Desmin Myopathy, a Skeletal Myopathy with Cardiomyopathy Caused by Mutations in the Desmin Gene
Marinos C. Dalakas, M.D., Kye-Yoon Park, Ph.D., Cristina Semino-Mora, M.D., Ph.D., Hee Suk Lee, M.D., Kumaraswamy Sivakumar, M.D., and Lev G. Goldfarb, M.D.
Background Myofibrillar myopathies are a heterogeneous groupof inherited or sporadic skeletal myopathies associated withcardiomyopathy. Among the myofibrillar proteins that accumulatewithin the muscle fibers of affected patients, the one foundmost consistently is desmin, an intermediate-filament proteinresponsible for the structural integrity of the myofibrils.Skeletal and cardiac myopathy develops in mice that lack desmin,suggesting that mutations in the desmin gene may be pathogenic.
Methods We examined 22 patients from 8 families with dominantlyinherited myofibrillar or desmin-related myopathy and 2 patientswith sporadic disease and analyzed the desmin gene for mutations,using complementary DNA (cDNA) amplified from muscle-biopsyspecimens and genomic DNA extracted from blood lymphocytes.Restriction-enzyme analysis was used to confirm the mutations.Expression vectors containing normal or mutant desmin cDNA wereintroduced into cultured cells to determine whether the mutantdesmin formed intermediate filaments.
Results Six missense mutations in the coding region of the desmingene that cause the substitution of an amino acid were identifiedin 11 patients (10 members of 4 families and 1 patient withsporadic disease); a splicing defect that resulted in the deletionof exon 3 was identified in the other patient with sporadicdisease. Mutations were clustered in the carboxy-terminal partof the rod domain, which is critical for filament assembly.In transfected cells, the mutant desmin was unable to form afilamentous network. Seven of the 12 patients with mutationsin the desmin gene had cardiomyopathy.
Conclusions Mutations in the desmin gene affecting intermediatefilaments cause a distinct myopathy that is often associatedwith cardiomyopathy and is termed "desmin myopathy." The mutantdesmin interferes with the normal assembly of intermediate filaments,resulting in fragility of the myofibrils and severe dysfunctionof skeletal and cardiac muscles.
Myofibrillar or desmin-related myopathies are a heterogeneousgroup of severe, dominantly inherited, skeletal myopathies,often accompanied by cardiomyopathy, that result in syncopalepisodes or sudden death due to conduction defects.1,2,3,4,5They can be difficult to recognize because of the heterogeneityof the clinical characteristics among families and within familiesand the lack of diagnostic specificity of the findings on musclebiopsy. Various myofibrillar proteins, including desmin, dystrophin,vimentin, ß-spectrin, and gelsolin, accumulate inthe muscle fibers of affected patients,1,2,3 but the role ofthese proteins in the degeneration of muscle fibers is unknown.Among these proteins, desmin, a 52-kd protein, has been linkedto desmin-related myopathy because it is consistently presentand unusually abundant in patients with this disorder.1,2,3Desmin is the chief intermediate filament of skeletal and cardiacmuscle,6,7 maintains the structural and functional integrityof the myofibrils, and functions as a cytoskeletal protein linkingZ bands to the plasma membrane. A skeletal and cardiac myopathydevelops in mice that lack desmin,8,9,10 supporting the importanceof this protein in maintaining the structural integrity of themuscle.
Support for the concept that mutant desmin may cause some casesof myofibrillar or desmin-related myopathy is provided by recentfindings of missense mutations in the desmin gene in three families11,12and by the demonstrated inability of the mutant desmin to producea network of intermediate filaments.12 We describe 12 patients,10 with familial disease and 2 with sporadic disease, who wereidentified among 24 patients with myofibrillar or desmin-relatedmyopathy and who had pathogenic mutations in the desmin gene;these findings provide evidence that such mutations cause adistinct subtype, termed "desmin myopathy."
Methods
Patients
Patients were admitted to the Neuromuscular Diseases Sectionof the National Institute of Neurological Disorders and Strokeaccording to an approved clinical protocol and after providingwritten informed consent. Twenty-two patients from eight familieswith dominantly inherited myofibrillar or desmin-related myopathyand two additional patients with no family history of myopathywere studied clinically, histologically, and genetically. Table 1lists the clinical and laboratory characteristics of 10 patientswith familial cases from 4 families (Families 1, 2, 3, and 4)and 2 patients with sporadic cases (Patients 5 and 6) in whommutations were identified in the desmin gene.
Table 1. Characteristics of 12 Patients with Desmin Myopathy.
In all 12 of these patients, muscle weakness began distallyat a mean age of 28 years (range, 20 to 43) and progressed toproximal muscles, causing them varying degrees of difficultywalking, climbing the stairs, raising their arms, or using theirhands. The severity of weakness differed among the patientsand within members of the same family. Four patients becamewheelchair-bound, and five required a walker or foot braces(Table 1). Dysphagia and weakness of the bulbar, facial, neck,and pectoralis muscles developed in seven patients, and twohad respiratory-muscle weakness. Serum creatine kinase levelswere mildly elevated in five patients (Table 1). All had normalsensation. In all patients, electromyographic studies showedmyopathy and muscle biopsy demonstrated a myopathy with bluishaccumulations on trichrome staining (Figure 1A) and strong immunoreactivityon staining with antibodies against desmin, indicative of desmindeposits (Figure 1B).
Figure 1. Serial, Transverse Cross Sections of a Muscle-Biopsy Specimen from a Patient with Desmin Myopathy.
The biopsy specimen is from the proband in Family 1. The dark-blue inclusions identified on trichrome staining (Panel A, x450) were immunoreactive for desmin (Panel B, x450). The faint accumulations around a vacuolated fiber in Panel A were also strongly immunoreactive. Electron-microscopical examination showed prominent streaming of Z bands (Panel C, x10,000) and aggregates of amorphous masses (Panel D, x40,000).
Six patients had cardiac-conduction defects, and five had syncopalepisodes that necessitated the implantation of a pacemaker (Table 1).In all three patients in Family 2 and in one of the twopatients with sporadic cases (Patient 6), cardiomyopathy precededskeletal myopathy by a mean of 12 years (range, 3 to 20). Inthe proband in Family 3, mitral-valve prolapse and mitral andtricuspid regurgitation developed 8 years after the onset ofskeletal myopathy, and in the proband in Family 1, cardiac-conductiondefects developed 22 years after the onset of skeletal myopathy.Two of the three patients in Family 2 died in their 30s of restrictivecardiomyopathy.
