The receptor for luteinizing hormone and chorionic gonadotropinplays a major part in normal and abnormal reproductive function.1,2,3,4In males, activation of the receptor regulates the developmentand function of Leydig cells.5 Testosterone secreted by Leydigcells promotes male sexual differentiation, pubertal androgenization,and fertility. The human luteinizing hormone receptor is a Gproteincoupled receptor with a transmembrane domain composedof seven segments. Activation of the receptor by luteinizinghormone leads to activation of Gs, the G protein that is coupledto adenylyl cyclase, and to an increase in cyclic AMP (cAMP).High concentrations of luteinizing hormone or of chorionic gonadotropincan also stimulate production of inositol phosphates and 1,2-diacylglycerolby phospholipase C, although the physiologic role of this secondarypathway remains unclear.1,4,6
Loss-of-function mutations of the gene for the luteinizing hormonereceptor in males cause pseudohermaphroditism associated withLeydig-cell hypoplasia, supporting the concept that a functionalreceptor is necessary for the early development of Leydig cells.2,3,7Activating mutations of the receptor, on the other hand, causegonadotropin-independent male-limited precocious puberty, adisorder characterized by autonomous hyperplasia and hyperfunctionof Leydig cells in association with inappropriate stimulationof adenylyl cyclase and the cAMP signaling pathway,2,3,8,9 butlittle or no activation of the phospholipase C pathway. Themost common mutation is a change from aspartic acid to glycineat position 578 (Asp578Gly) in the sixth transmembrane segmentof the receptor.
Leydig-cell adenomas are the most prevalent hormone-producingtumors of the testis and account for 1 to 3 percent of all testiculartumors.10,11,12 They are usually benign, but 10 percent of tumorsin adults are malignant. Boys with Leydig-cell tumors typicallyhave signs of isosexual precocity as a result of testosteronesecretion by the tumor.
The demonstrated role of the luteinizing hormone receptor inthe proliferation of Leydig cells and the presence of germ-lineand somatic mutations in the gene for the homologous thyrotropinreceptor in familial nonimmunogenic hyperthyroidism and sporadicthyroid adenomas, respectively,13,14 led us to hypothesize thatsome Leydig-cell adenomas might be caused by novel, activatingsomatic mutations of the luteinizing hormonereceptorgene. We now describe such a mutation in Leydig-cell adenomasin three boys.
Case Reports
The clinical characteristics of the three boys with isosexualprecocity are summarized in Table 1. Each boy presented withearly pubertal development that had begun one to two years previously.None had a family history of sexual precocity. After hormonalevaluation revealed gonadotropin-independent hypersecretionof testosterone, the possibility that the precocity was dueto congenital adrenal hyperplasia or a chorionic gonadotropinsecretingtumor was excluded. The volume of the testicles was asymmetricallyincreased in Patients 1 and 2, and a discrete testicular masswas palpable in Patient 2. Testicular ultrasonography revealeda unilateral mass in all three patients. Unilateral orchiectomywas performed in Patients 1 and 3, and a testis-sparing surgicalprocedure was performed in Patient 2.
Table 1. Clinical Characteristics of Three Boys with Isosexual Precocity and Leydig-Cell Tumors.
Methods
Amplification and Sequencing of DNA
Written informed consent was obtained from the patients' parentsafter the study protocol had been approved by the institutionalreview board. Slides of paraffin-embedded sections of tissuethat had been stained with hematoxylin and eosin were used toidentify discrete regions of interest (tumor and normal testis).Small, isolated regions of tissue were then scraped into microfugetubes, and DNA was extracted as described elsewhere.17 GenomicDNA from blood was obtained by standard methods.
DNA prepared from paraffin-embedded tissue or blood was amplifiedby the polymerase chain reaction (PCR) in 100 µl of reactionmixture containing 0.1 mM deoxynucleotide triphosphates, 2.5mM magnesium chloride, Taq Gold polymerase buffer and 0.5 Uof Taq Gold polymerase (PerkinElmer Applied Biosystems,Foster City, Calif.), and 0.1 mM upstream and downstream primers.Primers (5'TGTAAAACGACGGTTTGCAGTTCGAAACCCAGAATTAA3' and 5'CAGGAAACAGCTATGACCTGAAGGCAGCTGAGATGGCAAAAA3')contained 21M13 and M13 sequences (underlined) at their5' ends and were designed to amplify a short segment of exon11 that encodes the sixth transmembrane domain. Amplificationconsisted of denaturation at 95°C for 10 minutes, followedfirst by 40 cycles of annealing at 55°C for 1 minute, extensionat 72°C for 30 seconds, and denaturation at 95°C for1 minute and then one final cycle with a 3-minute primer extension.The remainder of exon 11 was amplified with primers that havebeen described elsewhere.18
DNA sequencing was performed with the ABI Prism Big Dye Primercycle-sequencing kit with Amplitaq DNA polymerase and an ABI377 sequencer (all PerkinElmer Applied Biosystems). Datawere analyzed with Sequence Navigator software, version 1.0.1(Applied Biosystems).
