FREE NEJM E-TOC    HOME   |   SUBSCRIBE   |   CURRENT ISSUE   |   PAST ISSUES   |   COLLECTIONS   |   Search Term  Advanced Search

Sign in | Get NEJM's E-Mail Table of Contents — Free | Subscribe

Previous Volume 341:1731-1736 December 2, 1999 Number 23 Next

PDF Editorial by Brunner, H. G. Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited PubMed Citation

The receptor for luteinizing hormone and chorionic gonadotropin plays a major part in normal and abnormal reproductive function.^1,2,3,4 In males, activation of the receptor regulates the development and function of Leydig cells.⁵ Testosterone secreted by Leydig cells promotes male sexual differentiation, pubertal androgenization, and fertility. The human luteinizing hormone receptor is a G protein–coupled receptor with a transmembrane domain composed of seven segments. Activation of the receptor by luteinizing hormone leads to activation of G_s, the G protein that is coupled to adenylyl cyclase, and to an increase in cyclic AMP (cAMP). High concentrations of luteinizing hormone or of chorionic gonadotropin can also stimulate production of inositol phosphates and 1,2-diacylglycerol by phospholipase C, although the physiologic role of this secondary pathway remains unclear.^1,4,6

Loss-of-function mutations of the gene for the luteinizing hormone receptor in males cause pseudohermaphroditism associated with Leydig-cell hypoplasia, supporting the concept that a functional receptor is necessary for the early development of Leydig cells.^2,3,7 Activating mutations of the receptor, on the other hand, cause gonadotropin-independent male-limited precocious puberty, a disorder characterized by autonomous hyperplasia and hyperfunction of Leydig cells in association with inappropriate stimulation of adenylyl cyclase and the cAMP signaling pathway,^2,3,8,9 but little or no activation of the phospholipase C pathway. The most common mutation is a change from aspartic acid to glycine at position 578 (Asp578Gly) in the sixth transmembrane segment of the receptor.

Leydig-cell adenomas are the most prevalent hormone-producing tumors of the testis and account for 1 to 3 percent of all testicular tumors.^10,11,12 They are usually benign, but 10 percent of tumors in adults are malignant. Boys with Leydig-cell tumors typically have signs of isosexual precocity as a result of testosterone secretion by the tumor.

The demonstrated role of the luteinizing hormone receptor in the proliferation of Leydig cells and the presence of germ-line and somatic mutations in the gene for the homologous thyrotropin receptor in familial nonimmunogenic hyperthyroidism and sporadic thyroid adenomas, respectively,^13,14 led us to hypothesize that some Leydig-cell adenomas might be caused by novel, activating somatic mutations of the luteinizing hormone–receptor gene. We now describe such a mutation in Leydig-cell adenomas in three boys.

Case Reports

The clinical characteristics of the three boys with isosexual precocity are summarized in Table 1. Each boy presented with early pubertal development that had begun one to two years previously. None had a family history of sexual precocity. After hormonal evaluation revealed gonadotropin-independent hypersecretion of testosterone, the possibility that the precocity was due to congenital adrenal hyperplasia or a chorionic gonadotropin–secreting tumor was excluded. The volume of the testicles was asymmetrically increased in Patients 1 and 2, and a discrete testicular mass was palpable in Patient 2. Testicular ultrasonography revealed a unilateral mass in all three patients. Unilateral orchiectomy was performed in Patients 1 and 3, and a testis-sparing surgical procedure was performed in Patient 2.

View this table: [in this window] [in a new window]   Table 1. Clinical Characteristics of Three Boys with Isosexual Precocity and Leydig-Cell Tumors.

 
Methods

Amplification and Sequencing of DNA

Written informed consent was obtained from the patients' parents after the study protocol had been approved by the institutional review board. Slides of paraffin-embedded sections of tissue that had been stained with hematoxylin and eosin were used to identify discrete regions of interest (tumor and normal testis). Small, isolated regions of tissue were then scraped into microfuge tubes, and DNA was extracted as described elsewhere.¹⁷ Genomic DNA from blood was obtained by standard methods.

DNA prepared from paraffin-embedded tissue or blood was amplified by the polymerase chain reaction (PCR) in 100 µl of reaction mixture containing 0.1 mM deoxynucleotide triphosphates, 2.5 mM magnesium chloride, Taq Gold polymerase buffer and 0.5 U of Taq Gold polymerase (Perkin–Elmer Applied Biosystems, Foster City, Calif.), and 0.1 mM upstream and downstream primers. Primers (5'TGTAAAACGACGGTTTGCAGTTCGAAACCCAGAATTAA3' and 5'CAGGAAACAGCTATGACCTGAAGGCAGCTGAGATGGCAAAAA3') contained –21M13 and M13 sequences (underlined) at their 5' ends and were designed to amplify a short segment of exon 11 that encodes the sixth transmembrane domain. Amplification consisted of denaturation at 95°C for 10 minutes, followed first by 40 cycles of annealing at 55°C for 1 minute, extension at 72°C for 30 seconds, and denaturation at 95°C for 1 minute and then one final cycle with a 3-minute primer extension. The remainder of exon 11 was amplified with primers that have been described elsewhere.¹⁸

DNA sequencing was performed with the ABI Prism Big Dye Primer cycle-sequencing kit with Amplitaq DNA polymerase and an ABI 377 sequencer (all Perkin–Elmer Applied Biosystems). Data were analyzed with Sequence Navigator software, version 1.0.1 (Applied Biosystems).

