The New England Journal of Medicine
e-mail icon  FREE NEJM E-TOC    HOME   |   SUBSCRIBE   |   CURRENT ISSUE   |   PAST ISSUES   |   COLLECTIONS   |    Advanced Search
Sign in | Get NEJM's E-Mail Table of Contents — Free | Subscribe
 
Original Article
PreviousPrevious
Volume 342:770-780 March 16, 2000 Number 11
NextNext

Desmin Myopathy, a Skeletal Myopathy with Cardiomyopathy Caused by Mutations in the Desmin Gene
Marinos C. Dalakas, M.D., Kye-Yoon Park, Ph.D., Cristina Semino-Mora, M.D., Ph.D., Hee Suk Lee, M.D., Kumaraswamy Sivakumar, M.D., and Lev G. Goldfarb, M.D.

 

This Article
-Abstract
- PDF

Tools and Services
-Add to Personal Archive
-Add to Citation Manager
-Notify a Friend
-E-mail When Cited

More Information
-PubMed Citation
ABSTRACT

Background Myofibrillar myopathies are a heterogeneous group of inherited or sporadic skeletal myopathies associated with cardiomyopathy. Among the myofibrillar proteins that accumulate within the muscle fibers of affected patients, the one found most consistently is desmin, an intermediate-filament protein responsible for the structural integrity of the myofibrils. Skeletal and cardiac myopathy develops in mice that lack desmin, suggesting that mutations in the desmin gene may be pathogenic.

Methods We examined 22 patients from 8 families with dominantly inherited myofibrillar or desmin-related myopathy and 2 patients with sporadic disease and analyzed the desmin gene for mutations, using complementary DNA (cDNA) amplified from muscle-biopsy specimens and genomic DNA extracted from blood lymphocytes. Restriction-enzyme analysis was used to confirm the mutations. Expression vectors containing normal or mutant desmin cDNA were introduced into cultured cells to determine whether the mutant desmin formed intermediate filaments.

Results Six missense mutations in the coding region of the desmin gene that cause the substitution of an amino acid were identified in 11 patients (10 members of 4 families and 1 patient with sporadic disease); a splicing defect that resulted in the deletion of exon 3 was identified in the other patient with sporadic disease. Mutations were clustered in the carboxy-terminal part of the rod domain, which is critical for filament assembly. In transfected cells, the mutant desmin was unable to form a filamentous network. Seven of the 12 patients with mutations in the desmin gene had cardiomyopathy.

Conclusions Mutations in the desmin gene affecting intermediate filaments cause a distinct myopathy that is often associated with cardiomyopathy and is termed "desmin myopathy." The mutant desmin interferes with the normal assembly of intermediate filaments, resulting in fragility of the myofibrils and severe dysfunction of skeletal and cardiac muscles.

Myofibrillar or desmin-related myopathies are a heterogeneous group of severe, dominantly inherited, skeletal myopathies, often accompanied by cardiomyopathy, that result in syncopal episodes or sudden death due to conduction defects.1,2,3,4,5 They can be difficult to recognize because of the heterogeneity of the clinical characteristics among families and within families and the lack of diagnostic specificity of the findings on muscle biopsy. Various myofibrillar proteins, including desmin, dystrophin, vimentin, ß-spectrin, and gelsolin, accumulate in the muscle fibers of affected patients,1,2,3 but the role of these proteins in the degeneration of muscle fibers is unknown. Among these proteins, desmin, a 52-kd protein, has been linked to desmin-related myopathy because it is consistently present and unusually abundant in patients with this disorder.1,2,3 Desmin is the chief intermediate filament of skeletal and cardiac muscle,6,7 maintains the structural and functional integrity of the myofibrils, and functions as a cytoskeletal protein linking Z bands to the plasma membrane. A skeletal and cardiac myopathy develops in mice that lack desmin,8,9,10 supporting the importance of this protein in maintaining the structural integrity of the muscle.