The father and two paternal uncles of the proband in Family1 had initially been given a diagnosis of CharcotMarieToothdisease after the development of distal-muscle weakness, anddied in their 40s and 50s. The father of the three siblingsstudied in Family 2 died of a myocardial infarction at the ageof 49 years. Patients 5 and 6 had no family history of myopathyand were not related.
In the other 12 patients with myofibrillar or desmin-relatedmyopathy who did not have mutations in the desmin gene, themyopathy was clinically and histologically similar to that ofthe patients with desmin myopathy, except that the disease occurredlater in life (mean age, 39 years) and there was no cardiomyopathy.
Histologic Analysis, Electron Microscopy, and Immunocytochemistry
Muscle biopsies were performed in all patients. Specimens wereprocessed for enzyme histochemistry and immunocytochemistryas described previously.13 Serial sections that were 5 µmthick were stained with modified Gomori trichrome or with antibodiesagainst desmin at a dilution of 1:100 (clone D33, Dako), antibodiesagainst dystrophin at a dilution of 1:50 (clones Dy4/6D3 andDy8/6C5, Novocastra Laboratories), antibodies against vimentinat a dilution of 1:200 (clone V9, Zymed), and antibodies againstß-spectrin at a dilution of 1:100 (clone RB2/3D5,Novocastra Laboratories). For secondary antibodies, fluorescein-conjugatedgoat antimouse IgG or rhodamine-conjugated goat antimouse IgGwas used. Muscle specimens were also processed for electronmicroscopy as described previously.13
Mutation Analysis
Total RNA was isolated from the muscle-biopsy specimens withthe use of a kit (RNeasy kit, Qiagen). Reverse transcriptionwas performed with 3 µg of total RNA according to themanufacturer's instructions (SuperScript II reverse transcriptasekit, GIBCO BRL), followed by the polymerase chain reaction (PCR)with the desmin-specific primers dF (5'CCGTCACCATGAGCCAGG3')and dR (5'AGAGGGTCTCTCGTCTTTAG3').11,14 Amplification was carriedout in a total volume of 20 µl containing 1 µl ofsingle-stranded complementary DNA (cDNA), 0.5 µM of eachprimer, 125 µM of each deoxynucleotide triphosphate, 1.5mM magnesium chloride, 10 mM TRIShydrochloric acid (pH8.3), 50 mM potassium chloride, and 0.6 unit of rTth polymerase(PerkinElmer Cetus). The resulting DNA fragments werepurified (Qiaex II gel extraction kit, Qiagen) and cloned intothe TA cloning vector (Invitrogen). Both strands were sequencedin at least nine clones.
Blood samples were obtained from the patients, their relatives,and normal subjects and stored in heparin-treated tubes. GenomicDNA extracted from these blood samples was used as the templatefor the PCR assay, with primers specific for the desmin sequencesconstructed for separate exons. Amplification was carried outwith use of a procedure designed for each exon. The resultantDNA fragments were subcloned (TA Cloning Kit, Invitrogen), andboth strands were sequenced in at least six clones. Sequencingof cloned DNA and cDNA was performed according to the manufacturer'sinstructions (DyePrimer Sequencing, PerkinElmer Cetus)on an automated DNA sequencer (model 373A, Applied Biosystems).
The same amplicons were also digested with restriction endonucleases(BsaHI, Bsp1286I, NcoI, Sbf I, BsaWI, and RsaI, New EnglandBiolabs, and TaiI, MBI Fermentas) according to the manufacturer'sinstructions and subjected to electrophoresis on a 4 percentagarose gel with a low melting point (NuSieve GTG, FMC BioProducts).To determine whether these mutations are common DNA variations,we screened 150 to 211 healthy unrelated control subjects fromAmerican and European populations for these mutations.
Mutations in the B-crystallin gene, which encodes a chaperoneprotein, were screened by direct sequencing of the PCR productsof each exon. Amplification was accomplished with the use ofprimers and PCR conditions as described previously.15
Expression of Desmin in Cultured Cells
Expression vectors for normal and mutant desmin were introducedinto SW13 (vimentin-negative) cells. Since these cells do notexpress the intermediate filaments desmin, vimentin, or keratin,they are ideal for an assessment of whether the mutated desmincan form a network of intermediate filaments. The DNA fragmentencompassing desmin cDNA, including the start and stop codons,was amplified by reverse-transcription PCR (RT-PCR) and clonedinto the pCR2.1 expression vector. The entire sequence of eachclone was verified by sequence analysis. Desmin expression vectorswere constructed for each identified mutation by cloning a 1.5-kbHind IIIXhoI fragment of the pCR2.1 clone containingeither normal or mutant desmin cDNA into the mammalian expressionvector pcDNA3.1. The SW13 (vimentin-negative) cells were grownto 50 percent confluence with Dulbecco's minimal essential mediumcontaining 10 percent fetal-calf serum and transfected withthe use of a transfection reagent (Effectene, Qiagen). Forty-eighthours after transfection, the cells were washed, exposed to4 percent paraformaldehyde for 15 minutes, and incubated withhuman desmin monoclonal antibody (D1033, Sigma) for 16 hoursat 4°C. For the secondary antibody, rhodamine-conjugatedantimouse IgG (T7657, Sigma) was used. The cells were observedand photographed under a confocal microscope. Transfected cellsfrom all mutations were also processed for electron microscopy.13
Results
Light-Microscopical, Immunocytochemical, and Ultrastructural Findings
The most consistent finding in every muscle-biopsy specimenwas the presence of bluish accumulations in subsarcolemmal orcentrally located areas (Figure 1A). In serial sections, theseaccumulations were strongly immunoreactive on staining withantibodies against desmin (Figure 1B). The number of fiberswith desmin-positive accumulations varied among specimens anddid not correlate with the severity of muscle weakness. Alldesmin-positive regions were also strongly positive for dystrophinand variably positive for vimentin or ß-spectrin,as reported previously.1,2,3 Vacuoles (Figure 1), many of themred-rimmed, and small aggregates of rods were observed in specimensfrom five of six patients. Multiple nuclei, atrophic fibers,and cytoplasmic bodies were common. On electron microscopy,myofibrillar disruption, fragments of thin and thick filaments,streaming Z bands, and deposits of dense, amorphous material(Figure 1C and Figure 1D) were prominent in all specimens examined.Accumulations of intermediate filaments were not observed.