Allele-Specific BsrI Digestion
The substitution of cytosine for guanine at nucleotide 1732(G1732C) that encoded replacement of aspartic acid with histidineat amino acid position 578 (Asp578His) was detected by creatinga new BsrI restriction-enzyme site (New England Biolabs, Beverly,Mass.) in the DNA sequence adjacent to the mutation. Amplificationwas conducted with the sense primer 5'GTGGAAACCACTCTCTCACAAGTCTA3'and the antisense primer 5'AAAAAAAGAGATAGGTGCCATGCAGGTGAACT3',in which adenine at one position was replaced by a cytosine(underlined). This variant oligonucleotide primer allowed BsrIdigestion, converting a 210-bp PCR product into 176- and 34-bpfragments, only when the mutant allele was present.
Characterization of the Functional Properties of Mutant Luteinizing Hormone Receptor
The Asp578His mutation was generated in the complementary DNA(cDNA) for human luteinizing hormone receptor in the expressionvector pSG5 with use of the Transformer Mutagenesis Kit (Clontech,Palo Alto, Calif.), and its presence was confirmed by sequencing.The wild-type DNA and mutant DNA were prepared with plasmid-purificationkits (Qiagen, Chatsworth, Calif.). Lipofectamine (GIBCOBRL,Gaithersburg, Md.) was used for the transient transfection ofCOS-7 cells (2x106 in a 100-mm dish) with 10 µg of plasmidDNA.
Eighteen hours after transfection, the cells were replated forbinding assays and assays of cAMP and inositol phosphate production,as previously described.19 Forty-eight hours after transfection,cAMP was measured by iodine-125 radioimmunoassay (BiomedicalTechnologies, Stoughton, Mass.). Total inositol phosphates weremeasured by means of anion-exchange column chromatography (DowexAG1-X8, Bio-Rad, Richmond, Calif.). Data were analyzed withPrism software (version 2.0, GraphPad, San Diego, Calif.).
Results
In all three cases, the tumor was well circumscribed and wascomposed of nests of polygonal cells with abundant eosinophiliccytoplasm and round or ovoid nuclei. Mitotic activity was low,and Reinke's crystalloids were not seen. Immunohistochemicalstaining for p53 protein20 was negative. Genomic DNA was extractedfrom the Leydig-cell adenoma, adjacent normal testis tissue,and blood leukocytes from Patient 1 (Figure 1A). PCR productsencoding exon 11 of the luteinizing hormonereceptor gene,which includes the region of the gene that encodes the sixthtransmembrane segment, were generated from these templates.DNA sequencing revealed a heterozygous guanine-to-cytosine mutationat nucleotide 1732 in the tumor only. This novel somatic mutation,resulting in the change of GAT to CAT, encodes replacement ofthe aspartic acid at position 578 of the receptor with histidine(Asp578His) (Figure 1A).
Figure 1. Microscopical Appearance and Results of DNA Analysis of Testicular Tissue from Boys with Leydig-Cell Tumors.
On the left-hand side of Panel A, a cross section of a paraffin-embedded section of testis from Patient 1 is shown (hematoxylin and eosin, x2). Areas of tumor and adjacent normal testis tissue were dissected and analyzed separately. The results of direct sequencing of a short segment of the gene for the luteinizing hormone receptor from tumor, normal testis, and blood, after PCR amplification, are shown on the right-hand side of Panel A. A heterozygous guanine-to-cytosine (G/C) mutation that results in the replacement of aspartic acid with histidine at codon 578 was found only in the tumor specimen, indicating that the mutation is somatic. Panel B shows BsrI restriction-enzyme analysis of PCR products generated with a variant primer from specimens of tumor, normal testis, and blood from the three patients and blood from three unaffected control subjects. Only the tumor samples show the presence of both uncut (210-bp) and digested (176-bp) fragments.
Screening for BsrI digestion indicated that the Leydig-celltumors from Patients 2 and 3 were also composed of cells thatwere heterozygous for the somatic mutation Asp578His (Figure 1B),findings that were subsequently confirmed by direct DNAsequencing. PCR products generated from 50 unaffected controlsubjects did not have evidence of digestion with BsrI (datanot shown), indicating that the mutation is not a common polymorphismof the luteinizing hormonereceptor gene.