Support for the concept that mutant desmin may cause some cases of myofibrillar or desmin-related myopathy is provided by recent findings of missense mutations in the desmin gene in three families11,12 and by the demonstrated inability of the mutant desmin to produce a network of intermediate filaments.12 We describe 12 patients, 10 with familial disease and 2 with sporadic disease, who were identified among 24 patients with myofibrillar or desmin-related myopathy and who had pathogenic mutations in the desmin gene; these findings provide evidence that such mutations cause a distinct subtype, termed "desmin myopathy."

Methods

Patients

Patients were admitted to the Neuromuscular Diseases Section of the National Institute of Neurological Disorders and Stroke according to an approved clinical protocol and after providing written informed consent. Twenty-two patients from eight families with dominantly inherited myofibrillar or desmin-related myopathy and two additional patients with no family history of myopathy were studied clinically, histologically, and genetically. Table 1 lists the clinical and laboratory characteristics of 10 patients with familial cases from 4 families (Families 1, 2, 3, and 4) and 2 patients with sporadic cases (Patients 5 and 6) in whom mutations were identified in the desmin gene.

View this table:
[in this window]
[in a new window]
  		Table 1. Characteristics of 12 Patients with Desmin Myopathy.

 
In all 12 of these patients, muscle weakness began distally at a mean age of 28 years (range, 20 to 43) and progressed to proximal muscles, causing them varying degrees of difficulty walking, climbing the stairs, raising their arms, or using their hands. The severity of weakness differed among the patients and within members of the same family. Four patients became wheelchair-bound, and five required a walker or foot braces (Table 1). Dysphagia and weakness of the bulbar, facial, neck, and pectoralis muscles developed in seven patients, and two had respiratory-muscle weakness. Serum creatine kinase levels were mildly elevated in five patients (Table 1). All had normal sensation. In all patients, electromyographic studies showed myopathy and muscle biopsy demonstrated a myopathy with bluish accumulations on trichrome staining (Figure 1A) and strong immunoreactivity on staining with antibodies against desmin, indicative of desmin deposits (Figure 1B).


View larger version (173K):
[in this window]
[in a new window]
  		Figure 1. Serial, Transverse Cross Sections of a Muscle-Biopsy Specimen from a Patient with Desmin Myopathy.

The biopsy specimen is from the proband in Family 1. The dark-blue inclusions identified on trichrome staining (Panel A, x450) were immunoreactive for desmin (Panel B, x450). The faint accumulations around a vacuolated fiber in Panel A were also strongly immunoreactive. Electron-microscopical examination showed prominent streaming of Z bands (Panel C, x10,000) and aggregates of amorphous masses (Panel D, x40,000).

 
Six patients had cardiac-conduction defects, and five had syncopal episodes that necessitated the implantation of a pacemaker (Table 1). In all three patients in Family 2 and in one of the two patients with sporadic cases (Patient 6), cardiomyopathy preceded skeletal myopathy by a mean of 12 years (range, 3 to 20). In the proband in Family 3, mitral-valve prolapse and mitral and tricuspid regurgitation developed 8 years after the onset of skeletal myopathy, and in the proband in Family 1, cardiac-conduction defects developed 22 years after the onset of skeletal myopathy. Two of the three patients in Family 2 died in their 30s of restrictive cardiomyopathy.

The father and two paternal uncles of the proband in Family 1 had initially been given a diagnosis of Charcot–Marie–Tooth disease after the development of distal-muscle weakness, and died in their 40s and 50s. The father of the three siblings studied in Family 2 died of a myocardial infarction at the age of 49 years. Patients 5 and 6 had no family history of myopathy and were not related.

In the other 12 patients with myofibrillar or desmin-related myopathy who did not have mutations in the desmin gene, the myopathy was clinically and histologically similar to that of the patients with desmin myopathy, except that the disease occurred later in life (mean age, 39 years) and there was no cardiomyopathy.

