 and of transforming growth factorß1.6 Moreover, a reduced level of transcription ofthe gene for transforming growth factor ß1 by adenovirusvector–mediated overexpression of the extracellular-matrixprotein proteoglycan decorin resulted in a significant reductionof scarring in a rat model of glomerulosclerosis.16
The improvement of lung function resulting from treatment withinterferon gamma-1b in patients with idiopathic pulmonary fibrosis,in combination with a significantly reduced level of transcriptionof the genes for transforming growth factor ß1 andconnective-tissue growth factor, provides important supportfor the hypothesis that mesenchymal activation in patients withlung fibrosis depends, at least in part, on the overexpressionof the genes for transforming growth factor ß1 andconnective-tissue growth factor. Moreover, these data suggestthat the mesenchymal activation in patients with idiopathicpulmonary fibrosis corresponds with a low level of transcriptionof interferon-. In view of the well-documented immunosuppressiveefficacy of transforming growth factor ß1,17,18,19including the inhibition of the release of interferon-20 andthe suppression of interferon-–dependent immune reactions,21it is possible that mesenchymal activation during chronic inflammationcould lead to an acquired deficiency of interferon-. This viewis strongly supported by the reciprocal effects of interferon-and transforming growth factor ß1 on mucosal inflammationof the intestine.22 Thus, interferon- may have a counterbalancingeffect on transforming growth factor ß1–dependentactivation of mesenchymal tissues.
Supported by the Austrian Ministry of Health.
We are indebted to all the participating physicians and personnelof the Department of Pulmonary Medicine for their help in conductingthis study.
Source Information
From the Department of Internal Medicine IV, Division of Pulmonary Medicine, University of Vienna Medical School, Vienna, Austria.
Address reprint requests to Dr. Block at the University of Vienna Medical School, Wahringer Gurtel 18-10, A-1090 Vienna, Austria, or at lutz-henning.block{at}akh-wein.ac.at.
References
Ryu JH, Colby TV, Hartman TE. Idiopathic pulmonary fibrosis: current concepts. Mayo Clin Proc 1998;73:1085-1101. [Medline]
Tukiainen P, Taskinen E, Holsti P, Korhola O, Valle M. Prognosis of cryptogenic fibrosing alveolitis. Thorax 1983;38:349-355. [Abstract]
Specks U, Nerlich A, Colby TV, Wiest I, Timpl R. Increased expression of type VI collagen in lung fibrosis. Am J Respir Crit Care Med 1995;15:1956-1964.
Elias JA, Freundlich B, Kern JA, Rosenbloom J. Cytokine networks in the regulation of inflammation and fibrosis in the lung. Chest 1990;97:1439-1445. [Free Full Text]
Bienkowski RS, Gotkin MG. Control of collagen deposition in mammalian lung. Proc Soc Exp Biol Med 1995;209:118-140. [Abstract]
Gurujeyalakshmi G, Giri SN. Molecular mechanisms of antifibrotic effect of interferon gamma in bleomycin-mouse model of lung fibrosis: downregulation of TGF-ß and procollagen I and III gene expression. Exp Lung Res 1995;21:791-808. [Medline]
Sime PJ, Xing Z, Graham FL, Csaky KG, Gauldie J. Adenovector-mediated gene transfer of active transforming growth factor ß1 induces prolonged severe fibrosis in rat lung. J Clin Invest 1997;100:768-776. [Medline]
Grotendorst GR. Connective tissue growth factor: a mediator of TGF-beta action on fibroblasts. Cytokine Growth Factor Rev 1997;8:171-179. [CrossRef][Medline]
Prior C, Haslam PL. In vivo levels and in vitro production of interferon-gamma in fibrosing interstitial lung diseases. Clin Exp Immunol 1992;88:280-287. [Medline]
Ziesche R, Kink E, Herold C, Podolsky A, Block LH. Therapy of chronic interstitial lung disease with a combination of interferon- and low-dose prednisolone. Chest 1996;110:Suppl:25S-25S.abstract
Watters LC, King TE, Schwarz MI, Waldron JA, Stanford RE, Cherniack RM. A clinical, radiographic, and physiologic scoring system for the longitudinal assessment of patients with idiopathic pulmonary fibrosis. Am Rev Respir Dis 1986;133:97-103. [Medline]
Harnoncourt K, Feldner H, Forche G, et al. Die Standardisierung der Lungenfunktionsdiagnostik. Osterreich Arzteztg 1982;37:1640-2.
IDV — data analysis and study planning: Testimate 5.2a. Report 6.0.08. Munich, Germany: Wessobrunner, 1998.