Analysis of the Desmin Gene Sequences
The length of the RT-PCRamplified transcripts from eachof the muscle-biopsy specimens, except for those from Patient6, was 1437 bp. This was also the length of transcripts fromthe control samples and suggests the absence of splicing errors.Patient 6 had a smaller cDNA fragment of 1341 bp, in additionto a normal 1437-bp fragment, suggesting the occurrence of aheterozygous deletion. The cDNA-sequence analysis led to theidentification of the deletion of exon 3. Sequencing of genomicDNA demonstrated that the deletion was due to a splicing defectcaused by the substitution of guanine for adenine in the thirdnucleotide of the splice donor site in intron 3 (Table 2). Withthe exception of the splicing defect identified in Patient 6,the mutations consisted of missense mutations in the codingregion of the desmin gene in 11 patients (Table 2). Three mutationsidentified in two families have already been briefly described.11
Table 2. Mutations in the Desmin Gene Identified in Patients with Desmin Myopathy.
In both affected members of Family 1, the nucleotide sequenceof desmin cDNA revealed the substitution of cytosine for guaninein exon 5, changing the sequence of codon 337 from GCC to CCCand the encoded amino acid from alanine to proline (Table 2).The mutation was verified by genomic sequencing and restriction-enzymeanalysis with BsaHI. Each of the three affected members of Family2 had two missense mutations, A360P on the maternal allele andN393I on the paternal allele (Table 2), indicating the presenceof compound heterozygosity. Several unaffected family memberscarried one, but not both, of the mutations. Functional studiesconfirmed that both mutations cause a severely dysfunctionaldesmin. In three affected members of Family 3, nucleotide sequencingof desmin cDNA revealed the substitution of guanine for cytosinein exon 8, changing the sequence of codon 451 from ATC to ATGand the encoded amino acid from isoleucine to methionine (Table 2).Several unaffected family members were found to have thesame mutation on restriction-enzyme analysis with NcoI. Bothaffected members of Family 4 had a guanine substituted for adeninein codon 342 of exon 6, changing the sequence of the codon fromAAC to GAC and the encoded amino acid from asparagine to asparticacid (Figure 2 and Table 2). The mutation was confirmed by analysiswith Sbf I.
Figure 2. Nucleotide Sequences of Desmin Gene Fragments from Two Members of Family 4 with Familial Autosomal Dominant Myopathy (Panel A) and from Patient 5, Who Had Sporadic Cardiac and Skeletal Myopathy, and Her Unaffected Parents (Panel B).
The alterations identified in codons 342 and 406 of the desmin gene are underlined, and the nucleotides affected are italicized. Restriction enzymes Sbf l and BsaWI were used to screen for mutations. Bands associated with mutations on electrophoresis are indicated by the arrows.
In Patient 5, who had sporadic desmin myopathy, thymine wassubstituted for cytosine in codon 406 of exon 6, changing thesequence of the codon from CGG to TGG and resulting in the substitutionof tryptophan for arginine (Figure 2 and Table 2). None of theunaffected parents of the two patients with sporadic myopathy(Patients 5 and 6) had evidence of mutations on direct sequencingor restriction-enzyme analysis, confirming that these patientshad spontaneous mutations in the desmin gene. The possibilityof alternative paternity was excluded by assessment with a batteryof microsatellite markers.
None of the normal subjects had any of the above-mentioned alterationsin the desmin gene, indicating that these mutations are notpolymorphisms. Desmin mutations were also excluded in the otherfour families with myofibrillar myopathies that we studied,based on sequencing of cDNA and of all nine exons amplifiedfrom genomic DNA. Also, no mutations in the B-crystallin genewere identified.
Studies of in Vitro Expression
The SW13 (vimentin-negative) cells transfected with normal desminprotein formed extensive cytoplasmic filamentous networks thatwere positive for desmin (Figure 3A). Cells transfected withthe expression vector containing each mutant desmin did notproduce an intracellular filamentous network but formed desmin-positiveaggregates scattered throughout the cytoplasm (Figure 3B). Onelectron microscopy (Figure 3C and Figure 3D) these aggregatesresembled the accumulations seen in the muscle-biopsy specimens(Figure 1D). Cells transfected with the two mutant desmins fromFamily 2, which had two alterations in the desmin gene, didnot produce a network of intermediate filaments. There wereno apparent qualitative differences in the expression studiesamong the identified mutations, except for the mutation at codon451, which led to only mild impairment of the filamentous network.
Figure 3. SW13 (Vimentin-Negative) Cell Lines Transfected with a Plasmid Construct Containing Either a Normal Desmin cDNA Sequence or the cDNA Sequence of a Mutant Allele from the Proband in Family 2.
In Panels A and B, cells were stained with an antibody against normal desmin with use of an indirect immunofluorescence technique. Normal desmin creates a well-structured filamentous network (Panel A). In contrast, cells transfected with the mutant desmin (A360P) cannot form a filamentous network but form scattered desmin-positive aggregates (Panel B). The bar represents 20 µm. Electron-microscopical examination of the same cells confirms the formation of aggregates only in the cells transfected with the mutant desmin (Panel D, x16,000) and not in cells transfected with the normal desmin sequence (Panel C, x20,000). In all the cells transfected with each of the identified mutant desmin sequences except the C-to-G missense mutation at codon 451 in Family 3 (Table 2), the aggregates resembled those seen in the muscle-biopsy specimens. (An example is shown in Fig. 1D.)
Correlations between Phenotype and Genotype
Although most of the missense mutations causing myopathy wereclustered at the carboxy-terminal part of the desmin rod domain(Figure 4) within the 2B subdomain, there were differences inthe clinical severity of disease and the age at onset of symptoms.In members of Family 1, who had an autosomal dominant mutation,the onset of disease was relatively late, the rate of progressionwas slow, and there was mild cardiomyopathy or none at all.In members of Family 2, who had compound heterozygosity, cardiomyopathydeveloped in early childhood and skeletal myopathy developedapproximately 10 years later; two of the proband's affectedbrothers had died in their 30s. In Patient 5, severe and rapidlyprogressive myopathy developed in her 20s and was followed withinmonths by cardiomyopathy. In Patient 6, who had a deletion mutationin the 1B subdomain, cardiomyopathy developed at the age of40 years, and she had a moderate degree of skeletal myopathyby the age of 43 years. Most of the affected members of Family3 and Family 4 did not have cardiomyopathy, but the severityof their skeletal myopathy ranged from mild to severe and involvedrespiratory muscles in Family 3.