Histologic Analysis, Electron Microscopy, and Immunocytochemistry

Muscle biopsies were performed in all patients. Specimens were processed for enzyme histochemistry and immunocytochemistry as described previously.13 Serial sections that were 5 µm thick were stained with modified Gomori trichrome or with antibodies against desmin at a dilution of 1:100 (clone D33, Dako), antibodies against dystrophin at a dilution of 1:50 (clones Dy4/6D3 and Dy8/6C5, Novocastra Laboratories), antibodies against vimentin at a dilution of 1:200 (clone V9, Zymed), and antibodies against ß-spectrin at a dilution of 1:100 (clone RB2/3D5, Novocastra Laboratories). For secondary antibodies, fluorescein-conjugated goat antimouse IgG or rhodamine-conjugated goat antimouse IgG was used. Muscle specimens were also processed for electron microscopy as described previously.13

Mutation Analysis

Total RNA was isolated from the muscle-biopsy specimens with the use of a kit (RNeasy kit, Qiagen). Reverse transcription was performed with 3 µg of total RNA according to the manufacturer's instructions (SuperScript II reverse transcriptase kit, GIBCO BRL), followed by the polymerase chain reaction (PCR) with the desmin-specific primers dF (5'CCGTCACCATGAGCCAGG3') and dR (5'AGAGGGTCTCTCGTCTTTAG3').11,14 Amplification was carried out in a total volume of 20 µl containing 1 µl of single-stranded complementary DNA (cDNA), 0.5 µM of each primer, 125 µM of each deoxynucleotide triphosphate, 1.5 mM magnesium chloride, 10 mM TRIS–hydrochloric acid (pH 8.3), 50 mM potassium chloride, and 0.6 unit of rTth polymerase (Perkin–Elmer Cetus). The resulting DNA fragments were purified (Qiaex II gel extraction kit, Qiagen) and cloned into the TA cloning vector (Invitrogen). Both strands were sequenced in at least nine clones.

Blood samples were obtained from the patients, their relatives, and normal subjects and stored in heparin-treated tubes. Genomic DNA extracted from these blood samples was used as the template for the PCR assay, with primers specific for the desmin sequences constructed for separate exons. Amplification was carried out with use of a procedure designed for each exon. The resultant DNA fragments were subcloned (TA Cloning Kit, Invitrogen), and both strands were sequenced in at least six clones. Sequencing of cloned DNA and cDNA was performed according to the manufacturer's instructions (DyePrimer Sequencing, Perkin–Elmer Cetus) on an automated DNA sequencer (model 373A, Applied Biosystems).

The same amplicons were also digested with restriction endonucleases (BsaHI, Bsp1286I, NcoI, Sbf I, BsaWI, and RsaI, New England Biolabs, and TaiI, MBI Fermentas) according to the manufacturer's instructions and subjected to electrophoresis on a 4 percent agarose gel with a low melting point (NuSieve GTG, FMC BioProducts). To determine whether these mutations are common DNA variations, we screened 150 to 211 healthy unrelated control subjects from American and European populations for these mutations.

Mutations in the {alpha}B-crystallin gene, which encodes a chaperone protein, were screened by direct sequencing of the PCR products of each exon. Amplification was accomplished with the use of primers and PCR conditions as described previously.15

Expression of Desmin in Cultured Cells

Expression vectors for normal and mutant desmin were introduced into SW13 (vimentin-negative) cells. Since these cells do not express the intermediate filaments desmin, vimentin, or keratin, they are ideal for an assessment of whether the mutated desmin can form a network of intermediate filaments. The DNA fragment encompassing desmin cDNA, including the start and stop codons, was amplified by reverse-transcription PCR (RT-PCR) and cloned into the pCR2.1 expression vector. The entire sequence of each clone was verified by sequence analysis. Desmin expression vectors were constructed for each identified mutation by cloning a 1.5-kb Hind III–XhoI fragment of the pCR2.1 clone containing either normal or mutant desmin cDNA into the mammalian expression vector pcDNA3.1. The SW13 (vimentin-negative) cells were grown to 50 percent confluence with Dulbecco's minimal essential medium containing 10 percent fetal-calf serum and transfected with the use of a transfection reagent (Effectene, Qiagen). Forty-eight hours after transfection, the cells were washed, exposed to 4 percent paraformaldehyde for 15 minutes, and incubated with human desmin monoclonal antibody (D1033, Sigma) for 16 hours at 4°C. For the secondary antibody, rhodamine-conjugated antimouse IgG (T7657, Sigma) was used. The cells were observed and photographed under a confocal microscope. Transfected cells from all mutations were also processed for electron microscopy.13