Broekelmann TJ, Limper AH, Colby TV, McDonald JA. Transforming growth factor beta 1 is present at sites of extracellular matrix gene expression in human pulmonary fibrosis. Proc Natl Acad Sci U S A 1991;88:6642-6646. [Free Full Text]
Isaka Y, Brees DK, Ikegaya K, et al. Gene therapy by skeletal muscle expression of decorin prevents fibrotic disease in rat kidney. Nat Med 1996;2:418-423. [CrossRef][Medline]
Qin L, Ding Y, Bromberg JS. Gene transfer of transforming growth factor-beta 1 prolongs murine cardiac allograft survival by inhibiting cell-mediated immunity. Hum Gene Ther 1996;7:1981-1988. [Medline]
Gilbert KM, Thoman M, Bauche K, Pham T, Weigle WO. Transforming growth factor-beta 1 induces antigen-specific unresponsiveness in naive T cells. Immunol Invest 1997;26:459-472. [Medline]
Lawrence DA. Transforming growth factor-beta: a general review. Eur Cytokine Netw 1996;7:363-374. [Medline]
Naganuma H, Sasaki A, Satoh E, et al. Transforming growth factor-beta inhibits interferon-gamma secretion by lymphokine-activated killer cells stimulated with tumor cells. Neurol Med Chir (Tokyo) 1996;36:789-795. [Medline]
Lee YJ, Han Y, Lu HT, et al. TGF-beta suppresses IFN-gamma induction of class II MHC gene expression by inhibiting class II transactivator messenger RNA expression. J Immunol 1997;158:2065-2075. [Abstract]
Strober W, Kelsall B, Fuss I, et al. Reciprocal IFN-gamma and TGF-beta responses regulate the occurrence of mucosal inflammation. Immunol Today 1997;18:61-64. [CrossRef][Medline]
Kim, R., Meyer, K. C.
(2008). Review: Therapies for interstitial lung disease: past, present and future. Therapeutic Advances in Respiratory Disease
2: 319-338
[Abstract]
Wells, A U, Hirani, N, on behalf of the BTS Interstitial Lung Disease Gui,
(2008). Interstitial lung disease guideline. Thorax
63: v1-v58
[Full Text]
Laurent, G. J., McAnulty, R. J., Hill, M., Chambers, R.
(2008). Escape from the Matrix: Multiple Mechanisms for Fibroblast Activation in Pulmonary Fibrosis. Proc Am Thorac Soc
5: 311-315
[Abstract][Full Text]
Schwartz, D. A.
(2008). Genetic Analysis of Sporadic and Familial Interstitial Pneumonia. Proc Am Thorac Soc
5: 343-347
[Abstract][Full Text]
Rogliani, P., Mura, M., Assunta Porretta, M., Saltini, C.
(2008). Review: New perspectives in the treatment of idiopathic pulmonary fibrosis. Therapeutic Advances in Respiratory Disease
2: 75-93
[Abstract]
Clement, A., Eber, E.
(2008). Interstitial lung diseases in infants and children. Eur Respir J
31: 658-666
[Abstract][Full Text]
Williams, T J, Wilson, J W
(2008). Challenges in pulmonary fibrosis: 7 {middle dot} Novel therapies and lung transplantation. Thorax
63: 277-284
[Abstract][Full Text]
Raymond, T., Schaller, M., Hogaboam, C. M., Lukacs, N. W., Rochford, R., Kunkel, S. L.
(2007). Toll-like Receptors, Notch Ligands, and Cytokines Drive the Chronicity of Lung Inflammation. Proc Am Thorac Soc
4: 635-641
[Abstract][Full Text]
Scotton, C. J., Chambers, R. C.
(2007). Molecular Targets in Pulmonary Fibrosis: The Myofibroblast in Focus. Chest
132: 1311-1321
[Abstract][Full Text]
Cooker, L. A., Peterson, D., Rambow, J., Riser, M. L., Riser, R. E., Najmabadi, F., Brigstock, D., Riser, B. L.
(2007). TNF-{alpha}, but not IFN-{gamma}, regulates CCN2 (CTGF), collagen type I, and proliferation in mesangial cells: possible roles in the progression of renal fibrosis. Am. J. Physiol. Renal Physiol.
293: F157-F165
[Abstract][Full Text]
Gunther, A., Enke, B., Markart, P., Hammerl, P., Morr, H., Behr, J., Stahler, G., Seeger, W., Grimminger, F., Leconte, I., Roux, S., Ghofrani, H-A.
(2007). Safety and tolerability of bosentan in idiopathic pulmonary fibrosis: an open label study. Eur Respir J
29: 713-719
[Abstract][Full Text]
Rudd, R. M, Prescott, R. J, Chalmers, J C, Johnston, I. D A, for the Fibrosing Alveolitis Subcommittee of the R,
(2007). British Thoracic Society Study on cryptogenic fibrosing alveolitis: response to treatment and survival. Thorax
62: 62-66
[Abstract][Full Text]
Raghu, G.