Allele-Specific BsrI Digestion

The substitution of cytosine for guanine at nucleotide 1732 (G1732C) that encoded replacement of aspartic acid with histidine at amino acid position 578 (Asp578His) was detected by creating a new BsrI restriction-enzyme site (New England Biolabs, Beverly, Mass.) in the DNA sequence adjacent to the mutation. Amplification was conducted with the sense primer 5'GTGGAAACCACTCTCTCACAAGTCTA3' and the antisense primer 5'AAAAAAAGAGATAGGTGCCATGCAGGTGAACT3', in which adenine at one position was replaced by a cytosine (underlined). This variant oligonucleotide primer allowed BsrI digestion, converting a 210-bp PCR product into 176- and 34-bp fragments, only when the mutant allele was present.

Characterization of the Functional Properties of Mutant Luteinizing Hormone Receptor

The Asp578His mutation was generated in the complementary DNA (cDNA) for human luteinizing hormone receptor in the expression vector pSG5 with use of the Transformer Mutagenesis Kit (Clontech, Palo Alto, Calif.), and its presence was confirmed by sequencing. The wild-type DNA and mutant DNA were prepared with plasmid-purification kits (Qiagen, Chatsworth, Calif.). Lipofectamine (GIBCO–BRL, Gaithersburg, Md.) was used for the transient transfection of COS-7 cells (2x10⁶ in a 100-mm dish) with 10 µg of plasmid DNA.

Eighteen hours after transfection, the cells were replated for binding assays and assays of cAMP and inositol phosphate production, as previously described.¹⁹ Forty-eight hours after transfection, cAMP was measured by iodine-125 radioimmunoassay (Biomedical Technologies, Stoughton, Mass.). Total inositol phosphates were measured by means of anion-exchange column chromatography (Dowex AG1-X8, Bio-Rad, Richmond, Calif.). Data were analyzed with Prism software (version 2.0, GraphPad, San Diego, Calif.).

Results

In all three cases, the tumor was well circumscribed and was composed of nests of polygonal cells with abundant eosinophilic cytoplasm and round or ovoid nuclei. Mitotic activity was low, and Reinke's crystalloids were not seen. Immunohistochemical staining for p53 protein²⁰ was negative. Genomic DNA was extracted from the Leydig-cell adenoma, adjacent normal testis tissue, and blood leukocytes from Patient 1 (Figure 1A). PCR products encoding exon 11 of the luteinizing hormone–receptor gene, which includes the region of the gene that encodes the sixth transmembrane segment, were generated from these templates. DNA sequencing revealed a heterozygous guanine-to-cytosine mutation at nucleotide 1732 in the tumor only. This novel somatic mutation, resulting in the change of GAT to CAT, encodes replacement of the aspartic acid at position 578 of the receptor with histidine (Asp578His) (Figure 1A).

View larger version (71K): [in this window] [in a new window]   Figure 1. Microscopical Appearance and Results of DNA Analysis of Testicular Tissue from Boys with Leydig-Cell Tumors. On the left-hand side of Panel A, a cross section of a paraffin-embedded section of testis from Patient 1 is shown (hematoxylin and eosin, x2). Areas of tumor and adjacent normal testis tissue were dissected and analyzed separately. The results of direct sequencing of a short segment of the gene for the luteinizing hormone receptor from tumor, normal testis, and blood, after PCR amplification, are shown on the right-hand side of Panel A. A heterozygous guanine-to-cytosine (G/C) mutation that results in the replacement of aspartic acid with histidine at codon 578 was found only in the tumor specimen, indicating that the mutation is somatic. Panel B shows BsrI restriction-enzyme analysis of PCR products generated with a variant primer from specimens of tumor, normal testis, and blood from the three patients and blood from three unaffected control subjects. Only the tumor samples show the presence of both uncut (210-bp) and digested (176-bp) fragments.

 
Screening for BsrI digestion indicated that the Leydig-cell tumors from Patients 2 and 3 were also composed of cells that were heterozygous for the somatic mutation Asp578His (Figure 1B), findings that were subsequently confirmed by direct DNA sequencing. PCR products generated from 50 unaffected control subjects did not have evidence of digestion with BsrI (data not shown), indicating that the mutation is not a common polymorphism of the luteinizing hormone–receptor gene.