Results

Light-Microscopical, Immunocytochemical, and Ultrastructural Findings

The most consistent finding in every muscle-biopsy specimen was the presence of bluish accumulations in subsarcolemmal or centrally located areas (Figure 1A). In serial sections, these accumulations were strongly immunoreactive on staining with antibodies against desmin (Figure 1B). The number of fibers with desmin-positive accumulations varied among specimens and did not correlate with the severity of muscle weakness. All desmin-positive regions were also strongly positive for dystrophin and variably positive for vimentin or ß-spectrin, as reported previously.1,2,3 Vacuoles (Figure 1), many of them red-rimmed, and small aggregates of rods were observed in specimens from five of six patients. Multiple nuclei, atrophic fibers, and cytoplasmic bodies were common. On electron microscopy, myofibrillar disruption, fragments of thin and thick filaments, streaming Z bands, and deposits of dense, amorphous material (Figure 1C and Figure 1D) were prominent in all specimens examined. Accumulations of intermediate filaments were not observed.

Analysis of the Desmin Gene Sequences

The length of the RT-PCR–amplified transcripts from each of the muscle-biopsy specimens, except for those from Patient 6, was 1437 bp. This was also the length of transcripts from the control samples and suggests the absence of splicing errors. Patient 6 had a smaller cDNA fragment of 1341 bp, in addition to a normal 1437-bp fragment, suggesting the occurrence of a heterozygous deletion. The cDNA-sequence analysis led to the identification of the deletion of exon 3. Sequencing of genomic DNA demonstrated that the deletion was due to a splicing defect caused by the substitution of guanine for adenine in the third nucleotide of the splice donor site in intron 3 (Table 2). With the exception of the splicing defect identified in Patient 6, the mutations consisted of missense mutations in the coding region of the desmin gene in 11 patients (Table 2). Three mutations identified in two families have already been briefly described.11

View this table:
[in this window]
[in a new window]
  		Table 2. Mutations in the Desmin Gene Identified in Patients with Desmin Myopathy.

 
In both affected members of Family 1, the nucleotide sequence of desmin cDNA revealed the substitution of cytosine for guanine in exon 5, changing the sequence of codon 337 from GCC to CCC and the encoded amino acid from alanine to proline (Table 2). The mutation was verified by genomic sequencing and restriction-enzyme analysis with BsaHI. Each of the three affected members of Family 2 had two missense mutations, A360P on the maternal allele and N393I on the paternal allele (Table 2), indicating the presence of compound heterozygosity. Several unaffected family members carried one, but not both, of the mutations. Functional studies confirmed that both mutations cause a severely dysfunctional desmin. In three affected members of Family 3, nucleotide sequencing of desmin cDNA revealed the substitution of guanine for cytosine in exon 8, changing the sequence of codon 451 from ATC to ATG and the encoded amino acid from isoleucine to methionine (Table 2). Several unaffected family members were found to have the same mutation on restriction-enzyme analysis with NcoI. Both affected members of Family 4 had a guanine substituted for adenine in codon 342 of exon 6, changing the sequence of the codon from AAC to GAC and the encoded amino acid from asparagine to aspartic acid (Figure 2 and Table 2). The mutation was confirmed by analysis with Sbf I.


View larger version (30K):
[in this window]
[in a new window]
  		Figure 2. Nucleotide Sequences of Desmin Gene Fragments from Two Members of Family 4 with Familial Autosomal Dominant Myopathy (Panel A) and from Patient 5, Who Had Sporadic Cardiac and Skeletal Myopathy, and Her Unaffected Parents (Panel B).

The alterations identified in codons 342 and 406 of the desmin gene are underlined, and the nucleotides affected are italicized. Restriction enzymes Sbf l and BsaWI were used to screen for mutations. Bands associated with mutations on electrophoresis are indicated by the arrows.