(2006). Idiopathic pulmonary fibrosis: treatment options in pursuit of evidence-based approaches.. Eur Respir J
28: 463-465
[Full Text]
Antoniou, K. M., Nicholson, A. G., Dimadi, M., Malagari, K., Latsi, P., Rapti, A., Tzanakis, N., Trigidou, R., Polychronopoulos, V., Bouros, D.
(2006). Long-term clinical effects of interferon gamma-1b and colchicine in idiopathic pulmonary fibrosis. Eur Respir J
28: 496-504
[Abstract][Full Text]
Lee, C. G., Kang, H.-R., Homer, R. J., Chupp, G., Elias, J. A.
(2006). Transgenic Modeling of Transforming Growth Factor-{beta}1: Role of Apoptosis in Fibrosis and Alveolar Remodeling.. Proc Am Thorac Soc
3: 418-423
[Abstract][Full Text]
Giannopoulou, M., Iszkula, S. C., Dai, C., Tan, X., Yang, J., Michalopoulos, G. K., Liu, Y.
(2006). Distinctive role of Stat3 and Erk-1/2 activation in mediating interferon-{gamma} inhibition of TGF-beta1 action. Am. J. Physiol. Renal Physiol.
290: F1234-F1240
[Abstract][Full Text]
Weinberger, S. E.
(2006). Update in pulmonary medicine.. ANN INTERN MED
144: 358-363
[Full Text]
Frankel, S. K., Cosgrove, G. P., Cha, S.-I., Cool, C. D., Wynes, M. W., Edelman, B. L., Brown, K. K., Riches, D. W. H.
(2006). TNF-{alpha} Sensitizes Normal and Fibrotic Human Lung Fibroblasts to Fas-Induced Apoptosis. Am. J. Respir. Cell Mol. Bio.
34: 293-304
[Abstract][Full Text]
Martinez, F. J.
(2006). Acute Exacerbations in Idiopathic Pulmonary Fibrosis. ANN INTERN MED
144: 218-219
[Full Text]
Walter, N., Collard, H. R., King, T. E. Jr.
(2006). Current perspectives on the treatment of idiopathic pulmonary fibrosis.. Proc Am Thorac Soc
3: 330-338
[Abstract][Full Text]
Ask, K., Martin, G. E. M., Kolb, M., Gauldie, J.
(2006). Targeting genes for treatment in idiopathic pulmonary fibrosis: challenges and opportunities, promises and pitfalls.. Proc Am Thorac Soc
3: 389-393
[Abstract][Full Text]
Demedts, M., Behr, J., Buhl, R., Costabel, U., Dekhuijzen, R., Jansen, H. M., MacNee, W., Thomeer, M., Wallaert, B., Laurent, F., Nicholson, A. G., Verbeken, E. K., Verschakelen, J., Flower, C. D.R., Capron, F., Petruzzelli, S., De Vuyst, P., van den Bosch, J. M.M., Rodriguez-Becerra, E., Corvasce, G., Lankhorst, I., Sardina, M., Montanari, M., the IFIGENIA Study Group,
(2005). High-Dose Acetylcysteine in Idiopathic Pulmonary Fibrosis.. NEJM
353: 2229-2242
[Abstract][Full Text]
Doran, P., Egan, J. J.
(2005). Herpesviruses: a cofactor in the pathogenesis of idiopathic pulmonary fibrosis?. Am. J. Physiol. Lung Cell. Mol. Physiol.
289: L709-L710
[Full Text]
Walters, D. M., Antao-Menezes, A., Ingram, J. L., Rice, A. B., Nyska, A., Tani, Y., Kleeberger, S. R., Bonner, J. C.
(2005). Susceptibility of Signal Transducer and Activator of Transcription-1-Deficient Mice to Pulmonary Fibrogenesis. Am. J. Pathol.
167: 1221-1229
[Abstract][Full Text]
Mora, A. L., Woods, C. R., Garcia, A., Xu, J., Rojas, M., Speck, S. H., Roman, J., Brigham, K. L., Stecenko, A. A.
(2005). Lung infection with {gamma}-herpesvirus induces progressive pulmonary fibrosis in Th2-biased mice. Am. J. Physiol. Lung Cell. Mol. Physiol.
289: L711-L721
[Abstract][Full Text]
Nathan, S. D.
(2005). Therapeutic Intervention: Assessing the Role of the International Consensus Guidelines. Chest
128: 533S-539S
[Abstract][Full Text]
Bouros, D., Antoniou, K. M.
(2005). Current and future therapeutic approaches in idiopathic pulmonary fibrosis. Eur Respir J
26: 693-703
[Abstract][Full Text]
Tiitto, L., Heiskanen, U., Bloigu, R., Paakko, P., Kinnula, V., Kaarteenaho-Wiik, R.