To assess the functional effects of the Asp578His mutation,wild-type and mutant forms of the luteinizing hormone receptorwere transiently expressed in COS-7 cells, and the binding ofchorionic gonadotropin and the production of cAMP and inositolphosphates were measured. The characteristics of receptors containingthe Asp578His mutation were directly compared with those ofreceptors containing a tyrosine residue at this position inplace of aspartic acid (Asp578Tyr) (Figure 2). The Asp578Tyrmutation is associated with severe precocious puberty in boys,characterized by diffuse Leydig-cell hyperplasia.9,19,21 Bindingexperiments with iodine-125labeled chorionic gonadotropinrevealed that the receptor containing the Asp578His mutationwas more highly expressed at the cell surface than the wild-typereceptor (mean [±SE] maximal binding capacity, 402±78 percent of wild type in five experiments) or that containingthe Asp578Tyr mutation (maximal binding capacity, 279±17percent of wild type), but its affinity for chorionic gonadotropin(dissociation constant, 1 nM) was similar to that of the lattertwo receptors (data not shown). The Asp578His mutation causedan agonist-independent increase in the basal production of cAMP(28±3 times the basal production in the wild-type receptor,or 80 percent of the maximal effect of chorionic gonadotropinin the wild-type receptor in four experiments), which was greaterthan that caused by Asp578Tyr (19±2 times the basal productionin the wild-type receptor in four experiments) or any otherknown mutation of the luteinizing hormone receptor.2,3,8,9,19Moreover, the basal production of inositol phosphates in theAsp578His mutant was seven times that in the wild-type receptor(70 percent of the maximal effect of chorionic gonadotropinin four experiments). The maximal chorionic gonadotropinstimulatedproduction of inositol phosphates was also greater than thatin the wild type. Basal inositol phosphate production was alsoincreased in cells expressing a low concentration of Asp578Hisreceptors (data not shown), indicating that a high level ofconstitutive activity is an intrinsic property of the Asp578Hisreceptor and not merely a result of the overexpression of receptors.
Figure 2. Comparison of Receptors with the Asp578His or Asp578Tyr Mutation and the Wild-Type Receptor.
Mean (±SE) basal and chorionic gonadotropinstimulated accumulation of cAMP (Panel A) and inositol phosphates (Panel B) is shown in COS-7 cells transfected with DNA for the wild-type luteinizing hormone receptor or receptors with the Asp578Tyr or Asp578His mutation. Data in Panel A are means (±SE) from four experiments. Data in Panel B are from one representative experiment performed in triplicate. Basal activity of the wild-type luteinizing hormone receptor is the same as that of the pSG5 expression vector alone.19 Basal cAMP production of the wild-type receptor was 1.1±0.2 pmol per 105 cells, and basal inositol phosphate production was 431±67 cpm per 105 cells.
Discussion
Leydig-cell adenomas are one cause of gonadotropin-independentsexual precocity in boys, a condition that may also be mediatedby virilizing forms of adrenal hyperplasia, adrenal tumors,tumors that produce chorionic gonadotropin, male-limited precociouspuberty, and McCuneAlbright syndrome (due to an activatingmutation of arginine at position 201 in the subunit of Gs).22,23,24In boys with male-limited precocious puberty, signs of sexualdevelopment usually appear before the age of four years,23 butin boys with Leydig-cell tumors, these signs typically appearlater, between the ages of five and nine.11 Because small testicularmasses may not be palpable, all boys with gonadotropin-independenthypersecretion of testosterone and no family history of precociouspuberty should undergo testicular ultrasonography.
The identification of a novel somatic mutation, Asp578His, inthe gene encoding the luteinizing hormone receptor in threeboys with Leydig-cell tumors provides a new example of how activatingmutations of G proteincoupled receptors can cause disease.25As with the homologous thyrotropin receptor,14 it appears thatsomatic mutations of the gene for the luteinizing hormone receptormay be associated with a more highly activating phenotype thanthe hereditary mutations. Spontaneous Leydig-cell tumors arecommon in laboratory animals, and drugs that cause high serumluteinizing hormone concentrations can increase the incidenceof Leydig-cell hyperplasia and adenomas in rodents.26 In humans,Leydig-cell hyperplasia and tumors appear to be distinct entities.22,27Boys with precocious puberty due to activating mutations inthe gene for the luteinizing hormone receptor have not beenreported to be at increased risk for Leydig-cell tumors,22 althoughthere is one documented occurrence of a testicular seminomain such a patient.28