To assess the functional effects of the Asp578His mutation, wild-type and mutant forms of the luteinizing hormone receptor were transiently expressed in COS-7 cells, and the binding of chorionic gonadotropin and the production of cAMP and inositol phosphates were measured. The characteristics of receptors containing the Asp578His mutation were directly compared with those of receptors containing a tyrosine residue at this position in place of aspartic acid (Asp578Tyr) (Figure 2). The Asp578Tyr mutation is associated with severe precocious puberty in boys, characterized by diffuse Leydig-cell hyperplasia.^9,19,21 Binding experiments with iodine-125–labeled chorionic gonadotropin revealed that the receptor containing the Asp578His mutation was more highly expressed at the cell surface than the wild-type receptor (mean [±SE] maximal binding capacity, 402± 78 percent of wild type in five experiments) or that containing the Asp578Tyr mutation (maximal binding capacity, 279±17 percent of wild type), but its affinity for chorionic gonadotropin (dissociation constant, 1 nM) was similar to that of the latter two receptors (data not shown). The Asp578His mutation caused an agonist-independent increase in the basal production of cAMP (28±3 times the basal production in the wild-type receptor, or 80 percent of the maximal effect of chorionic gonadotropin in the wild-type receptor in four experiments), which was greater than that caused by Asp578Tyr (19±2 times the basal production in the wild-type receptor in four experiments) or any other known mutation of the luteinizing hormone receptor.^2,3,8,9,19 Moreover, the basal production of inositol phosphates in the Asp578His mutant was seven times that in the wild-type receptor (70 percent of the maximal effect of chorionic gonadotropin in four experiments). The maximal chorionic gonadotropin–stimulated production of inositol phosphates was also greater than that in the wild type. Basal inositol phosphate production was also increased in cells expressing a low concentration of Asp578His receptors (data not shown), indicating that a high level of constitutive activity is an intrinsic property of the Asp578His receptor and not merely a result of the overexpression of receptors.

View larger version (12K): [in this window] [in a new window]   Figure 2. Comparison of Receptors with the Asp578His or Asp578Tyr Mutation and the Wild-Type Receptor. Mean (±SE) basal and chorionic gonadotropin–stimulated accumulation of cAMP (Panel A) and inositol phosphates (Panel B) is shown in COS-7 cells transfected with DNA for the wild-type luteinizing hormone receptor or receptors with the Asp578Tyr or Asp578His mutation. Data in Panel A are means (±SE) from four experiments. Data in Panel B are from one representative experiment performed in triplicate. Basal activity of the wild-type luteinizing hormone receptor is the same as that of the pSG5 expression vector alone.19 Basal cAMP production of the wild-type receptor was 1.1±0.2 pmol per 105 cells, and basal inositol phosphate production was 431±67 cpm per 105 cells.

 
Discussion

Leydig-cell adenomas are one cause of gonadotropin-independent sexual precocity in boys, a condition that may also be mediated by virilizing forms of adrenal hyperplasia, adrenal tumors, tumors that produce chorionic gonadotropin, male-limited precocious puberty, and McCune–Albright syndrome (due to an activating mutation of arginine at position 201 in the subunit of G_s).^22,23,24 In boys with male-limited precocious puberty, signs of sexual development usually appear before the age of four years,²³ but in boys with Leydig-cell tumors, these signs typically appear later, between the ages of five and nine.¹¹ Because small testicular masses may not be palpable, all boys with gonadotropin-independent hypersecretion of testosterone and no family history of precocious puberty should undergo testicular ultrasonography.

The identification of a novel somatic mutation, Asp578His, in the gene encoding the luteinizing hormone receptor in three boys with Leydig-cell tumors provides a new example of how activating mutations of G protein–coupled receptors can cause disease.²⁵ As with the homologous thyrotropin receptor,¹⁴ it appears that somatic mutations of the gene for the luteinizing hormone receptor may be associated with a more highly activating phenotype than the hereditary mutations. Spontaneous Leydig-cell tumors are common in laboratory animals, and drugs that cause high serum luteinizing hormone concentrations can increase the incidence of Leydig-cell hyperplasia and adenomas in rodents.²⁶ In humans, Leydig-cell hyperplasia and tumors appear to be distinct entities.^22,27 Boys with precocious puberty due to activating mutations in the gene for the luteinizing hormone receptor have not been reported to be at increased risk for Leydig-cell tumors,²² although there is one documented occurrence of a testicular seminoma in such a patient.²⁸

The causes of Leydig-cell tumors are likely to be heterogeneous. Although luteinizing hormone signaling plays a major part in Leydig-cell proliferation, alterations in other local stimuli, including müllerian-duct inhibitory factor, inhibin, growth factors, and temperature, may also create conditions favorable to tumorigenesis.^5,29,30 The activating arginine-to-cysteine mutation Arg201Cys in the subunit of G_s was recently detected in Leydig-cell tumors from three adult women and one man, but not in a tumor from a boy with sexual precocity.³¹ In a preliminary screening, we have found the Asp578His mutation in three of five additional Leydig-cell tumors, but none had a mutation of arginine at position 201 (unpublished data). Although Leydig-cell tumors are not common in patients with McCune–Albright syndrome or male-limited precocious puberty, it is plausible that somatic mutations that promote increased cellular production of cAMP and an increased rate of cell division represent one early event in the neoplastic process.³²