 
In Patient 5, who had sporadic desmin myopathy, thymine was substituted for cytosine in codon 406 of exon 6, changing the sequence of the codon from CGG to TGG and resulting in the substitution of tryptophan for arginine (Figure 2 and Table 2). None of the unaffected parents of the two patients with sporadic myopathy (Patients 5 and 6) had evidence of mutations on direct sequencing or restriction-enzyme analysis, confirming that these patients had spontaneous mutations in the desmin gene. The possibility of alternative paternity was excluded by assessment with a battery of microsatellite markers.

None of the normal subjects had any of the above-mentioned alterations in the desmin gene, indicating that these mutations are not polymorphisms. Desmin mutations were also excluded in the other four families with myofibrillar myopathies that we studied, based on sequencing of cDNA and of all nine exons amplified from genomic DNA. Also, no mutations in the {alpha}B-crystallin gene were identified.

Studies of in Vitro Expression

The SW13 (vimentin-negative) cells transfected with normal desmin protein formed extensive cytoplasmic filamentous networks that were positive for desmin (Figure 3A). Cells transfected with the expression vector containing each mutant desmin did not produce an intracellular filamentous network but formed desmin-positive aggregates scattered throughout the cytoplasm (Figure 3B). On electron microscopy (Figure 3C and Figure 3D) these aggregates resembled the accumulations seen in the muscle-biopsy specimens (Figure 1D). Cells transfected with the two mutant desmins from Family 2, which had two alterations in the desmin gene, did not produce a network of intermediate filaments. There were no apparent qualitative differences in the expression studies among the identified mutations, except for the mutation at codon 451, which led to only mild impairment of the filamentous network.


View larger version (158K):
[in this window]
[in a new window]
  		Figure 3. SW13 (Vimentin-Negative) Cell Lines Transfected with a Plasmid Construct Containing Either a Normal Desmin cDNA Sequence or the cDNA Sequence of a Mutant Allele from the Proband in Family 2.

In Panels A and B, cells were stained with an antibody against normal desmin with use of an indirect immunofluorescence technique. Normal desmin creates a well-structured filamentous network (Panel A). In contrast, cells transfected with the mutant desmin (A360P) cannot form a filamentous network but form scattered desmin-positive aggregates (Panel B). The bar represents 20 µm. Electron-microscopical examination of the same cells confirms the formation of aggregates only in the cells transfected with the mutant desmin (Panel D, x16,000) and not in cells transfected with the normal desmin sequence (Panel C, x20,000). In all the cells transfected with each of the identified mutant desmin sequences except the C-to-G missense mutation at codon 451 in Family 3 (Table 2), the aggregates resembled those seen in the muscle-biopsy specimens. (An example is shown in Fig. 1D.)

 
Correlations between Phenotype and Genotype

Although most of the missense mutations causing myopathy were clustered at the carboxy-terminal part of the desmin rod domain (Figure 4) within the 2B subdomain, there were differences in the clinical severity of disease and the age at onset of symptoms. In members of Family 1, who had an autosomal dominant mutation, the onset of disease was relatively late, the rate of progression was slow, and there was mild cardiomyopathy or none at all. In members of Family 2, who had compound heterozygosity, cardiomyopathy developed in early childhood and skeletal myopathy developed approximately 10 years later; two of the proband's affected brothers had died in their 30s. In Patient 5, severe and rapidly progressive myopathy developed in her 20s and was followed within months by cardiomyopathy. In Patient 6, who had a deletion mutation in the 1B subdomain, cardiomyopathy developed at the age of 40 years, and she had a moderate degree of skeletal myopathy by the age of 43 years. Most of the affected members of Family 3 and Family 4 did not have cardiomyopathy, but the severity of their skeletal myopathy ranged from mild to severe and involved respiratory muscles in Family 3.


View larger version (4K):
[in this window]
[in a new window]
  		Figure 4. Secondary Structure of Human Desmin and the Location of the Mutations Associated with Cardiac and Skeletal Myopathy.