The causes of Leydig-cell tumors are likely to be heterogeneous.Although luteinizing hormone signaling plays a major part inLeydig-cell proliferation, alterations in other local stimuli,including müllerian-duct inhibitory factor, inhibin, growthfactors, and temperature, may also create conditions favorableto tumorigenesis.5,29,30 The activating arginine-to-cysteinemutation Arg201Cys in the subunit of Gs was recently detectedin Leydig-cell tumors from three adult women and one man, butnot in a tumor from a boy with sexual precocity.31 In a preliminaryscreening, we have found the Asp578His mutation in three offive additional Leydig-cell tumors, but none had a mutationof arginine at position 201 (unpublished data). Although Leydig-celltumors are not common in patients with McCuneAlbrightsyndrome or male-limited precocious puberty, it is plausiblethat somatic mutations that promote increased cellular productionof cAMP and an increased rate of cell division represent oneearly event in the neoplastic process.32
The adenoma-associated mutation occurs at the conserved asparticacid residue at position 578, where substitution by glycinehas been found to cause the most common form of male-limitedprecocious puberty (characterized by patchy Leydig-cell hyperplasia)and where substitution by tyrosine has been associated witha more severe clinical phenotype (characterized by diffuse Leydig-cellhyperplasia).9,21
Under normal conditions, hormone-mediated activation of theluteinizing hormone receptor in Leydig cells probably does notresult in stimulation of the phospholipase C pathway.1,4 Becausethe main feature that distinguishes the Asp578His mutation fromreceptor mutations associated with Leydig-cell hyperplasia isits ability to activate this pathway (Figure 2B), it is temptingto speculate that neoplastic transformation of Leydig cellsinvolves inappropriate costimulation or synergism of the cAMPand phospholipase C pathways. Costimulation of these pathwaysby a constitutively active mutant 1B-adrenergicreceptortransgene has been implicated in animals with thyroid neoplasia.33Furthermore, a somatic mutation corresponding to Asp578His inthe thyrotropin receptor (Asp633His) has been described in apatient with a rare, autonomously hyperfunctioning insular thyroidcarcinoma that had metastasized to a cervical lymph node andto the lungs.34 The Asp633His mutation in the thyrotropin receptoralso has been found to cause constitutive activation of boththe cAMP and phospholipase C pathways (unpublished data). Manyother receptors coupled to the activation of phospholipase Cstimulate cell proliferation and transformation, although theseeffects may in fact be independent of traditional signalingpathways.35,36
Supported by grants from the American Cancer Society (IRG-93-037-04,to the Robert H. Lurie Comprehensive Cancer Center, and IllinoisDivision grant 98-31, to Dr. Shenker), the National Institutesof Health (5T32-DK07169-19A1), the French Ministry of ForeignAffairs (a Lavoisier grant, to Dr. Duranteau), and the PhilippeFoundation (to Dr. Duranteau). Dr. Shenker is the Crown FamilyYoung Investigator in Developmental Systems Biology.
We are indebted to Dr. David Walterhouse, Dr. Barry Rich, Dr.Jean Bienaymé, Dr. Bernard Boudailliez, and Michele Irvingfor referral of patients; to Dr. Ritu Nayar, Dr. Susan Crawford,Dr. Pauline Chou, Dr. Frank Gonzalez-Crussi, and Dr. PatrickBarbet for performing the histologic analyses; to Tom Kotlar,Dr. Peter Kopp, Dr. Larry Jameson, and Dr. Angelo DiGeorge forvaluable suggestions; and to the National Hormone and PituitaryProgram for supplying chorionic gonadotropin.
Source Information
From the Division of Endocrinology, Department of Pediatrics, Northwestern University Medical School and Children's Memorial Institute for Education and Research, Chicago (G.L., L.D., J.M., A.S.); the Service d'Endocrinologie Pédiatrique, Groupe Hospitalier CochinSaint Vincent de Paul, Paris (J.-C.C.); and the Division of Pediatric Endocrinology, Temple University Children's Medical Center, Philadelphia (D.A.D.).
Address reprint requests to Dr. Shenker at Children's Memorial Hospital, 2300 Children's Plaza, Box 225, Chicago, IL 60614, or at ashenker{at}nwu.edu.