(2005). Thoracoscopic Lung Biopsy Is a Safe Procedure in Diagnosing Usual Interstitial Pneumonia. Chest
128: 2375-2380
[Abstract][Full Text]
Pacanowski, M. A, Amsden, G. W
(2005). Interferon Gamma-1b in the Treatment of Idiopathic Pulmonary Fibrosis. The Annals of Pharmacotherapy
39: 1678-1686
[Abstract][Full Text]
Bajwa, E. K., Ayas, N. T., Schulzer, M., Mak, E., Ryu, J. H., Malhotra, A.
(2005). Interferon-{gamma}1b Therapy in Idiopathic Pulmonary Fibrosis: A Metaanalysis. Chest
128: 203-206
[Abstract][Full Text]
Halkos, M. E., Gal, A. A., Kerendi, F., Miller, D. L., Miller, J. I. Jr
(2005). Role of Thoracic Surgeons in the Diagnosis of Idiopathic Interstitial Lung Disease. Ann. Thorac. Surg.
79: 2172-2179
[Abstract][Full Text]
Gharaee-Kermani, M., Hatano, K., Nozaki, Y., Phan, S. H.
(2005). Gender-Based Differences in Bleomycin-Induced Pulmonary Fibrosis. Am. J. Pathol.
166: 1593-1606
[Abstract][Full Text]
Willis, B. C., Liebler, J. M., Luby-Phelps, K., Nicholson, A. G., Crandall, E. D., du Bois, R. M., Borok, Z.
(2005). Induction of Epithelial-Mesenchymal Transition in Alveolar Epithelial Cells by Transforming Growth Factor-{beta}1: Potential Role in Idiopathic Pulmonary Fibrosis. Am. J. Pathol.
166: 1321-1332
[Abstract][Full Text]
Bonniaud, P., Margetts, P. J., Kolb, M., Schroeder, J. A., Kapoun, A. M., Damm, D., Murphy, A., Chakravarty, S., Dugar, S., Higgins, L., Protter, A. A., Gauldie, J.
(2005). Progressive Transforming Growth Factor {beta}1-induced Lung Fibrosis Is Blocked by an Orally Active ALK5 Kinase Inhibitor. Am. J. Respir. Crit. Care Med.
171: 889-898
[Abstract][Full Text]
Burdick, M. D., Murray, L. A., Keane, M. P., Xue, Y. Y., Zisman, D. A., Belperio, J. A., Strieter, R. M.
(2005). CXCL11 Attenuates Bleomycin-induced Pulmonary Fibrosis via Inhibition of Vascular Remodeling. Am. J. Respir. Crit. Care Med.
171: 261-268
[Abstract][Full Text]
King, T. E. Jr, Safrin, S., Starko, K. M., Brown, K. K., Noble, P. W., Raghu, G., Schwartz, D. A.
(2005). Analyses of Efficacy End Points in a Controlled Trial of Interferon-{gamma}1b for Idiopathic Pulmonary Fibrosis. Chest
127: 171-177
[Abstract][Full Text]
Aghanouri, R., Ghanei, M., Aslani, J., Keivani-Amine, H., Rastegar, F., Karkhane, A.
(2004). Fibrogenic cytokine levels in bronchoalveolar lavage aspirates 15 years after exposure to sulfur mustard. Am. J. Physiol. Lung Cell. Mol. Physiol.
287: L1160-L1164
[Abstract][Full Text]
Xu, Y., Wang, L., Buttice, G., Sengupta, P. K., Smith, B. D.
(2004). Major Histocompatibility Class II Transactivator (CIITA) Mediates Repression of Collagen (COL1A2) Transcription by Interferon {gamma} (IFN-{gamma}). J. Biol. Chem.
279: 41319-41332
[Abstract][Full Text]
Singh, J., Steele, M.
(2004). Acute Respiratory Failure After a Single Dose of Interferon-gamma. Chest
126: 994S-995S
[Abstract]
Nadrous, H. F., Ryu, J. H., Douglas, W. W., Decker, P. A., Olson, E. J.
(2004). Impact of Angiotensin-Converting Enzyme Inhibitors and Statins on Survival in Idiopathic Pulmonary Fibrosis. Chest
126: 438-446
[Abstract][Full Text]
Khalil, N., O'Connor, R.
(2004). Idiopathic pulmonary fibrosis: current understanding of the pathogenesis and the status of treatment. CMAJ
171: 153-160
[Abstract][Full Text]
Dauber, J. H., Gibson, K. F., Kaminski, N.
(2004). Interferon-{gamma} 1b in Idiopathic Pulmonary Fibrosis: What We Know and What Must We Learn. Am. J. Respir. Crit. Care Med.