Figure 4. Secondary Structure of Human Desmin and the Location of the Mutations Associated with Cardiac and Skeletal Myopathy.
Boxes indicate four conserved -helical subdomains (1A, 1B, 2A, and 2B) that are separated by nonhelical linkers. The helical rod domain is flanked by a nonhelical amino-terminal domain (head) and carboxy-terminal domain (tail). Most of the identified point mutations are located in the carboxy-terminal part of 2B (arrows). The deletion mutation identified in Patient 6, located in the 1B subdomain, led to the deletion of exon 3 as a result of the substitution of guanine for adenine in the third nucleotide of the splice donor site in intron 3 (IVS3+3AG). Another deletion mutation in exon 3, described in a Spanish family,12 resulted in a small (7-amino-acid) deletion (173179).
Discussion
This study provides direct evidence that among the dominantlyinherited or sporadic myofibrillar myopathies, there is a geneticallydistinct subgroup desmin myopathy characterizedby pathogenic mutations in the desmin gene and by frequent cardiac-conductiondefects. In spite of the apparent clinical and histologic similaritiesbetween patients with desmin myopathy and those with other myofibrillarmyopathies, none of the 12 patients from 4 families with othertypes of myofibrillar myopathies whom we studied had mutationsin the coding region of the desmin gene, indicating that desminmyopathy is a distinct subgroup.
Among the four families with desmin myopathy defined by suchmutations, three had an autosomal dominant mode of inheritanceand the fourth (Family 2) demonstrated a pattern of inheritancecompatible with the presence of compound heterozygosity. Thetwo patients with sporadic disease (Patients 5 and 6) had spontaneousmutations. Since the frequency of sporadic myofibrillar myopathyappears to be high,4 the desmin gene and possibly other unidentifiedgenes may be hot spots for mutations. One large family in whichdesmin gene mutations were excluded had functional mutationsin the B-crystallin gene,15 which encodes a chaperone proteinnecessary for the stabilization of desmin intermediate filaments.16We excluded the possibility of mutations in the B-crystallingene in all our patients.
Functional studies provide compelling evidence that the mutationsin the human desmin gene are pathogenic and interfere with theassembly of intermediate filaments in vitro. Because the functionalabnormalities caused by the mutant desmin can be reversed bythe insertion of a wild-type desmin,12 the amount of wild-typedesmin within the myofibers may determine the severity of symptoms.Consequently, the absence of symptoms in heterozygous familymembers and the clinical heterogeneity within and between familiesmay be related to the site of the mutation and to the presenceof at least one wild-type allele. In experiments in vitro inour study and in other studies, truncated desmin molecules17,18and mutant human desmin expressed in SW13 (vimentin-negative)cells produced aggregates similar to those seen in muscle-biopsyspecimens. In the muscle, these accumulations are useful histologicmarkers, but they do not correlate with the severity of muscleinvolvement, suggesting that the cause of muscle weakness isrelated to the dysfunction of intermediate filaments ratherthan to the accumulation of myofibrillar proteins.
In the skeletal and cardiac muscles, normal desmin encirclesthe Z bands that hold together the actin filaments and helptransmit tension along the myofibrils, protecting their structuralintegrity during repeated muscle contractures over time (Figure 5).6,7,19,23 Defects in the function of desmin, as well as inthe other desmin-associated filaments, such as plectin and B-crystallin(Figure 5), may therefore cause fragility of the myofibrilsand impair contraction. In mice that lack desmin, cardiomyopathyand skeletal myopathy develop in older age.8,9,24,25 Remarkably,the presence of myopathy in mice correlates with the extentof muscle use, and the histologic features in muscle specimensfrom these mice are very similar to those of patients with desminmyopathy, including disrupted myofibrils and streaming of Zbands.8,9,25 In our patients, skeletal myopathy did not developbefore the age of 20 years and in most cases was not rapidlyprogressive. Because intermediate filaments participate in thetransmission of active force,26 the disruption of the filamentousnetwork by the mutant desmin impairs the force generated withinthe contractile filaments and weakens the sarcomere (Figure 5),resulting in myofibrillar damage over a period of severalyears because of the cumulative effects of mechanical stressand muscle use. The contributory effect of mechanical stresswith advancing age has been recognized in patients with metabolicmyopathies.27
Figure 5. Main Intermediate Filaments and Cytoskeletal Proteins Linking the Extracellular Matrix with the Structural Muscle Proteins Associated with Mutations Causing Cardiac and Skeletal Myopathy.
In the mature cardiac and skeletal muscle, the Z bands hold together the actin filaments and have a fundamental role in the transmission of tension throughout the myofibril. The desmin filaments, consisting of 10-nm-wide intermediate filaments, encircle the Z bands and are fastened to them and to one another by plectin filaments.619 Desmin (from the Greek noun desmos, meaning link or bond) mechanically integrates the contractile actions of the muscle fiber laterally by linking the individual myofibrils at the Z-band level, as shown for three adjacent myofibrils, and longitudinally by linking the Z bands to the sarcolemma and nuclei (along with other intermediate-filamentassociated proteins).6 The heat-shock protein B-crystallin protects, or chaperones, the desmin filaments from stress-induced damage. Desmin, along with B-crystallin and plectin, forms an organized network at the Z-band level that protects the structural integrity of the myofibrils during mechanical stress.16 Mutations in desmin, B-crystallin, and plectin1420 cause fragility of the myofibrils and lead to their destruction after repetitive mechanical stress. Mutations in other cytoskeletal proteins, including dystrophin, actin, the sarcoglycan complex,21 the nuclear protein emerin, and the intermediate nuclear filaments lamin A and C,22 are also associated with cardiomyopathy and skeletal myopathy.