The adenoma-associated mutation occurs at the conserved aspartic acid residue at position 578, where substitution by glycine has been found to cause the most common form of male-limited precocious puberty (characterized by patchy Leydig-cell hyperplasia) and where substitution by tyrosine has been associated with a more severe clinical phenotype (characterized by diffuse Leydig-cell hyperplasia).^9,21

Under normal conditions, hormone-mediated activation of the luteinizing hormone receptor in Leydig cells probably does not result in stimulation of the phospholipase C pathway.^1,4 Because the main feature that distinguishes the Asp578His mutation from receptor mutations associated with Leydig-cell hyperplasia is its ability to activate this pathway (Figure 2B), it is tempting to speculate that neoplastic transformation of Leydig cells involves inappropriate costimulation or synergism of the cAMP and phospholipase C pathways. Costimulation of these pathways by a constitutively active mutant _1B-adrenergic–receptor transgene has been implicated in animals with thyroid neoplasia.³³ Furthermore, a somatic mutation corresponding to Asp578His in the thyrotropin receptor (Asp633His) has been described in a patient with a rare, autonomously hyperfunctioning insular thyroid carcinoma that had metastasized to a cervical lymph node and to the lungs.³⁴ The Asp633His mutation in the thyrotropin receptor also has been found to cause constitutive activation of both the cAMP and phospholipase C pathways (unpublished data). Many other receptors coupled to the activation of phospholipase C stimulate cell proliferation and transformation, although these effects may in fact be independent of traditional signaling pathways.^35,36

Supported by grants from the American Cancer Society (IRG-93-037-04, to the Robert H. Lurie Comprehensive Cancer Center, and Illinois Division grant 98-31, to Dr. Shenker), the National Institutes of Health (5T32-DK07169-19A1), the French Ministry of Foreign Affairs (a Lavoisier grant, to Dr. Duranteau), and the Philippe Foundation (to Dr. Duranteau). Dr. Shenker is the Crown Family Young Investigator in Developmental Systems Biology.

We are indebted to Dr. David Walterhouse, Dr. Barry Rich, Dr. Jean Bienaymé, Dr. Bernard Boudailliez, and Michele Irving for referral of patients; to Dr. Ritu Nayar, Dr. Susan Crawford, Dr. Pauline Chou, Dr. Frank Gonzalez-Crussi, and Dr. Patrick Barbet for performing the histologic analyses; to Tom Kotlar, Dr. Peter Kopp, Dr. Larry Jameson, and Dr. Angelo DiGeorge for valuable suggestions; and to the National Hormone and Pituitary Program for supplying chorionic gonadotropin.

Source Information

From the Division of Endocrinology, Department of Pediatrics, Northwestern University Medical School and Children's Memorial Institute for Education and Research, Chicago (G.L., L.D., J.M., A.S.); the Service d'Endocrinologie Pédiatrique, Groupe Hospitalier Cochin–Saint Vincent de Paul, Paris (J.-C.C.); and the Division of Pediatric Endocrinology, Temple University Children's Medical Center, Philadelphia (D.A.D.).

Address reprint requests to Dr. Shenker at Children's Memorial Hospital, 2300 Children's Plaza, Box 225, Chicago, IL 60614, or at ashenker{at}nwu.edu.