Boxes indicate four conserved {alpha}-helical subdomains (1A, 1B, 2A, and 2B) that are separated by nonhelical linkers. The helical rod domain is flanked by a nonhelical amino-terminal domain (head) and carboxy-terminal domain (tail). Most of the identified point mutations are located in the carboxy-terminal part of 2B (arrows). The deletion mutation identified in Patient 6, located in the 1B subdomain, led to the deletion of exon 3 as a result of the substitution of guanine for adenine in the third nucleotide of the splice donor site in intron 3 (IVS3+3A->G). Another deletion mutation in exon 3, described in a Spanish family,12 resulted in a small (7-amino-acid) deletion ({Delta}173–179).

 
Discussion

This study provides direct evidence that among the dominantly inherited or sporadic myofibrillar myopathies, there is a genetically distinct subgroup — desmin myopathy — characterized by pathogenic mutations in the desmin gene and by frequent cardiac-conduction defects. In spite of the apparent clinical and histologic similarities between patients with desmin myopathy and those with other myofibrillar myopathies, none of the 12 patients from 4 families with other types of myofibrillar myopathies whom we studied had mutations in the coding region of the desmin gene, indicating that desmin myopathy is a distinct subgroup.

Among the four families with desmin myopathy defined by such mutations, three had an autosomal dominant mode of inheritance and the fourth (Family 2) demonstrated a pattern of inheritance compatible with the presence of compound heterozygosity. The two patients with sporadic disease (Patients 5 and 6) had spontaneous mutations. Since the frequency of sporadic myofibrillar myopathy appears to be high,4 the desmin gene and possibly other unidentified genes may be hot spots for mutations. One large family in which desmin gene mutations were excluded had functional mutations in the {alpha}B-crystallin gene,15 which encodes a chaperone protein necessary for the stabilization of desmin intermediate filaments.16 We excluded the possibility of mutations in the {alpha}B-crystallin gene in all our patients.

Functional studies provide compelling evidence that the mutations in the human desmin gene are pathogenic and interfere with the assembly of intermediate filaments in vitro. Because the functional abnormalities caused by the mutant desmin can be reversed by the insertion of a wild-type desmin,12 the amount of wild-type desmin within the myofibers may determine the severity of symptoms. Consequently, the absence of symptoms in heterozygous family members and the clinical heterogeneity within and between families may be related to the site of the mutation and to the presence of at least one wild-type allele. In experiments in vitro in our study and in other studies, truncated desmin molecules17,18 and mutant human desmin expressed in SW13 (vimentin-negative) cells produced aggregates similar to those seen in muscle-biopsy specimens. In the muscle, these accumulations are useful histologic markers, but they do not correlate with the severity of muscle involvement, suggesting that the cause of muscle weakness is related to the dysfunction of intermediate filaments rather than to the accumulation of myofibrillar proteins.

In the skeletal and cardiac muscles, normal desmin encircles the Z bands that hold together the actin filaments and help transmit tension along the myofibrils, protecting their structural integrity during repeated muscle contractures over time (Figure 5). 6,7,19,23 Defects in the function of desmin, as well as in the other desmin-associated filaments, such as plectin and {alpha}B-crystallin (Figure 5), may therefore cause fragility of the myofibrils and impair contraction. In mice that lack desmin, cardiomyopathy and skeletal myopathy develop in older age.8,9,24,25 Remarkably, the presence of myopathy in mice correlates with the extent of muscle use, and the histologic features in muscle specimens from these mice are very similar to those of patients with desmin myopathy, including disrupted myofibrils and streaming of Z bands.8,9,25 In our patients, skeletal myopathy did not develop before the age of 20 years and in most cases was not rapidly progressive. Because intermediate filaments participate in the transmission of active force,26 the disruption of the filamentous network by the mutant desmin impairs the force generated within the contractile filaments and weakens the sarcomere (Figure 5), resulting in myofibrillar damage over a period of several years because of the cumulative effects of mechanical stress and muscle use. The contributory effect of mechanical stress with advancing age has been recognized in patients with metabolic myopathies.27


View larger version (103K):
[in this window]
[in a new window]
  		Figure 5. Main Intermediate Filaments and Cytoskeletal Proteins Linking the Extracellular Matrix with the Structural Muscle Proteins Associated with Mutations Causing Cardiac and Skeletal Myopathy.