All but one of the six point mutations in the desmin gene thatwe identified were clustered at the carboxy-terminal part ofthe desmin rod domain, and five of them were within the 2B subdomain.The results of in vitro studies of peptide assembly have stronglyindicated that the integrity of the carboxy-terminal part ofthe desmin rod is critically important for the proper assemblyof intermediate filaments.17,18,28 The deletion of only fourcarboxy-terminal residues or the substitution of a single aminoacid impairs the assembly of desmin molecules and disrupts thedesminvimentin network.17,28 The introduction of prolineresidues at the carboxy-terminal end of the desmin rod, as occurswith A337P and A360P mutations, results in short, thick, andkinked irregular structures.28 A similar effect was observedin mutagenesis experiments with keratin, an intermediate filamentin skin cells that is structurally and functionally similarto desmin.29
Recently, two additional mutations have been reported. One wasidentified in a family with dilated cardiomyopathy but withoutskeletal myopathy, in which no functional studies were performed.30The other was identified in a large Ashkenazi Jewish familywith 28 affected members in 6 generations with dominantly inheriteddistal myopathy associated with missense mutations in the desminrod domain.31
Intermediate filaments are critical mechanical integrators ofthe cytoskeleton, protecting the cell from repeated mechanicalstress. Mutations in the most common human intermediate filament,keratin, have been causally connected to epidermolysis bullosasimplex.7 Like the mutations in the desmin gene that interferewith the assembly of intermediate filaments in the muscles ofhumans and mice lacking desmin, mutations in the keratin geneaffect the mechanical integrity of the epidermal cells. Thus,it appears that desminopathies along with keratinopathies forma new category of intermediate-filament disorders. Recognitionof the desminopathies is important because cardiac-conductiondefects, if unrecognized or unanticipated, can cause suddendeath. Mutations in other intermediate-filamentassociatedproteins, such as plectin, which is a linker protein, connectingdesmin to Z bands (Figure 5),19 and B-crystallin, which protectsdesmin filaments from stress-induced damage, cause myopathysimilar to desmin myopathy.15,20 Our findings expand the spectrumof genetically identifiable skeletal and cardiac myopathiescaused by defects in proteins of the extracellular matrix, thedystroglyan complex, dystrophin, sarcomere, intermediate filaments,and components of the nuclear envelope.21,22
We are indebted to Dr. Victor Ferrans of the National Heart,Lung, and Blood Institute for help with the expression studies;to Neal Epstein for helpful discussions; and to all the patientswho participated in the study.
Source Information
From the Neuromuscular Diseases Section (M.C.D., C.S.-M., K.S.) and the Clinical Neurogenetics Unit (K.-Y.P., H.S.L., L.G.G.), National Institute of Neurological Disorders and Stroke, National Institutes of Health, Bethesda, Md.
Address reprint requests to Dr. Dalakas at the Neuromuscular Diseases Section, NINDS, National Institutes of Health, Bldg. 10, Rm. 4N248, 10 Center Dr., MSC 1382, Bethesda, MD 20892-1382, or at dalakas{at}helix.nih.gov.
References
Nakano S, Engel AG, Waclawik AJ, Emslie-Smith AM, Busis NA. Myofibrillar myopathy with abnormal foci of desmin positivity. I. Light and electron microscopy analysis of 10 cases. J Neuropathol Exp Neurol 1996;55:549-562. [Medline]
De Bleecker JL, Engel AG, Ertl BB. Myofibrillar myopathy with abnormal foci of desmin positivity. II. Immunocytochemical analysis reveals accumulation of multiple other proteins. J Neuropathol Exp Neurol 1996;55:563-577. [Medline]
Nakano S, Engel AG, Akiguchi I, Kimura J. Myofibrillar myopathy. III. Abnormal expression of cyclin-dependent kinases and nuclear proteins. J Neuropathol Exp Neurol 1997;56:850-856. [Medline]
Amato AA, Kagan-Hallet K, Jackson CE, et al. The wide spectrum of myofibrillar myopathy suggests a multifactorial etiology and pathogenesis. Neurology 1998;51:1646-1655. [Free Full Text]
Lazarides E. Intermediate filaments as mechanical integrators of cellular space. Nature 1980;283:249-256. [CrossRef][Medline]
Fuchs E, Cleveland DW. A structural scaffolding of intermediate filaments in health and disease. Science 1998;279:514-519. [Free Full Text]
Capetanaki Y, Milner DJ, Weitzer G. Desmin in muscle formation and maintenance: knockouts and consequences. Cell Struct Funct 1997;22:103-116. [Medline]
Milner DJ, Weitzer G, Tran D, Bradley A, Capetanaki Y. Disruption of muscle architecture and myocardial degeneration in mice lacking desmin. J Cell Biol 1996;134:1255-1270. [Free Full Text]
Thornell L-E, Carlsson L, Li Z, Mericskay M, Paulin D. Null mutation in the desmin gene gives rise to a cardiomyopathy. J Mol Cell Cardiol 1997;29:2107-2124. [CrossRef][Medline]
Goldfarb LG, Park K-Y, Cervenakova L, et al. Missense mutations in desmin associated with familial cardiac and skeletal myopathy. Nat Genet 1998;19:402-403. [CrossRef][Medline]
Munoz-Marmol AM, Strasser G, Isamat M, et al. A dysfunctional desmin mutation in a patient with severe generalized myopathy. Proc Natl Acad Sci U S A 1998;95:11312-11317. [Free Full Text]
Semino-Mora C, Dalakas MC. Rimmed vacuoles with ß-amyloid and ubiquitinated filamentous deposits in the muscles of patients with long-standing denervation (postpoliomyelitis muscular atrophy): similarities with inclusion body myositis. Hum Pathol 1998;29:1128-1133. [CrossRef][Medline]
Vicart P, Dupret JM, Hazan J, et al. Human desmin gene: cDNA sequence, regional localization and exclusion of the locus in a familial desmin-related myopathy. Hum Genet 1996;98:422-429. [CrossRef][Medline]
Vicart P, Caron A, Guicheney P, et al. A missense mutation in the B-crystallin chaperone gene causes a desmin-related myopathy. Nat Genet 1998;20:92-95. [CrossRef][Medline]
Bennardini F, Wrzosek A, Chiesi M. B-crystallin in cardiac tissue: association with actin and desmin filaments. Circ Res 1992;71:288-294. [Free Full Text]
Yu KR, Hijikata T, Lin ZX, Sweeney HL, Englander SW, Holtzer H. Truncated desmin in PtK2 cells induces desmin-vimentin-cytokeratin coprecipitation, involution of intermediate filament networks, and nuclear fragmentation: a model for many degenerative diseases. Proc Natl Acad Sci U S A 1994;91:2497-2501. [Free Full Text]
Raats JM, Schaart G, Henderik JB, et al. Muscle-specific expression of a dominant negative desmin mutant in transgenic mice. Eur J Cell Biol 1996;71:221-236. [Medline]
Hijikata T, Murakami T, Imamura M, Fujimaki N, Ishikawa H. Plectin is a linker of intermediate filaments to Z-discs in skeletal muscle fibers. J Cell Sci 1999;112:867-876. [Abstract]
Banwell BL, Russel J, Fukudome T, Shen XM, Stilling G, Engel AG. Myopathy, myasthenic syndrome, and epidermolysis bullosa simplex due to plectin deficiency. J Neuropathol Exp Neurol 1999;58:832-846. [Medline]
Dalakas MC. Diseases of muscle and the neuromuscular junction. Part 3 of Neurology. No. 11. In: Rubinstein E, ed. Scientific American medicine. Vol. 3. New York: Scientific American, 1997:111-1111-14.