References

1. Segaloff DL, Ascoli M. The lutropin/choriogonadotropin recep-tor . . . 4 years later. Endocr Rev 1993;14:324-347. [Abstract]
2. Themmen APN, Brunner HG. Luteinizing hormone receptor mutations and sex differentiation. Eur J Endocrinol 1996;134:533-540. [Abstract]
3. Chan W-Y. Molecular genetic, biochemical, and clinical implications of gonadotropin receptor mutations. Mol Genet Metab 1998;63:75-84. [CrossRef][Medline]
4. Dufau ML. The luteinizing hormone receptor. Annu Rev Physiol 1998;60:461-496. [CrossRef][Medline]
5. Lejeune H, Habert R, Saez JM. Origin, proliferation and differentiation of Leydig cells. J Mol Endocrinol 1998;20:1-25. [CrossRef][Medline]
6. Herrlich A, Kühn B, Grosse R, Schmid A, Schultz G, Gudermann T. Involvement of G_s and G_i proteins in dual coupling of the luteinizing hormone receptor to adenylyl cyclase and phospholipase C. J Biol Chem 1996;271:16764-16772. [Free Full Text]
7. Latronico AC, Anasti J, Arnhold IJP, et al. Testicular and ovarian resistance to luteinizing hormone caused by inactivating mutations of the luteinizing hormone-receptor gene. N Engl J Med 1996;334:507-512. [Free Full Text]
8. Shenker A, Laue L, Kosugi S, Merendino JJ Jr, Minegishi T, Cutler GB Jr. A constitutively activating mutation of the luteinizing hormone receptor in familial male precocious puberty. Nature 1993;365:652-654. [CrossRef][Medline]
9. Laue L, Chan W-Y, Hsueh AJW, et al. Genetic heterogeneity of constitutively activating mutations of the human luteinizing hormone receptor in familial male-limited precocious puberty. Proc Natl Acad Sci U S A 1995;92:1906-1910. [Free Full Text]
10. Kim I, Young RH, Scully RE. Leydig cell tumors of the testis: a clinicopathological analysis of 40 cases and review of the literature. Am J Surg Pathol 1985;9:177-192. [Medline]
11. Scully RE. Testicular tumors with endocrine manifestations. In: DeGroot LJ, ed. Endocrinology. 3rd ed. Philadelphia: W.B. Saunders, 1995:2442-8.
12. Huseby RA. Leydig cell neoplasia. In: Payne AH, Hardy MP, Rus-sell LD, eds. The Leydig cell. Vienna, Ill.: Cache River Press, 1996:555-71.
13. Paschke R, Ludgate M. The thyrotropin receptor in thyroid diseases. N Engl J Med 1997;337:1675-1681. [Free Full Text]
14. Parma J, Duprez L, Van Sande J, et al. Diversity and prevalence of somatic mutations in the thyrotropin receptor and G_s genes as a cause of toxic thyroid adenomas. J Clin Endocrinol Metab 1997;82:2695-2701. [Free Full Text]
15. Greulich WW, Pyle SI. Radiographic atlas of skeletal development of the hand and wrist. 2nd ed. Stanford, Calif.: Stanford University Press, 1959.
16. Marshall WA, Tanner JM. Variations in the pattern of pubertal changes in boys. Arch Dis Child 1970;45:13-23.
17. Sarkar FH, Li YW, Crissman JD. A method for PCR sequencing of the p53 gene from a single 10-microns frozen or paraffin-embedded tissue section. Biotechniques 1993;15:36-38. [Medline]
18. Atger M, Misrahi M, Sar S, Le Flem L, Dessen P, Milgrom E. Structure of the human luteinizing hormone-choriogonadotropin receptor gene: unusual promoter and 5' non-coding regions. Mol Cell Endocrinol 1995;111:113-123. [CrossRef][Medline]
19. Kosugi S, Mori T, Shenker A. The role of Asp⁵⁷⁸ in maintaining the inactive conformation of the human lutropin/choriogonadotropin receptor. J Biol Chem 1996;271:31813-31817. [Free Full Text]
20. McCluggage WG, Shanks JH, Arthur K, Banerjee SS. Cellular proliferation and nuclear ploidy assessments augment established prognostic factors in predicting malignancy in testicular Leydig cell tumours. Histopathology 1998;33:361-368. [CrossRef][Medline]
21. Müller J, Gondos B, Kosugi S, Mori T, Shenker A. Severe testotoxicosis phenotype associated with Asp⁵⁷⁸Tyr mutation of the lutrophin/choriogonadotrophin receptor gene. J Med Genet 1998;35:340-341. [Abstract]
22. Wilson BE, Netzloff ML. Primary testicular abnormalities causing precocious puberty Leydig cell tumor, Leydig cell hyperplasia, and adrenal rest tumor. Ann Clin Lab Sci 1983;13:315-320. [Abstract]
23. Holland FJ. Gonadotropin-independent precocious puberty. Endocrinol Metab Clin North Am 1991;20:191-210. [Medline]
24. Weinstein LS, Shenker A, Gejman PV, Merino MJ, Friedman E, Spiegel AM. Activating mutations of the stimulatory G protein in the McCune-Albright syndrome. N Engl J Med 1991;325:1688-1695. [Abstract]
25. Spiegel AM. Mutations in G proteins and G protein-coupled receptors in endocrine disease. J Clin Endocrinol Metab 1996;81:2434-2442. [CrossRef][Medline]
26. Clegg ED, Cook JC, Chapin RE, Foster PMD, Daston GP. Leydig cell hyperplasia and adenoma formation: mechanisms and relevance to humans. Reprod Toxicol 1997;11:107-121. [CrossRef][Medline]
27. Naughton CK, Nadler RB, Basler JW, Humphrey PA. Leydig cell hyperplasia. Br J Urol 1998;81:282-289. [Medline]
28. Martin MM, Wu S-M, Martin ALA, Rennert OM, Chan W-Y. Testicular seminoma in a patient with a constitutively activating mutation of the luteinizing hormone/chorionic gonadotropin receptor. Eur J Endocrinol 1998;139:101-106. [Abstract]
29. Matzuk MM, Finegold MJ, Mishina Y, Bradley A, Behringer RR. Synergistic effects of inhibins and mullerian-inhibiting substance on testicular tumorigenesis. Mol Endocrinol 1995;9:1337-1345. [Abstract]
30. Wu N, Murono EP. Temperature and germ cell regulation of Leydig cell proliferation stimulated by Sertoli cell-secreted mitogenic factor: a possible role in cryptorchidism. Andrologia 1996;28:247-257. [Medline]
31. Fragoso MCBV, Latronico AC, Carvalho FM, et al. Activating mutation of the stimulatory G protein (gsp) as a putative cause of ovarian and testicular human stromal Leydig cell tumors. J Clin Endocrinol Metab 1998;83:2074-2078. [Free Full Text]
32. Studer H, Derwahl M. Mechanisms of nonneoplastic endocrine hyperplasia -- a changing concept: a review focused on the thyroid gland. Endocr Rev 1995;16:411-426. [Abstract]
33. Ledent C, Denef J-F, Cottecchia S, et al. Costimulation of adenylyl cyclase and phospholipase C by a mutant _1B-adrenergic receptor transgene promotes malignant transformation of thyroid follicular cells. Endocrinology 1997;138:369-378. [Free Full Text]
34. Russo D, Tumino S, Arturi F, et al. Detection of an activating mutation of the thyrotropin receptor in a case of an autonomously hyperfunctioning thyroid insular carcinoma. J Clin Endocrinol Metab 1997;82:735-738. [Free Full Text]
35. Moolenaar WH. G-protein-coupled receptors, phosphoinositide hydrolysis, and cell proliferation. Cell Growth Differ 1991;2:359-364. [Medline]
36. van Biesen T, Luttrell LM, Hawes BE, Lefkowitz RJ. Mitogenic signaling via G protein-coupled receptors. Endocr Rev 1996;17:698-714. [CrossRef][Medline]