References
Segaloff DL, Ascoli M. The lutropin/choriogonadotropin recep-tor . . . 4 years later. Endocr Rev 1993;14:324-347. [Free Full Text]
Themmen APN, Brunner HG. Luteinizing hormone receptor mutations and sex differentiation. Eur J Endocrinol 1996;134:533-540. [Free Full Text]
Chan W-Y. Molecular genetic, biochemical, and clinical implications of gonadotropin receptor mutations. Mol Genet Metab 1998;63:75-84. [CrossRef][Medline]
Dufau ML. The luteinizing hormone receptor. Annu Rev Physiol 1998;60:461-496. [CrossRef][Medline]
Lejeune H, Habert R, Saez JM. Origin, proliferation and differentiation of Leydig cells. J Mol Endocrinol 1998;20:1-25. [CrossRef][Medline]
Herrlich A, Kühn B, Grosse R, Schmid A, Schultz G, Gudermann T. Involvement of Gs and Gi proteins in dual coupling of the luteinizing hormone receptor to adenylyl cyclase and phospholipase C. J Biol Chem 1996;271:16764-16772. [Free Full Text]
Latronico AC, Anasti J, Arnhold IJP, et al. Testicular and ovarian resistance to luteinizing hormone caused by inactivating mutations of the luteinizing hormone-receptor gene. N Engl J Med 1996;334:507-512. [Free Full Text]
Shenker A, Laue L, Kosugi S, Merendino JJ Jr, Minegishi T, Cutler GB Jr. A constitutively activating mutation of the luteinizing hormone receptor in familial male precocious puberty. Nature 1993;365:652-654. [CrossRef][Medline]
Laue L, Chan W-Y, Hsueh AJW, et al. Genetic heterogeneity of constitutively activating mutations of the human luteinizing hormone receptor in familial male-limited precocious puberty. Proc Natl Acad Sci U S A 1995;92:1906-1910. [Free Full Text]
Kim I, Young RH, Scully RE. Leydig cell tumors of the testis: a clinicopathological analysis of 40 cases and review of the literature. Am J Surg Pathol 1985;9:177-192. [Medline]
Paschke R, Ludgate M. The thyrotropin receptor in thyroid diseases. N Engl J Med 1997;337:1675-1681. [Free Full Text]
Parma J, Duprez L, Van Sande J, et al. Diversity and prevalence of somatic mutations in the thyrotropin receptor and Gs genes as a cause of toxic thyroid adenomas. J Clin Endocrinol Metab 1997;82:2695-2701. [Free Full Text]
Greulich WW, Pyle SI. Radiographic atlas of skeletal development of the hand and wrist. 2nd ed. Stanford, Calif.: Stanford University Press, 1959.
Marshall WA, Tanner JM. Variations in the pattern of pubertal changes in boys. Arch Dis Child 1970;45:13-23.
Sarkar FH, Li YW, Crissman JD. A method for PCR sequencing of the p53 gene from a single 10-microns frozen or paraffin-embedded tissue section. Biotechniques 1993;15:36-38. [Medline]
Atger M, Misrahi M, Sar S, Le Flem L, Dessen P, Milgrom E. Structure of the human luteinizing hormone-choriogonadotropin receptor gene: unusual promoter and 5' non-coding regions. Mol Cell Endocrinol 1995;111:113-123. [CrossRef][Medline]
Kosugi S, Mori T, Shenker A. The role of Asp578 in maintaining the inactive conformation of the human lutropin/choriogonadotropin receptor. J Biol Chem 1996;271:31813-31817. [Free Full Text]
McCluggage WG, Shanks JH, Arthur K, Banerjee SS. Cellular proliferation and nuclear ploidy assessments augment established prognostic factors in predicting malignancy in testicular Leydig cell tumours. Histopathology 1998;33:361-368. [CrossRef][Medline]
Müller J, Gondos B, Kosugi S, Mori T, Shenker A. Severe testotoxicosis phenotype associated with Asp578Tyr mutation of the lutrophin/choriogonadotrophin receptor gene. J Med Genet 1998;35:340-341. [Free Full Text]
Wilson BE, Netzloff ML. Primary testicular abnormalities causing precocious puberty Leydig cell tumor, Leydig cell hyperplasia, and adrenal rest tumor. Ann Clin Lab Sci 1983;13:315-320. [Abstract]
Holland FJ. Gonadotropin-independent precocious puberty. Endocrinol Metab Clin North Am 1991;20:191-210. [Medline]
Weinstein LS, Shenker A, Gejman PV, Merino MJ, Friedman E, Spiegel AM. Activating mutations of the stimulatory G protein in the McCune-Albright syndrome. N Engl J Med 1991;325:1688-1695. [Abstract]
Spiegel AM. Mutations in G proteins and G protein-coupled receptors in endocrine disease. J Clin Endocrinol Metab 1996;81:2434-2442. [CrossRef][Medline]
Clegg ED, Cook JC, Chapin RE, Foster PMD, Daston GP. Leydig cell hyperplasia and adenoma formation: mechanisms and relevance to humans. Reprod Toxicol 1997;11:107-121. [CrossRef][Medline]
Martin MM, Wu S-M, Martin ALA, Rennert OM, Chan W-Y. Testicular seminoma in a patient with a constitutively activating mutation of the luteinizing hormone/chorionic gonadotropin receptor. Eur J Endocrinol 1998;139:101-106. [Abstract]
Matzuk MM, Finegold MJ, Mishina Y, Bradley A, Behringer RR. Synergistic effects of inhibins and mullerian-inhibiting substance on testicular tumorigenesis. Mol Endocrinol 1995;9:1337-1345. [Free Full Text]
Wu N, Murono EP. Temperature and germ cell regulation of Leydig cell proliferation stimulated by Sertoli cell-secreted mitogenic factor: a possible role in cryptorchidism. Andrologia 1996;28:247-257. [Medline]
Fragoso MCBV, Latronico AC, Carvalho FM, et al. Activating mutation of the stimulatory G protein (gsp) as a putative cause of ovarian and testicular human stromal Leydig cell tumors. J Clin Endocrinol Metab 1998;83:2074-2078. [Free Full Text]
Studer H, Derwahl M. Mechanisms of nonneoplastic endocrine hyperplasia -- a changing concept: a review focused on the thyroid gland. Endocr Rev 1995;16:411-426. [Free Full Text]
Ledent C, Denef J-F, Cottecchia S, et al. Costimulation of adenylyl cyclase and phospholipase C by a mutant 1B-adrenergic receptor transgene promotes malignant transformation of thyroid follicular cells. Endocrinology 1997;138:369-378. [Free Full Text]
Russo D, Tumino S, Arturi F, et al. Detection of an activating mutation of the thyrotropin receptor in a case of an autonomously hyperfunctioning thyroid insular carcinoma. J Clin Endocrinol Metab 1997;82:735-738. [Free Full Text]
Liao, M., Zhang, Y., Dufau, M. L.