Fatkin D, MacRae C, Sasaki T, et al. Missense mutations in the rod domain of the lamin A/C gene as causes of dilated cardiomyopathy and conduction-system disease. N Engl J Med 1999;341:1715-1724. [Free Full Text]
Watson PA, Hannan R, Carl LL, Giger KE. Desmin gene expression in cardiac myocytes is responsive to contractile activity and stretch. Am J Physiol 1996;270:C1228-C1235. [Free Full Text]
Weitzer G, Milner DJ, Kim JU, Bradley A, Capetanaki Y. Cytoskeletal control of myogenesis: a desmin null mutation blocks the myogenic pathway during embryonic stem cell differentiation. Dev Biol 1995;172:422-439. [CrossRef][Medline]
Li Z, Colucci-Guyon E, Pincon-Raymond M, et al. Cardiovascular lesions and skeletal myopathy in mice lacking desmin. Dev Biol 1996;175:362-366. [CrossRef][Medline]
Sjuve R, Arner A, Li Z, et al. Mechanical alterations in smooth muscle from mice lacking desmin. J Muscle Res Cell Motil 1998;19:415-429. [CrossRef][Medline]
Sivakumar K, Vasconcelos O, Goldfarb L, Dalakas MC. Late-onset muscle weakness in partial phosphofructokinase deficiency: a unique myopathy with vacuoles, abnormal mitochondria, and absence of the common exon 5/intron 5 junction point mutation. Neurology 1996;46:1337-1342. [Free Full Text]
Raats JMH, Henderik JBJ, Verdijk M, et al. Assembly of carboxy-terminally deleted desmin in vimentin-free cells. Eur J Cell Biol 1991;56:84-103. [Medline]
Letai A, Coulombe PA, Fuchs E. Do the ends justify the means? Proline mutations at the ends of the keratin coiled-coil rod segment are more disruptive than internal mutations. J Cell Biol 1992;116:1181-1195. [Free Full Text]
Li D, Tapscoft T, Gonzalez O, et al. Desmin mutation responsible for idiopathic dilated cardiomyopathy. Circulation 1999;100:461-464. [Free Full Text]
Sjöberg G, Saavedra-Matiz CA, Rosen DR, et al. A missense mutation in the desmin rod domain is associated with autosomal dominant distal myopathy, and exerts a dominant negative effect on filament formation. Hum Mol Genet 1999;8:2191-2198. [Free Full Text]
Willis, M. S., Schisler, J. C., Portbury, A. L., Patterson, C.
(2009). Build it up-Tear it down: protein quality control in the cardiac sarcomere. Cardiovasc Res
81: 439-448
[Abstract][Full Text]
Kaski, J P, Syrris, P, Burch, M, Tome-Esteban, M-T, Fenton, M, Christiansen, M, Andersen, P S, Sebire, N, Ashworth, M, Deanfield, J E, McKenna, W J, Elliott, P M
(2008). Idiopathic restrictive cardiomyopathy in children is caused by mutations in cardiac sarcomere protein genes. Heart
94: 1478-1484
[Abstract][Full Text]
Mavroidis, M., Panagopoulou, P., Kostavasili, I., Weisleder, N., Capetanaki, Y.
(2008). A missense mutation in desmin tail domain linked to human dilated cardiomyopathy promotes cleavage of the head domain and abolishes its Z-disc localization. FASEB J.
22: 3318-3327
[Abstract][Full Text]
Tannous, P., Zhu, H., Johnstone, J. L., Shelton, J. M., Rajasekaran, N. S., Benjamin, I. J., Nguyen, L., Gerard, R. D., Levine, B., Rothermel, B. A., Hill, J. A.
(2008). Autophagy is an adaptive response in desmin-related cardiomyopathy. Proc. Natl. Acad. Sci. USA
105: 9745-9750
[Abstract][Full Text]
Kley, R. A., Hellenbroich, Y., van der Ven, P. F. M., Furst, D. O., Huebner, A., Bruchertseifer, V., Peters, S. A., Heyer, C. M., Kirschner, J., Schroder, R., Fischer, D., Muller, K., Tolksdorf, K., Eger, K., Germing, A., Brodherr, T., Reum, C., Walter, M. C., Lochmuller, H., Ketelsen, U.-P., Vorgerd, M.
(2007). Clinical and morphological phenotype of the filamin myopathy: a study of 31 German patients. Brain
130: 3250-3264
[Abstract][Full Text]
Stone, M. R., O'Neill, A., Lovering, R. M., Strong, J., Resneck, W. G., Reed, P. W., Toivola, D. M., Ursitti, J. A., Omary, M. B., Bloch, R. J.
(2007). Absence of keratin 19 in mice causes skeletal myopathy with mitochondrial and sarcolemmal reorganization. J. Cell Sci.
120: 3999-4008
[Abstract][Full Text]
Lowe, T., Kley, R. A., van der Ven, P. F.M., Himmel, M., Huebner, A., Vorgerd, M., Furst, D. O.
(2007). The pathomechanism of filaminopathy: altered biochemical properties explain the cellular phenotype of a protein aggregation myopathy. Hum Mol Genet
16: 1351-1358
[Abstract][Full Text]
Patterson, C., Ike, C., Willis, P. W. IV, Stouffer, G. A., Willis, M. S.
(2007). The Bitter End: The Ubiquitin-Proteasome System and Cardiac Dysfunction. Circulation
115: 1456-1463
[Abstract][Full Text]
Taylor, M. R.G., Slavov, D., Ku, L., Di Lenarda, A., Sinagra, G., Carniel, E., Haubold, K., Boucek, M. M., Ferguson, D., Graw, S. L., Zhu, X., Cavanaugh, J., Sucharov, C. C., Long, C. S., Bristow, M. R., Lavori, P., Mestroni, L., for the Familial Cardiomyopathy Registry and the B,
(2007). Prevalence of Desmin Mutations in Dilated Cardiomyopathy. Circulation
115: 1244-1251
[Abstract][Full Text]
Wang, X., Robbins, J.