PDF Editorial by Brunner, H. G. Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited PubMed Citation

This article has been cited by other articles:

• Liao, M., Zhang, Y., Dufau, M. L. (2008). Protein Kinase C{alpha}-Induced Derepression of the Human Luteinizing Hormone Receptor Gene Transcription through ERK-Mediated Release of HDAC1/Sin3A Repressor Complex from Sp1 Sites. Mol. Endocrinol. 22: 1449-1463 [Abstract] [Full Text]  
• Carel, J.-C., Leger, J. (2008). Precocious Puberty. NEJM 358: 2366-2377 [Full Text]  
• Meng, X.-L., Rennert, O. M., Chan, W.-Y. (2007). Human Chorionic Gonadotropin Induces Neuronal Differentiation of PC12 Cells through Activation of Stably Expressed Lutropin/Choriogonadotropin Receptor. Endocrinology 148: 5865-5873 [Abstract] [Full Text]  
• Zhang, M., Tao, Y.-X., Ryan, G. L., Feng, X., Fanelli, F., Segaloff, D. L. (2007). Intrinsic Differences in the Response of the Human Lutropin Receptor Versus the Human Follitropin Receptor to Activating Mutations. J. Biol. Chem. 282: 25527-25539 [Abstract] [Full Text]  
• Shiraishi, K., Ascoli, M. (2007). Lutropin/Choriogonadotropin Stimulate the Proliferation of Primary Cultures of Rat Leydig Cells through a Pathway that Involves Activation of the Extracellularly Regulated Kinase 1/2 Cascade. Endocrinology 148: 3214-3225 [Abstract] [Full Text]  
• Nurwakagari, P., Breit, A., Hess, C., Salman-Livny, H., Ben-Menahem, D., Gudermann, T. (2007). A conformational contribution of the luteinizing hormone-receptor ectodomain to receptor activation. J Mol Endocrinol 38: 259-275 [Abstract] [Full Text]  
• Carvajal-Carmona, L. G., Alam, N. A., Pollard, P. J., Jones, A. M., Barclay, E., Wortham, N., Pignatelli, M., Freeman, A., Pomplun, S., Ellis, I., Poulsom, R., El-Bahrawy, M. A., Berney, D. M., Tomlinson, I. P. M. (2006). Adult Leydig Cell Tumors of the Testis Caused by Germline Fumarate Hydratase Mutations. J. Clin. Endocrinol. Metab. 91: 3071-3075 [Abstract] [Full Text]  
• Veldhuis, J. D., Roemmich, J. N., Richmond, E. J., Bowers, C. Y. (2006). Somatotropic and Gonadotropic Axes Linkages in Infancy, Childhood, and the Puberty-Adult Transition. Endocr. Rev. 27: 101-140 [Abstract] [Full Text]  
• Mizutani, T., Shiraishi, K., Welsh, T., Ascoli, M. (2006). Activation of the Lutropin/Choriogonadotropin Receptor in MA-10 Cells Leads to the Tyrosine Phosphorylation of the Focal Adhesion Kinase by a Pathway that Involves Src Family Kinases. Mol. Endocrinol. 20: 619-630 [Abstract] [Full Text]  
• Wettschureck, N., Offermanns, S. (2005). Mammalian G Proteins and Their Cell Type Specific Functions. Physiol. Rev. 85: 1159-1204 [Abstract] [Full Text]  
• Themmen, A. P N (2005). An update of the pathophysiology of human gonadotrophin subunit and receptor gene mutations and polymorphisms. Reproduction 130: 263-274 [Abstract] [Full Text]  
• Rulli, S. B, Huhtaniemi, I. (2005). What have gonadotrophin overexpressing transgenic mice taught us about gonadal function?. Reproduction 130: 283-291 [Abstract] [Full Text]  
• Marx, S. J., Simonds, W. F. (2005). Hereditary Hormone Excess: Genes, Molecular Pathways, and Syndromes. Endocr. Rev. 26: 615-661 [Abstract] [Full Text]  
• Meehan, T. P, Harmon, B. G, Overcast, M. E, Yu, K. K, Camper, S. A, Puett, D., Narayan, P. (2005). Gonadal defects and hormonal alterations in transgenic mice expressing a single chain human chorionic gonadotropin-lutropin receptor complex. J Mol Endocrinol 34: 489-503 [Abstract] [Full Text]  