170: 107-108
[Full Text]
Strieter, R. M., Starko, K. M., Enelow, R. I., Noth, I., Valentine, V. G., the other members of the Idiopathic Pulmonary Fibr,
(2004). Effects of Interferon-{gamma} 1b on Biomarker Expression in Patients with Idiopathic Pulmonary Fibrosis. Am. J. Respir. Crit. Care Med.
170: 133-140
[Abstract][Full Text]
Inoue, T., Fujishima, S., Ikeda, E., Yoshie, O., Tsukamoto, N., Aiso, S., Aikawa, N., Kubo, A., Matsushima, K., Yamaguchi, K.
(2004). CCL22 and CCL17 in rat radiation pneumonitis and in human idiopathic pulmonary fibrosis. Eur Respir J
24: 49-56
[Abstract][Full Text]
Collard, H. R., Ryu, J. H., Douglas, W. W., Schwarz, M. I., Curran-Everett, D., King, T. E. Jr., Brown, K. K.
(2004). Combined Corticosteroid and Cyclophosphamide Therapy Does Not Alter Survival in Idiopathic Pulmonary Fibrosis. Chest
125: 2169-2174
[Abstract][Full Text]
Wen, F.-Q., Liu, X., Kobayashi, T., Abe, S., Fang, Q., Kohyama, T., Ertl, R., Terasaki, Y., Manouilova, L., Rennard, S. I.
(2004). Interferon-{gamma} Inhibits Transforming Growth Factor-{beta} Production in Human Airway Epithelial Cells by Targeting Smads. Am. J. Respir. Cell Mol. Bio.
30: 816-822
[Abstract][Full Text]
Jakubzick, C., Choi, E. S., Carpenter, K. J., Kunkel, S. L., Evanoff, H., Martinez, F. J., Flaherty, K. R., Toews, G. B., Colby, T. V., Travis, W. D., Joshi, B. H., Puri, R. K., Hogaboam, C. M.
(2004). Human Pulmonary Fibroblasts Exhibit Altered Interleukin-4 and Interleukin-13 Receptor Subunit Expression in Idiopathic Interstitial Pneumonia. Am. J. Pathol.
164: 1989-2001
[Abstract][Full Text]
Jakubzick, C, Choi, E S, Kunkel, S L, Evanoff, H, Martinez, F J, Puri, R K, Flaherty, K R, Toews, G B, Colby, T V, Kazerooni, E A, Gross, B H, Travis, W D, Hogaboam, C M
(2004). Augmented pulmonary IL-4 and IL-13 receptor subunit expression in idiopathic interstitial pneumonia. J. Clin. Pathol.
57: 477-486
[Abstract][Full Text]
Evans, S. E., Colby, T. V., Ryu, J. H., Limper, A. H.
(2004). Transforming Growth Factor-{beta}1 and Extracellular Matrix-Associated Fibronectin Expression in Pulmonary Lymphangioleiomyomatosis. Chest
125: 1063-1070
[Abstract][Full Text]
Carvalho, C. R. R., Kairalla, R. A., Schettino, G. P. P., Crestani, B., Valeyre, D.
(2004). Acute Respiratory Failure after Interferon-{gamma} Therapy in IPF. Am. J. Respir. Crit. Care Med.
169: 543-544
[Full Text]
Bartram, U., Speer, C. P.
(2004). The Role of Transforming Growth Factor {beta} in Lung Development and Disease. Chest
125: 754-765
[Abstract][Full Text]
Kaufman, J., Sime, P. J., Phipps, R. P.
(2004). Expression of CD154 (CD40 Ligand) by Human Lung Fibroblasts: Differential Regulation by IFN-{gamma} and IL-13, and Implications for Fibrosis. J. Immunol.
172: 1862-1871
[Abstract][Full Text]
Raghu, G., Brown, K. K., Bradford, W. Z., Starko, K., Noble, P. W., Schwartz, D. A., King, T. E. Jr., the Idiopathic Pulmonary Fibrosis Study Group,
(2004). A Placebo-Controlled Trial of Interferon Gamma-1b in Patients with Idiopathic Pulmonary Fibrosis. NEJM
350: 125-133
[Abstract][Full Text]
Teirstein, A. S.
(2004). The Elusive Goal of Therapy for Usual Interstitial Pneumonia. NEJM
350: 181-183
[Full Text]
Santiago, B., Galindo, M., Palao, G., Pablos, J. L.
(2004). Intracellular Regulation of Fas-Induced Apoptosis in Human Fibroblasts by Extracellular Factors and Cycloheximide. J. Immunol.
172: 560-566
[Abstract][Full Text]
Costabel, U.