(2006). Heart Failure and Protein Quality Control. Circ. Res.
99: 1315-1328
[Abstract][Full Text]
Lapouge, K., Fontao, L., Champliaud, M.-F., Jaunin, F., Frias, M. A., Favre, B., Paulin, D., Green, K. J., Borradori, L.
(2006). New insights into the molecular basis of desmoplakinand desmin-related cardiomyopathies. J. Cell Sci.
119: 4974-4985
[Abstract][Full Text]
Arbustini, E., Pasotti, M., Pilotto, A., Pellegrini, C., Grasso, M., Previtali, S., Repetto, A., Bellini, O., Azan, G., Scaffino, M., Campana, C., Piccolo, G., Vigano, M., Tavazzi, L.
(2006). Desmin accumulation restrictive cardiomyopathy and atrioventricular block associated with desmin gene defects. Eur J Heart Fail
8: 477-483
[Abstract][Full Text]
Muntoni, F., Bonne, G., Goldfarb, L. G., Mercuri, E., Piercy, R. J., Burke, M., Yaou, R. B., Richard, P., Recan, D., Shatunov, A., Sewry, C. A., Brown, S. C.
(2006). Disease severity in dominant Emery Dreifuss is increased by mutations in both emerin and desmin proteins. Brain
129: 1260-1268
[Abstract][Full Text]
Ozden, S., Mouly, V., Prevost, M.-C., Gessain, A., Butler-Browne, G., Ceccaldi, P.-E.
(2005). Muscle Wasting Induced by HTLV-1 Tax-1 Protein: An in Vitro and in Vivo Study. Am. J. Pathol.
167: 1609-1619
[Abstract][Full Text]
Nerbonne, J. M., Kass, R. S.
(2005). Molecular Physiology of Cardiac Repolarization. Physiol. Rev.
85: 1205-1253
[Abstract][Full Text]
Zhang, J, Kumar, A, Kaplan, L, Fricker, F J, Wallace, M R
(2005). Genetic linkage of a novel autosomal dominant restrictive cardiomyopathy locus. J. Med. Genet.
42: 663-665
[Abstract][Full Text]
Bar, H., Fischer, D., Goudeau, B., Kley, R. A., Clemen, C. S., Vicart, P., Herrmann, H., Vorgerd, M., Schroder, R.
(2005). Pathogenic effects of a novel heterozygous R350P desmin mutation on the assembly of desmin intermediate filaments in vivo and in vitro. Hum Mol Genet
14: 1251-1260
[Abstract][Full Text]
Hsiao, V. C., Tian, R., Long, H., Der Perng, M., Brenner, M., Quinlan, R. A., Goldman, J. E.
(2005). Alexander-disease mutation of GFAP causes filament disorganization and decreased solubility of GFAP. J. Cell Sci.
118: 2057-2065
[Abstract][Full Text]
Omary, M. B., Coulombe, P. A., McLean, W.H. I.
(2004). Intermediate Filament Proteins and Their Associated Diseases. NEJM
351: 2087-2100
[Full Text]
Vattemi, G., Tonin, P., Mora, M., Filosto, M., Morandi, L., Savio, C., Dal Pra, I., Rizzuto, N., Tomelleri, G.
(2004). Expression of protein kinase C isoforms and interleukin-1{beta} in myofibrillar myopathy. Neurology
62: 1778-1782
[Abstract][Full Text]
Selcen, D., Engel, A. G.
(2004). Mutations in myotilin cause myofibrillar myopathy. Neurology
62: 1363-1371
[Abstract][Full Text]
Goldfarb, L. G., Vicart, P., Goebel, H. H., Dalakas, M. C.
(2004). Desmin myopathy. Brain
127: 723-734
[Abstract][Full Text]
Selcen, D., Ohno, K., Engel, A. G.
(2004). Myofibrillar myopathy: clinical, morphological and genetic studies in 63 patients. Brain
127: 439-451
[Abstract][Full Text]
Dos Remedios, C. G., Chhabra, D., Kekic, M., Dedova, I. V., Tsubakihara, M., Berry, D. A., Nosworthy, N. J.
(2003). Actin Binding Proteins: Regulation of Cytoskeletal Microfilaments. Physiol. Rev.
83: 433-473
[Abstract][Full Text]
Schroder, R., Goudeau, B., Simon, M. C., Fischer, D., Eggermann, T., Clemen, C. S., Li, Z., Reimann, J., Xue, Z., Rudnik-Schoneborn, S., Zerres, K., van der Ven, P. F. M., Furst, D. O., Kunz, W. S., Vicart, P.
(2003). On noxious desmin: functional effects of a novel heterozygous desmin insertion mutation on the extrasarcomeric desmin cytoskeleton and mitochondria. Hum Mol Genet
12: 657-669
[Abstract][Full Text]
Chen, F., Chang, R., Trivedi, M., Capetanaki, Y., Cryns, V. L.
(2003). Caspase Proteolysis of Desmin Produces a Dominant-negative Inhibitor of Intermediate Filaments and Promotes Apoptosis. J. Biol. Chem.
278: 6848-6853
[Abstract][Full Text]
Huang, X., Li, J., Foster, D., Lemanski, S. L., Dube, D. K., Zhang, C., Lemanski, L. F.
(2002). Protein Kinase C-Mediated Desmin Phosphorylation Is Related to Myofibril Disarray in Cardiomyopathic Hamster Heart. Exp. Biol. Med.
227: 1039-1046
[Abstract][Full Text]
Bowles, N.E.
(2002). The molecular biology of dilated cardiomyopathy. Eur Heart J Suppl
4: I2-I7
[Abstract]
Sasagawa, K., Matsudo, Y., Kang, M., Fujimura, L., Iitsuka, Y., Okada, S., Ochiai, T., Tokuhisa, T., Hatano, M.
(2002). Identification of Nd1, a Novel Murine Kelch Family Protein, Involved in Stabilization of Actin Filaments. J. Biol. Chem.