• Piaditis, G., Angellou, A., Kontogeorgos, G., Mazarakis, N., Kounadi, T., Kaltsas, G., Vamvakidis, K., Lloyd, R. V., Horvath, E., Kovacs, K. (2005). Ectopic Bioactive Luteinizing Hormone Secretion by a Pancreatic Endocrine Tumor, Manifested as Luteinized Granulosa-Thecal Cell Tumor of the Ovaries. J. Clin. Endocrinol. Metab. 90: 2097-2103 [Abstract] [Full Text]  
• Basciani, S., Brama, M., Mariani, S., De Luca, G., Arizzi, M., Vesci, L., Pisano, C., Dolci, S., Spera, G., Gnessi, L. (2005). Imatinib Mesylate Inhibits Leydig Cell Tumor Growth: Evidence for In vitro and In vivo Activity. Cancer Res. 65: 1897-1903 [Abstract] [Full Text]  
• Samson, M., Peale, F. V. Jr., Frantz, G., Rioux-Leclercq, N., Rajpert-De Meyts, E., Ferrara, N. (2004). Human Endocrine Gland-Derived Vascular Endothelial Growth Factor: Expression Early in Development and in Leydig Cell Tumors Suggests Roles in Normal and Pathological Testis Angiogenesis. J. Clin. Endocrinol. Metab. 89: 4078-4088 [Abstract] [Full Text]  
• Bastepe, M., Raas-Rothschild, A., Silver, J., Weissman, I., Wientroub, S., Juppner, H., Gillis, D. (2004). A Form of Jansen's Metaphyseal Chondrodysplasia with Limited Metabolic and Skeletal Abnormalities Is Caused by a Novel Activating Parathyroid Hormone (PTH)/PTH-Related Peptide Receptor Mutation. J. Clin. Endocrinol. Metab. 89: 3595-3600 [Abstract] [Full Text]  
• Hirakawa, T., Ascoli, M. (2003). The Lutropin/Choriogonadotropin Receptor-Induced Phosphorylation of the Extracellular Signal-Regulated Kinases in Leydig Cells Is Mediated by a Protein Kinase A-Dependent Activation of Ras. Mol. Endocrinol. 17: 2189-2200 [Abstract] [Full Text]  
• Rulli, S. B., Ahtiainen, P., Makela, S., Toppari, J., Poutanen, M., Huhtaniemi, I. (2003). Elevated Steroidogenesis, Defective Reproductive Organs, and Infertility in Transgenic Male Mice Overexpressing Human Chorionic Gonadotropin. Endocrinology 144: 4980-4990 [Abstract] [Full Text]  
• Collins, M. T., Sarlis, N. J., Merino, M. J., Monroe, J., Crawford, S. E., Krakoff, J. A., Guthrie, L. C., Bonat, S., Robey, P. G., Shenker, A. (2003). Thyroid Carcinoma in the McCune-Albright Syndrome: Contributory Role of Activating Gs{alpha} Mutations. J. Clin. Endocrinol. Metab. 88: 4413-4417 [Abstract] [Full Text]  
• Hirakawa, T., Ascoli, M. (2003). A Constitutively Active Somatic Mutation of the Human Lutropin Receptor Found in Leydig Cell Tumors Activates the Same Families of G Proteins as Germ Line Mutations Associated with Leydig Cell Hyperplasia. Endocrinology 144: 3872-3878 [Abstract] [Full Text]  
• Sangkuhl, K., Schulz, A., Schultz, G., Schoneberg, T. (2002). Structural Requirements for Mutational Lutropin/Choriogonadotropin Receptor Activation. J. Biol. Chem. 277: 47748-47755 [Abstract] [Full Text]  
• Als, C., Gedeon, P., Rosler, H., Minder, C., Netzer, P., Laissue, J. A. (2002). Survival Analysis of 19 Patients with Toxic Thyroid Carcinoma. J. Clin. Endocrinol. Metab. 87: 4122-4127 [Abstract] [Full Text]  
• Angelova, K., Fanelli, F., Puett, D. (2002). A Model for Constitutive Lutropin Receptor Activation Based on Molecular Simulation and Engineered Mutations in Transmembrane Helices 6 and 7. J. Biol. Chem. 277: 32202-32213 [Abstract] [Full Text]  
• Chu, S., Rushdi, S., Zumpe, E.T., Mamers, P., Healy, D.L., Jobling, T., Burger, H.G., Fuller, P.J. (2002). FSH-regulated gene expression profiles in ovarian tumours and normal ovaries. Mol Hum Reprod 8: 426-433 [Abstract] [Full Text]  
• Ascoli, M., Fanelli, F., Segaloff, D. L. (2002). The Lutropin/Choriogonadotropin Receptor, A 2002 Perspective. Endocr. Rev. 23: 141-174 [Abstract] [Full Text]  