(2003). Idiopathic pulmonary fibrosis: a treatable disease?. Eur Respir J
22: 872-873
[Full Text]
Prasse, A., Muller, K-M., Kurz, C., Hamm, H., Virchow, J.C. Jr
(2003). Does interferon-{gamma} improve pulmonary function in idiopathic pulmonary fibrosis?. Eur Respir J
22: 906-911
[Abstract][Full Text]
Gunther, A., Lubke, N., Ermert, M., Schermuly, R. T., Weissmann, N., Breithecker, A., Markart, P., Ruppert, C., Quanz, K., Ermert, L., Grimminger, F., Seeger, W.
(2003). Prevention of Bleomycin-induced Lung Fibrosis by Aerosolization of Heparin or Urokinase in Rabbits. Am. J. Respir. Crit. Care Med.
168: 1358-1365
[Abstract][Full Text]
Segel, M. J., Izbicki, G., Cohen, P. Y., Or, R., Christensen, T. G., Wallach-Dayan, S. B., Breuer, R.
(2003). Role of interferon-{gamma} in the evolution of murine bleomycin lung fibrosis. Am. J. Physiol. Lung Cell. Mol. Physiol.
285: L1255-L1262
[Abstract][Full Text]
Kamp, D. W.
(2003). Idiopathic Pulmonary Fibrosis: The Inflammation Hypothesis Revisited. Chest
124: 1187-1190
[Full Text]
Tajima, S., Oshikawa, K., Tominaga, S.-i., Sugiyama, Y.
(2003). The Increase in Serum Soluble ST2 Protein Upon Acute Exacerbation of Idiopathic Pulmonary Fibrosis. Chest
124: 1206-1214
[Abstract][Full Text]
Wynes, M. W., Riches, D. W. H.
(2003). Induction of Macrophage Insulin-Like Growth Factor-I Expression by the Th2 Cytokines IL-4 and IL-13. J. Immunol.
171: 3550-3559
[Abstract][Full Text]
Kaminski, N., Belperio, J. A., Bitterman, P. B., Chen, L., Chensue, S. W., Choi, A. M.K., Dacic, S., Dauber, J. H., du Bois, R. M., Enghild, J. J., Fattman, C. L., Grutters, J. C., Haegens, A., Hanford, L. E., Heintz, N., Henson, P. M., Hogaboam, C., Kagan, V. E., Keane, M. P., Kunkel, S. L., Land, S., Loyd, J. E., Lukacs, N., MacPherson, M., Manning, B., Manning, N., Martinelli, M., Moller, D. R., Morse, D., Mossman, B., Noble, P. W., Nowak, N., Oury, T. D., Pardo, A., Perez, A., Petty, T. L., Phan, S. H., Ramos-Nino, M. E., Ray, P., Rogers, R. M., Sato, H., Scapoli, L., Schaefer, L. M., Selman, M., Stern, M., Strollo, D. C., Tyurin, V. A., Valnickova, Z., Welsh, K. I., Witzmann, F. A., Yousem, S. A., Strieter, R. M.
(2003). Idiopathic Pulmonary Fibrosis. Am. J. Respir. Cell Mol. Bio.
29: S1-105
[Full Text]
Olman, M. A., Matthay, M. A.
(2003). Transforming growth factor-{beta} induces fibrosis in immune cell-depleted lungs. Am. J. Physiol. Lung Cell. Mol. Physiol.
285: L522-L526
[Full Text]
Wittram, C., Mark, E. J., McLoud, T. C.
(2003). CT-Histologic Correlation of the ATS/ERS 2002 Classification of Idiopathic Interstitial Pneumonias. RadioGraphics
23: 1057-1071
[Abstract][Full Text]
Xaubet, A., Marin-Arguedas, A., Lario, S., Ancochea, J., Morell, F., Ruiz-Manzano, J., Rodriguez-Becerra, E., Rodriguez-Arias, J. M., Inigo, P., Sanz, S., Campistol, J. M., Mullol, J., Picado, C.
(2003). Transforming Growth Factor-{beta}1 Gene Polymorphisms Are Associated with Disease Progression in Idiopathic Pulmonary Fibrosis. Am. J. Respir. Crit. Care Med.
168: 431-435
[Abstract][Full Text]
Bergeron, A., Soler, P., Kambouchner, M., Loiseau, P., Milleron, B., Valeyre, D., Hance, A.J., Tazi, A.
(2003). Cytokine profiles in idiopathic pulmonary fibrosis suggest an important role for TGF-{beta} and IL-10. Eur Respir J
22: 69-76
[Abstract][Full Text]
Silver, R. F., Zukowski, L., Kotake, S., Li, Q., Pozuelo, F., Krywiak, A., Larkin, R.
(2003). Recruitment of Antigen-Specific Th1-Like Responses to the Human Lung following Bronchoscopic Segmental Challenge with Purified Protein Derivative of Mycobacterium tuberculosis. Am. J. Respir. Cell Mol. Bio.