277: 44140-44146
[Abstract][Full Text]
Hahn, H. S., Yussman, M. G., Toyokawa, T., Marreez, Y., Barrett, T. J., Hilty, K. C., Osinska, H., Robbins, J., Dorn, G. W. II
(2002). Ischemic Protection and Myofibrillar Cardiomyopathy: Dose-Dependent Effects of In Vivo {delta}PKC Inhibition. Circ. Res.
91: 741-748
[Abstract][Full Text]
Fatkin, D., Graham, R. M.
(2002). Molecular Mechanisms of Inherited Cardiomyopathies. Physiol. Rev.
82: 945-980
[Abstract][Full Text]
Loufrani, L., Li, Z., Levy, B. I., Paulin, D., Henrion, D.
(2002). Excessive Microvascular Adaptation to Changes in Blood Flow in Mice Lacking Gene Encoding for Desmin. Arterioscler. Thromb. Vasc. Bio.
22: 1579-1584
[Abstract][Full Text]
Feasson, L, Stockholm, D, Freyssenet, D, Richard, I, Duguez, S, Beckmann, J S, Denis, C
(2002). Molecular adaptations of neuromuscular disease-associated proteins in response to eccentric exercise in human skeletal muscle. J. Physiol.
543: 297-306
[Abstract][Full Text]
Barrans, J. D., Allen, P. D., Stamatiou, D., Dzau, V. J., Liew, C.-C.
(2002). Global Gene Expression Profiling of End-Stage Dilated Cardiomyopathy Using a Human Cardiovascular-Based cDNA Microarray. Am. J. Pathol.
160: 2035-2043
[Abstract][Full Text]
Du, X.-J., Cole, T. J., Tenis, N., Gao, X.-M., Kontgen, F., Kemp, B. E., Heierhorst, J.
(2002). Impaired Cardiac Contractility Response to Hemodynamic Stress in S100A1-Deficient Mice. Mol. Cell. Biol.
22: 2821-2829
[Abstract][Full Text]
Mavroidis, M., Capetanaki, Y.
(2002). Extensive Induction of Important Mediators of Fibrosis and Dystrophic Calcification in Desmin-Deficient Cardiomyopathy. Am. J. Pathol.
160: 943-952
[Abstract][Full Text]
Miyamoto, Y., Akita, H., Shiga, N., Takai, E., Iwai, C., Mizutani, K., Kawai, H., Takarada, A., Yokoyama, M.
(2001). Frequency and clinical characteristics of dilated cardiomyopathy caused by desmin gene mutation in a Japanese population. Eur Heart J
22: 2284-2289
[Abstract]
Chien, K.R.
(2001). Genomic circuits and the integrative biology of cardiomyopathies. Eur Heart J Suppl
3: L3-L9
[Abstract]
Ku, N.-O., Gish, R., Wright, T. L., Omary, M. B.
(2001). Keratin 8 Mutations in Patients with Cryptogenic Liver Disease. NEJM
344: 1580-1587
[Abstract][Full Text]
Wang, X., Osinska, H., Dorn, G. W. II, Nieman, M., Lorenz, J. N., Gerdes, A. M., Witt, S., Kimball, T., Gulick, J., Robbins, J.
(2001). Mouse Model of Desmin-Related Cardiomyopathy. Circulation
103: 2402-2407
[Abstract][Full Text]
Schweitzer, S., Klymkowsky, M., Bellin, R., Robson, R., Capetanaki, Y, Evans, R.
(2001). Paranemin and the organization of desmin filament networks. J. Cell Sci.
114: 1079-1089
[Abstract]
Marin-Garcia, J., Goldenthal, M. J, Moe, G. W
(2001). Mitochondrial pathology in cardiac failure. Cardiovasc Res
49: 17-26
[Full Text]
Tesson, F, Sylvius, N, Pilotto, A, Dubosq-Bidot, L, Peuchmaurd, M, Bouchier, C, Benaiche, A, Mangin, L, Charron, P, Gavazzi, A, Tavazzi, L, Arbustini, E, Komajda, M
(2000). Epidemiology of desmin and cardiac actin gene mutations in a European population of dilated cardiomyopathy. Eur Heart J
21: 1872-1876
[Abstract]
Norgett, E. E., Hatsell, S. J., Carvajal-Huerta, L., Ruiz Cabezas, J.-C., Common, J., Purkis, P. E., Whittock, N., Leigh, I. M., Stevens, H. P., Kelsell, D. P.
(2000). Recessive mutation in desmoplakin disrupts desmoplakin-intermediate filament interactions and causes dilated cardiomyopathy, woolly hair and keratoderma. Hum Mol Genet
9: 2761-2766
[Abstract][Full Text]
Sugawara, M., Kato, K., Komatsu, M., Wada, C., Kawamura, K., Shindo, S., Yoshioka, N., Tanaka, K., Watanabe, S., Toyoshima, I.
(2000). A novel de novo mutation in the desmin gene causes desmin myopathy with toxic aggregates. Neurology
55: 986-990
[Abstract][Full Text]
Mayosi, B., Blair, E., Watkins, H., Li, D., Tapscott, T., Gonzalez, O., Quinones, M. A., Zoghbi, W. A., Hill, R., Bachinski, L. L., Mann, D. L., Roberts, R., Burch, P. E.
(2000). Dilated Cardiomyopathy and the Desmin Gene Response. Circulation
102
: e100-e101
[Full Text]
(2000). New Insights into the Pathogenesis of Desmin Myopathy. JWatch Neurology
2000: 1-1
[Full Text]
Magin, T., Kaiser, H., Leitgeb, S, Grund, C, Leigh, I., Morley, S., Lane, E.
(2000). Supplementation of a mutant keratin by stable expression of desmin in cultured human EBS keratinocytes. J. Cell Sci.
113: 4231-4239
[Abstract]
Newey, S. E., Howman, E. V., Ponting, Chris. P., Benson, M. A., Nawrotzki, R., Loh, N. Y., Davies, K. E., Blake, D. J.
(2001). Syncoilin, a Novel Member of the Intermediate Filament Superfamily That Interacts with alpha -Dystrobrevin in Skeletal Muscle. J. Biol. Chem.
276: 6645-6655
[Abstract][Full Text]
Mizuno, Y., Thompson, T. G., Guyon, J. R., Lidov, H. G. W., Brosius, M., Imamura, M., Ozawa, E., Watkins, S. C., Kunkel, L. M.
(2001). Desmuslin, an intermediate filament protein that interacts with alpha -dystrobrevin and desmin. Proc. Natl. Acad. Sci. USA
98: 6156-6161
[Abstract][Full Text]