In the mature cardiac and skeletal muscle, the Z bands hold together the actin filaments and have a fundamental role in the transmission of tension throughout the myofibril. The desmin filaments, consisting of 10-nm-wide intermediate filaments, encircle the Z bands and are fastened to them and to one another by plectin filaments.619 Desmin (from the Greek noun desmos, meaning link or bond) mechanically integrates the contractile actions of the muscle fiber laterally by linking the individual myofibrils at the Z-band level, as shown for three adjacent myofibrils, and longitudinally by linking the Z bands to the sarcolemma and nuclei (along with other intermediate-filament–associated proteins).6 The heat-shock protein {alpha}B-crystallin protects, or chaperones, the desmin filaments from stress-induced damage. Desmin, along with {alpha}B-crystallin and plectin, forms an organized network at the Z-band level that protects the structural integrity of the myofibrils during mechanical stress.16 Mutations in desmin, {alpha}B-crystallin, and plectin1420 cause fragility of the myofibrils and lead to their destruction after repetitive mechanical stress. Mutations in other cytoskeletal proteins, including dystrophin, actin, the sarcoglycan complex,21 the nuclear protein emerin, and the intermediate nuclear filaments lamin A and C,22 are also associated with cardiomyopathy and skeletal myopathy.

 
All but one of the six point mutations in the desmin gene that we identified were clustered at the carboxy-terminal part of the desmin rod domain, and five of them were within the 2B subdomain. The results of in vitro studies of peptide assembly have strongly indicated that the integrity of the carboxy-terminal part of the desmin rod is critically important for the proper assembly of intermediate filaments.17,18,28 The deletion of only four carboxy-terminal residues or the substitution of a single amino acid impairs the assembly of desmin molecules and disrupts the desmin–vimentin network.17,28 The introduction of proline residues at the carboxy-terminal end of the desmin rod, as occurs with A337P and A360P mutations, results in short, thick, and kinked irregular structures.28 A similar effect was observed in mutagenesis experiments with keratin, an intermediate filament in skin cells that is structurally and functionally similar to desmin.29

Recently, two additional mutations have been reported. One was identified in a family with dilated cardiomyopathy but without skeletal myopathy, in which no functional studies were performed.30 The other was identified in a large Ashkenazi Jewish family with 28 affected members in 6 generations with dominantly inherited distal myopathy associated with missense mutations in the desmin rod domain.31

Intermediate filaments are critical mechanical integrators of the cytoskeleton, protecting the cell from repeated mechanical stress. Mutations in the most common human intermediate filament, keratin, have been causally connected to epidermolysis bullosa simplex.7 Like the mutations in the desmin gene that interfere with the assembly of intermediate filaments in the muscles of humans and mice lacking desmin, mutations in the keratin gene affect the mechanical integrity of the epidermal cells. Thus, it appears that desminopathies along with keratinopathies form a new category of intermediate-filament disorders. Recognition of the desminopathies is important because cardiac-conduction defects, if unrecognized or unanticipated, can cause sudden death. Mutations in other intermediate-filament–associated proteins, such as plectin, which is a linker protein, connecting desmin to Z bands (Figure 5),19 and {alpha}B-crystallin, which protects desmin filaments from stress-induced damage, cause myopathy similar to desmin myopathy.15,20 Our findings expand the spectrum of genetically identifiable skeletal and cardiac myopathies caused by defects in proteins of the extracellular matrix, the dystroglyan complex, dystrophin, sarcomere, intermediate filaments, and components of the nuclear envelope.21,22

We are indebted to Dr. Victor Ferrans of the National Heart, Lung, and Blood Institute for help with the expression studies; to Neal Epstein for helpful discussions; and to all the patients who participated in the study.


Source Information

From the Neuromuscular Diseases Section (M.C.D., C.S.-M., K.S.) and the Clinical Neurogenetics Unit (K.-Y.P., H.S.L., L.G.G.), National Institute of Neurological Disorders and Stroke, National Institutes of Health, Bethesda, Md.