(2008). Protein Kinase C{alpha}-Induced Derepression of the Human Luteinizing Hormone Receptor Gene Transcription through ERK-Mediated Release of HDAC1/Sin3A Repressor Complex from Sp1 Sites. Mol. Endocrinol.
22: 1449-1463
[Abstract][Full Text]
Meng, X.-L., Rennert, O. M., Chan, W.-Y.
(2007). Human Chorionic Gonadotropin Induces Neuronal Differentiation of PC12 Cells through Activation of Stably Expressed Lutropin/Choriogonadotropin Receptor. Endocrinology
148: 5865-5873
[Abstract][Full Text]
Zhang, M., Tao, Y.-X., Ryan, G. L., Feng, X., Fanelli, F., Segaloff, D. L.
(2007). Intrinsic Differences in the Response of the Human Lutropin Receptor Versus the Human Follitropin Receptor to Activating Mutations. J. Biol. Chem.
282: 25527-25539
[Abstract][Full Text]
Shiraishi, K., Ascoli, M.
(2007). Lutropin/Choriogonadotropin Stimulate the Proliferation of Primary Cultures of Rat Leydig Cells through a Pathway that Involves Activation of the Extracellularly Regulated Kinase 1/2 Cascade. Endocrinology
148: 3214-3225
[Abstract][Full Text]
Nurwakagari, P., Breit, A., Hess, C., Salman-Livny, H., Ben-Menahem, D., Gudermann, T.
(2007). A conformational contribution of the luteinizing hormone-receptor ectodomain to receptor activation. J Mol Endocrinol
38: 259-275
[Abstract][Full Text]
Carvajal-Carmona, L. G., Alam, N. A., Pollard, P. J., Jones, A. M., Barclay, E., Wortham, N., Pignatelli, M., Freeman, A., Pomplun, S., Ellis, I., Poulsom, R., El-Bahrawy, M. A., Berney, D. M., Tomlinson, I. P. M.
(2006). Adult Leydig Cell Tumors of the Testis Caused by Germline Fumarate Hydratase Mutations. J. Clin. Endocrinol. Metab.
91: 3071-3075
[Abstract][Full Text]
Veldhuis, J. D., Roemmich, J. N., Richmond, E. J., Bowers, C. Y.
(2006). Somatotropic and Gonadotropic Axes Linkages in Infancy, Childhood, and the Puberty-Adult Transition. Endocr. Rev.
27: 101-140
[Abstract][Full Text]
Mizutani, T., Shiraishi, K., Welsh, T., Ascoli, M.
(2006). Activation of the Lutropin/Choriogonadotropin Receptor in MA-10 Cells Leads to the Tyrosine Phosphorylation of the Focal Adhesion Kinase by a Pathway that Involves Src Family Kinases. Mol. Endocrinol.
20: 619-630
[Abstract][Full Text]
Wettschureck, N., Offermanns, S.
(2005). Mammalian G Proteins and Their Cell Type Specific Functions. Physiol. Rev.
85: 1159-1204
[Abstract][Full Text]
Themmen, A. P N
(2005). An update of the pathophysiology of human gonadotrophin subunit and receptor gene mutations and polymorphisms. Reproduction
130: 263-274
[Abstract][Full Text]
Rulli, S. B, Huhtaniemi, I.
(2005). What have gonadotrophin overexpressing transgenic mice taught us about gonadal function?. Reproduction
130: 283-291
[Abstract][Full Text]
Marx, S. J., Simonds, W. F.
(2005). Hereditary Hormone Excess: Genes, Molecular Pathways, and Syndromes. Endocr. Rev.