29: 117-123
[Abstract][Full Text]
Chilosi, M., Poletti, V., Zamo, A., Lestani, M., Montagna, L., Piccoli, P., Pedron, S., Bertaso, M., Scarpa, A., Murer, B., Cancellieri, A., Maestro, R., Semenzato, G., Doglioni, C.
(2003). Aberrant Wnt/{beta}-Catenin Pathway Activation in Idiopathic Pulmonary Fibrosis. Am. J. Pathol.
162: 1495-1502
[Abstract][Full Text]
Selman, M.
(2003). A Dark Side of Interferon-{gamma} in the Treatment of Idiopathic Pulmonary Fibrosis?. Am. J. Respir. Crit. Care Med.
167: 945-946
[Full Text]
Honore, I., Nunes, H., Groussard, O., Kambouchner, M., Chambellan, A., Aubier, M., Valeyre, D., Crestani, B.
(2003). Acute Respiratory Failure after Interferon-{gamma} Therapy of End-Stage Pulmonary Fibrosis. Am. J. Respir. Crit. Care Med.
167: 953-957
[Abstract][Full Text]
Collard, H. R., King, T. E. Jr
(2003). Demystifying Idiopathic Interstitial Pneumonia. Arch Intern Med
163: 17-29
[Abstract][Full Text]
Antoniou, K. M., Ferdoutsis, E., Bouros, D.
(2003). Interferons and Their Application in the Diseases of the Lung. Chest
123: 209-216
[Abstract][Full Text]
Strieter, R. M., Belperio, J. A., Keane, M. P.
(2002). CXC Chemokines in Angiogenesis Related to Pulmonary Fibrosis. Chest
122: 298S-301S
[Abstract][Full Text]
Belperio, J. A., Dy, M., Burdick, M. D., Xue, Y. Y., Li, K., Elias, J. A., Keane, M. P.
(2002). Interaction of IL-13 and C10 in the Pathogenesis of Bleomycin-Induced Pulmonary Fibrosis. Am. J. Respir. Cell Mol. Bio.
27: 419-427
[Abstract][Full Text]
Venkatesan, N., Roughley, P. J., Ludwig, M. S.
(2002). Proteoglycan expression in bleomycin lung fibroblasts: role of transforming growth factor-beta 1 and interferon-gamma. Am. J. Physiol. Lung Cell. Mol. Physiol.
283: L806-L814
[Abstract][Full Text]
Selman, M.
(2002). From Anti-inflammatory Drugs Through Antifibrotic Agents to Lung Transplantation : A Long Road of Research, Clinical Attempts, and Failures in the Treatment of Idiopathic Pulmonary Fibrosis. Chest
122: 759-761
[Full Text]
Vicencio, A. G., Eickelberg, O., Stankewich, M. C., Kashgarian, M., Haddad, G. G.
(2002). Regulation of TGF-beta ligand and receptor expression in neonatal rat lungs exposed to chronic hypoxia. J. Appl. Physiol.
93: 1123-1130
[Abstract][Full Text]
Matsuoka, H., Arai, T., Mori, M., Goya, S., Kida, H., Morishita, H., Fujiwara, H., Tachibana, I., Osaki, T., Hayashi, S.
(2002). A p38 MAPK inhibitor, FR-167653, ameliorates murine bleomycin-induced pulmonary fibrosis. Am. J. Physiol. Lung Cell. Mol. Physiol.
283: L103-L112
[Abstract][Full Text]
Wahidi, M. M., Ravenel, J., Palmer, S. M., McAdams, H. P.
(2002). Progression of Idiopathic Pulmonary Fibrosis in Native Lungs After Single Lung Transplantation*. Chest
121: 2072-2076
[Abstract][Full Text]
Hubbard, R., Venn, A.
(2002). The impact of coexisting connective tissue disease on survival in patients with fibrosing alveolitis. Rheumatology (Oxford)
41: 676-679
[Abstract][Full Text]
RUDIGER, J. J., ROTH, M., BIHL, M. P., CORNELIUS, B. C., JOHNSON, M., ZIESCHE, R., BLOCK, L.-H.
(2002). Interaction of C/EBP{alpha} and the glucocorticoid receptor in vivo and in nontransformed human cells. FASEB J.
16: 177-184
[Abstract][Full Text]
WANG, H.-D., YAMAYA, M., OKINAGA, S., JIA, Y.-X., KAMANAKA, M., TAKAHASHI, H., GUO, L.-Y., OHRUI, T., SASAKI, H.
(2002). Bilirubin Ameliorates Bleomycin-Induced Pulmonary Fibrosis in Rats. Am. J. Respir. Crit. Care Med.