• Rannikko, A., Pakarinen, P., Manna, P. R., Beau, I., Misrahi, M., Aittomaki, K., Huhtaniemi, I. (2002). Functional characterization of the human FSH receptor with an inactivating Ala189Val mutation. Mol Hum Reprod 8: 311-317 [Abstract] [Full Text]  
• Richter-Unruh, A., Wessels, H. T., Menken, U., Bergmann, M., Schmittmann-Ohters, K., Schaper, J., Tappeser, S., Hauffa, B. P. (2002). Male LH-Independent Sexual Precocity in a 3.5-Year-Old Boy Caused by a Somatic Activating Mutation of the LH Receptor in a Leydig Cell Tumor. J. Clin. Endocrinol. Metab. 87: 1052-1056 [Abstract] [Full Text]  
• Hirakawa, T., Galet, C., Ascoli, M. (2002). MA-10 Cells Transfected with the Human Lutropin/Choriogonadotropin Receptor (hLHR): A Novel Experimental Paradigm to Study the Functional Properties of the hLHR. Endocrinology 143: 1026-1035 [Abstract] [Full Text]  
• Manna, P. R., Joshi, L., Reinhold, V. N., Aubert, M. L., Suganuma, N., Pettersson, K., Huhtaniemi, I. T. (2002). Synthesis, purification and structural and functional characterization of recombinant form of a common genetic variant of human luteinizing hormone. Hum Mol Genet 11: 301-315 [Abstract] [Full Text]  
• Choong, C. S., Fuller, P. J., Chu, S., Jeske, Y., Bowling, F., Brown, R., Borzi, P., Balazs, N. D., Suppiah, R., Cotterill, A. M., Payton, D., Robertson, D. M., Burger, H. G. (2002). Sertoli-Leydig Cell Tumor of the Ovary, a Rare Cause of Precocious Puberty in a 12-Month-Old Infant. J. Clin. Endocrinol. Metab. 87: 49-56 [Abstract] [Full Text]  
• Neumann, S., Krause, G., Chey, S., Paschke, R. (2001). A Free Carboxylate Oxygen in the Side Chain of Position 674 in Transmembrane Domain 7 Is Necessary for TSH Receptor Activation. Mol. Endocrinol. 15: 1294-1305 [Abstract] [Full Text]  
• Huhtaniemi, I., Bartke, A. (2001). Perspective: Male Reproduction. Endocrinology 142: 2178-2183 [Full Text]  
• Bebia, Z., Somers, J. P., Liu, G., Ihrig, L., Shenker, A., Zeleznik, A. J. (2001). Adenovirus-Directed Expression of Functional Luteinizing Hormone (LH) Receptors in Undifferentiated Rat Granulosa Cells: Evidence for Differential Signaling through Follicle-Stimulating Hormone and LH Receptors. Endocrinology 142: 2252-2259 [Abstract] [Full Text]  
• Jorge, B. H., Agarwal, S. K., Lando, V. S., Salvatori, R., Barbero, R. R., Abelin, N., Levine, M. A., Marx, S. J., Toledo, S. P. A. (2001). Study of the Multiple Endocrine Neoplasia Type 1, Growth Hormone-Releasing Hormone Receptor, Gs{{alpha}}, and Gi2{{alpha}} Genes in Isolated Familial Acromegaly. J. Clin. Endocrinol. Metab. 86: 542-544 [Abstract] [Full Text]  
• Min, L., Ascoli, M. (2000). Effect of Activating and Inactivating Mutations on the Phosphorylation and Trafficking of the Human Lutropin/Choriogonadotropin Receptor. Mol. Endocrinol. 14: 1797-1810 [Abstract] [Full Text]  
• Themmen, A. P. N., Huhtaniemi, I. T. (2000). Mutations of Gonadotropins and Gonadotropin Receptors: Elucidating the Physiology and Pathophysiology of Pituitary-Gonadal Function. Endocr. Rev. 21: 551-583 [Abstract] [Full Text]  
• Tao, Y.-X., Abell, A. N., Liu, X., Nakamura, K., Segaloff, D. L. (2000). Constitutive Activation of G Protein-Coupled Receptors as a Result of Selective Substitution of a Conserved Leucine Residue in Transmembrane Helix III. Mol. Endocrinol. 14: 1272-1282 [Abstract] [Full Text]  
• Brunner, H. G., Otten, B. J. (1999). Precocious Puberty in Boys. NEJM 341: 1763-1765 [Full Text]  
• Min, L., Galet, C., Ascoli, M. (2002). The Association of Arrestin-3 with the Human Lutropin/Choriogonadotropin Receptor Depends Mostly on Receptor Activation Rather than on Receptor Phosphorylation. J. Biol. Chem. 277: 702-710 [Abstract] [Full Text]