26: 615-661
[Abstract][Full Text]
Meehan, T. P, Harmon, B. G, Overcast, M. E, Yu, K. K, Camper, S. A, Puett, D., Narayan, P.
(2005). Gonadal defects and hormonal alterations in transgenic mice expressing a single chain human chorionic gonadotropin-lutropin receptor complex. J Mol Endocrinol
34: 489-503
[Abstract][Full Text]
Piaditis, G., Angellou, A., Kontogeorgos, G., Mazarakis, N., Kounadi, T., Kaltsas, G., Vamvakidis, K., Lloyd, R. V., Horvath, E., Kovacs, K.
(2005). Ectopic Bioactive Luteinizing Hormone Secretion by a Pancreatic Endocrine Tumor, Manifested as Luteinized Granulosa-Thecal Cell Tumor of the Ovaries. J. Clin. Endocrinol. Metab.
90: 2097-2103
[Abstract][Full Text]
Basciani, S., Brama, M., Mariani, S., De Luca, G., Arizzi, M., Vesci, L., Pisano, C., Dolci, S., Spera, G., Gnessi, L.
(2005). Imatinib Mesylate Inhibits Leydig Cell Tumor Growth: Evidence for In vitro and In vivo Activity. Cancer Res.
65: 1897-1903
[Abstract][Full Text]
Samson, M., Peale, F. V. Jr., Frantz, G., Rioux-Leclercq, N., Rajpert-De Meyts, E., Ferrara, N.
(2004). Human Endocrine Gland-Derived Vascular Endothelial Growth Factor: Expression Early in Development and in Leydig Cell Tumors Suggests Roles in Normal and Pathological Testis Angiogenesis. J. Clin. Endocrinol. Metab.
89: 4078-4088
[Abstract][Full Text]
Bastepe, M., Raas-Rothschild, A., Silver, J., Weissman, I., Wientroub, S., Juppner, H., Gillis, D.
(2004). A Form of Jansen's Metaphyseal Chondrodysplasia with Limited Metabolic and Skeletal Abnormalities Is Caused by a Novel Activating Parathyroid Hormone (PTH)/PTH-Related Peptide Receptor Mutation. J. Clin. Endocrinol. Metab.
89: 3595-3600
[Abstract][Full Text]
Hirakawa, T., Ascoli, M.
(2003). The Lutropin/Choriogonadotropin Receptor-Induced Phosphorylation of the Extracellular Signal-Regulated Kinases in Leydig Cells Is Mediated by a Protein Kinase A-Dependent Activation of Ras. Mol. Endocrinol.
17: 2189-2200
[Abstract][Full Text]
Rulli, S. B., Ahtiainen, P., Makela, S., Toppari, J., Poutanen, M., Huhtaniemi, I.
(2003). Elevated Steroidogenesis, Defective Reproductive Organs, and Infertility in Transgenic Male Mice Overexpressing Human Chorionic Gonadotropin. Endocrinology
144: 4980-4990
[Abstract][Full Text]
Collins, M. T., Sarlis, N. J., Merino, M. J., Monroe, J., Crawford, S. E., Krakoff, J. A., Guthrie, L. C., Bonat, S., Robey, P. G., Shenker, A.
(2003). Thyroid Carcinoma in the McCune-Albright Syndrome: Contributory Role of Activating Gs{alpha} Mutations. J. Clin. Endocrinol. Metab.
88: 4413-4417
[Abstract][Full Text]
Hirakawa, T., Ascoli, M.
(2003). A Constitutively Active Somatic Mutation of the Human Lutropin Receptor Found in Leydig Cell Tumors Activates the Same Families of G Proteins as Germ Line Mutations Associated with Leydig Cell Hyperplasia. Endocrinology
144: 3872-3878
[Abstract][Full Text]
Sangkuhl, K., Schulz, A., Schultz, G., Schoneberg, T.
(2002). Structural Requirements for Mutational Lutropin/Choriogonadotropin Receptor Activation. J. Biol. Chem.
277: 47748-47755
[Abstract][Full Text]
Als, C., Gedeon, P., Rosler, H., Minder, C., Netzer, P., Laissue, J. A.
(2002). Survival Analysis of 19 Patients with Toxic Thyroid Carcinoma. J. Clin. Endocrinol. Metab.
87: 4122-4127
[Abstract][Full Text]
Angelova, K., Fanelli, F., Puett, D.
(2002). A Model for Constitutive Lutropin Receptor Activation Based on Molecular Simulation and Engineered Mutations in Transmembrane Helices 6 and 7. J. Biol. Chem.
277: 32202-32213
[Abstract][Full Text]
Ascoli, M., Fanelli, F., Segaloff, D. L.
(2002). The Lutropin/Choriogonadotropin Receptor, A 2002 Perspective. Endocr. Rev.