165: 406-411
[Abstract][Full Text]
PETERS-GOLDEN, M., BAILIE, M., MARSHALL, T., WILKE, C., PHAN, S. H., TOEWS, G. B., MOORE, B. B.
(2002). Protection from Pulmonary Fibrosis in Leukotriene-Deficient Mice. Am. J. Respir. Crit. Care Med.
165: 229-235
[Abstract][Full Text]
(2002). American Thoracic Society/European Respiratory Society International Multidisciplinary Consensus Classification of the Idiopathic Interstitial Pneumonias . This Joint Statement of the American Thoracic Society (ATS), and the European Respiratory Society (ERS) was adopted by the ATS Board of Directors, June 2001 and by The ERS Executive Committee, June 2001. Am. J. Respir. Crit. Care Med.
165: 277-304
[Full Text]
Lee, C. G., Homer, R. J., Zhu, Z., Lanone, S., Wang, X., Koteliansky, V., Shipley, J. M., Gotwals, P., Noble, P., Chen, Q., Senior, R. M., Elias, J. A.
(2001). Interleukin-13 Induces Tissue Fibrosis by Selectively Stimulating and Activating Transforming Growth Factor {beta}1. JEM
194: 809-822
[Abstract][Full Text]
Gross, T. J., Hunninghake, G. W.
(2001). Idiopathic Pulmonary Fibrosis. NEJM
345: 517-525
[Full Text]
Katzenstein, A.-L. A., Myers, J. L.
(2001). Idiopathic Pulmonary Fibrosis . To Biopsy or Not to Biopsy. Am. J. Respir. Crit. Care Med.
164: 185-186
[Full Text]
Selman, M.
(2001). Idiopathic Pulmonary Fibrosis Challenges for the Future. Chest
120: 8-10
[Full Text]
Stern, J.-B., Mal, H., Groussard, O., Brugiere, O., Marceau, A., Jebrak, G., Fournier, M.
(2001). Prognosis of Patients With Advanced Idiopathic Pulmonary Fibrosis Requiring Mechanical Ventilation for Acute Respiratory Failure. Chest
120: 213-219
[Abstract][Full Text]
Keane, M. P., Belperio, J. A., Burdick, M. D., Strieter, R. M.
(2001). IL-12 attenuates bleomycin-induced pulmonary fibrosis. Am. J. Physiol. Lung Cell. Mol. Physiol.
281: L92-L97
[Abstract][Full Text]
Strieter, R. M.
(2001). Mechanisms of Pulmonary Fibrosis : Conference Summary. Chest
120: 77S-85S
[Full Text]
Blom, I E, van Dijk, A J, de Weger, R A, Tilanus, M G J, Goldschmeding, R
(2001). Identification of human ccn2 (connective tissue growth factor) promoter polymorphisms. Mol. Pathol.
54: 192-196
[Abstract][Full Text]
Maeyama, T., Kuwano, K., Kawasaki, M., Kunitake, R., Hagimoto, N., Hara, N.
(2001). Attenuation of bleomycin-induced pneumopathy in mice by monoclonal antibody to interleukin-12. Am. J. Physiol. Lung Cell. Mol. Physiol.
280: L1128-L1137
[Abstract][Full Text]
Chen, E. S., Greenlee, B. M., Wills-Karp, M., Moller, D. R.
(2001). Attenuation of Lung Inflammation and Fibrosis in Interferon-{gamma}-Deficient Mice after Intratracheal Bleomycin. Am. J. Respir. Cell Mol. Bio.
24: 545-555
[Abstract][Full Text]
EICKELBERG, O., PANSKY, A., KOEHLER, E., BIHL, M., TAMM, M., HILDEBRAND, P., PERRUCHOUD, A. P., KASHGARIAN, M., ROTH, M.
(2001). Molecular mechanisms of TGF-{beta} antagonism by interferon {gamma} and cyclosporine A in lung fibroblasts. FASEB J.
15: 797-806
[Abstract][Full Text]
Krishna, G., Liu, K., Shigemitsu, H., Gao, M., Raffin, T. A., Rosen, G. D.
(2001). PG490-88, a Derivative of Triptolide, Blocks Bleomycin-Induced Lung Fibrosis. Am. J. Pathol.
158: 997-1004
[Abstract][Full Text]
Selman, M., King, T. E. Jr., Pardo, A.
(2001). Idiopathic Pulmonary Fibrosis: Prevailing and Evolving Hypotheses about Its Pathogenesis and Implications for Therapy. ANN INTERN MED
134: 136-151
[Abstract][Full Text]
A correction has been published: N Engl J Med 2000;342(7):524.
inhibits the proliferation of lung fibroblasts in a dose-dependent manner and reduces the synthesis of protein in fibroblasts.4,5 Moreover, in a bleomycin-induced model of lung fibrosis, exogenous interferon-
Previous