23: 141-174
[Abstract][Full Text]
Rannikko, A., Pakarinen, P., Manna, P. R., Beau, I., Misrahi, M., Aittomaki, K., Huhtaniemi, I.
(2002). Functional characterization of the human FSH receptor with an inactivating Ala189Val mutation. Mol Hum Reprod
8: 311-317
[Abstract][Full Text]
Richter-Unruh, A., Wessels, H. T., Menken, U., Bergmann, M., Schmittmann-Ohters, K., Schaper, J., Tappeser, S., Hauffa, B. P.
(2002). Male LH-Independent Sexual Precocity in a 3.5-Year-Old Boy Caused by a Somatic Activating Mutation of the LH Receptor in a Leydig Cell Tumor. J. Clin. Endocrinol. Metab.
87: 1052-1056
[Abstract][Full Text]
Hirakawa, T., Galet, C., Ascoli, M.
(2002). MA-10 Cells Transfected with the Human Lutropin/Choriogonadotropin Receptor (hLHR): A Novel Experimental Paradigm to Study the Functional Properties of the hLHR. Endocrinology
143: 1026-1035
[Abstract][Full Text]
Manna, P. R., Joshi, L., Reinhold, V. N., Aubert, M. L., Suganuma, N., Pettersson, K., Huhtaniemi, I. T.
(2002). Synthesis, purification and structural and functional characterization of recombinant form of a common genetic variant of human luteinizing hormone. Hum Mol Genet
11: 301-315
[Abstract][Full Text]
Choong, C. S., Fuller, P. J., Chu, S., Jeske, Y., Bowling, F., Brown, R., Borzi, P., Balazs, N. D., Suppiah, R., Cotterill, A. M., Payton, D., Robertson, D. M., Burger, H. G.
(2002). Sertoli-Leydig Cell Tumor of the Ovary, a Rare Cause of Precocious Puberty in a 12-Month-Old Infant. J. Clin. Endocrinol. Metab.
87: 49-56
[Abstract][Full Text]
Neumann, S., Krause, G., Chey, S., Paschke, R.
(2001). A Free Carboxylate Oxygen in the Side Chain of Position 674 in Transmembrane Domain 7 Is Necessary for TSH Receptor Activation. Mol. Endocrinol.
15: 1294-1305
[Abstract][Full Text]
Huhtaniemi, I., Bartke, A.
(2001). Perspective: Male Reproduction. Endocrinology
142: 2178-2183
[Full Text]
Bebia, Z., Somers, J. P., Liu, G., Ihrig, L., Shenker, A., Zeleznik, A. J.
(2001). Adenovirus-Directed Expression of Functional Luteinizing Hormone (LH) Receptors in Undifferentiated Rat Granulosa Cells: Evidence for Differential Signaling through Follicle-Stimulating Hormone and LH Receptors. Endocrinology
142: 2252-2259
[Abstract][Full Text]
Jorge, B. H., Agarwal, S. K., Lando, V. S., Salvatori, R., Barbero, R. R., Abelin, N., Levine, M. A., Marx, S. J., Toledo, S. P. A.
(2001). Study of the Multiple Endocrine Neoplasia Type 1, Growth Hormone-Releasing Hormone Receptor, Gs{{alpha}}, and Gi2{{alpha}} Genes in Isolated Familial Acromegaly. J. Clin. Endocrinol. Metab.
86: 542-544
[Abstract][Full Text]
Min, L., Ascoli, M.
(2000). Effect of Activating and Inactivating Mutations on the Phosphorylation and Trafficking of the Human Lutropin/Choriogonadotropin Receptor. Mol. Endocrinol.
14: 1797-1810
[Abstract][Full Text]
Themmen, A. P. N., Huhtaniemi, I. T.
(2000). Mutations of Gonadotropins and Gonadotropin Receptors: Elucidating the Physiology and Pathophysiology of Pituitary-Gonadal Function. Endocr. Rev.
21: 551-583
[Abstract][Full Text]
Tao, Y.-X., Abell, A. N., Liu, X., Nakamura, K., Segaloff, D. L.
(2000). Constitutive Activation of G Protein-Coupled Receptors as a Result of Selective Substitution of a Conserved Leucine Residue in Transmembrane Helix III. Mol. Endocrinol.
14: 1272-1282
[Abstract][Full Text]
Brunner, H. G., Otten, B. J.
(1999). Precocious Puberty in Boys. NEJM
341: 1763-1765
[Full Text]
Min, L., Galet, C., Ascoli, M.
(2002). The Association of Arrestin-3 with the Human Lutropin/Choriogonadotropin Receptor Depends Mostly on Receptor Activation Rather than on Receptor Phosphorylation. J. Biol. Chem.
277: 702-710
[Abstract][Full Text]