Address reprint requests to Dr. Dalakas at the Neuromuscular Diseases Section, NINDS, National Institutes of Health, Bldg. 10, Rm. 4N248, 10 Center Dr., MSC 1382, Bethesda, MD 20892-1382, or at dalakas{at}helix.nih.gov.

References

  1. Nakano S, Engel AG, Waclawik AJ, Emslie-Smith AM, Busis NA. Myofibrillar myopathy with abnormal foci of desmin positivity. I. Light and electron microscopy analysis of 10 cases. J Neuropathol Exp Neurol 1996;55:549-562. [Medline]
  2. De Bleecker JL, Engel AG, Ertl BB. Myofibrillar myopathy with abnormal foci of desmin positivity. II. Immunocytochemical analysis reveals accumulation of multiple other proteins. J Neuropathol Exp Neurol 1996;55:563-577. [Medline]
  3. Nakano S, Engel AG, Akiguchi I, Kimura J. Myofibrillar myopathy. III. Abnormal expression of cyclin-dependent kinases and nuclear proteins. J Neuropathol Exp Neurol 1997;56:850-856. [Medline]
  4. Goebel HH. Desmin-related myopathies. Curr Opin Neurol 1997;10:426-429. [Medline]
  5. Amato AA, Kagan-Hallet K, Jackson CE, et al. The wide spectrum of myofibrillar myopathy suggests a multifactorial etiology and pathogenesis. Neurology 1998;51:1646-1655. [Free Full Text]
  6. Lazarides E. Intermediate filaments as mechanical integrators of cellular space. Nature 1980;283:249-256. [CrossRef][Medline]
  7. Fuchs E, Cleveland DW. A structural scaffolding of intermediate filaments in health and disease. Science 1998;279:514-519. [Free Full Text]
  8. Capetanaki Y, Milner DJ, Weitzer G. Desmin in muscle formation and maintenance: knockouts and consequences. Cell Struct Funct 1997;22:103-116. [Medline]
  9. Milner DJ, Weitzer G, Tran D, Bradley A, Capetanaki Y. Disruption of muscle architecture and myocardial degeneration in mice lacking desmin. J Cell Biol 1996;134:1255-1270. [Free Full Text]
  10. Thornell L-E, Carlsson L, Li Z, Mericskay M, Paulin D. Null mutation in the desmin gene gives rise to a cardiomyopathy. J Mol Cell Cardiol 1997;29:2107-2124. [CrossRef][Medline]
  11. Goldfarb LG, Park K-Y, Cervenakova L, et al. Missense mutations in desmin associated with familial cardiac and skeletal myopathy. Nat Genet 1998;19:402-403. [CrossRef][Medline]
  12. Munoz-Marmol AM, Strasser G, Isamat M, et al. A dysfunctional desmin mutation in a patient with severe generalized myopathy. Proc Natl Acad Sci U S A 1998;95:11312-11317. [Free Full Text]
  13. Semino-Mora C, Dalakas MC. Rimmed vacuoles with ß-amyloid and ubiquitinated filamentous deposits in the muscles of patients with long-standing denervation (postpoliomyelitis muscular atrophy): similarities with inclusion body myositis. Hum Pathol 1998;29:1128-1133. [CrossRef][Medline]
  14. Vicart P, Dupret JM, Hazan J, et al. Human desmin gene: cDNA sequence, regional localization and exclusion of the locus in a familial desmin-related myopathy. Hum Genet 1996;98:422-429. [CrossRef][Medline]
  15. Vicart P, Caron A, Guicheney P, et al. A missense mutation in the {alpha}B-crystallin chaperone gene causes a desmin-related myopathy. Nat Genet 1998;20:92-95. [CrossRef][Medline]
  16. Bennardini F, Wrzosek A, Chiesi M. {alpha}B-crystallin in cardiac tissue: association with actin and desmin filaments. Circ Res 1992;71:288-294. [Free Full Text]
  17. Yu KR, Hijikata T, Lin ZX, Sweeney HL, Englander SW, Holtzer H. Truncated desmin in PtK2 cells induces desmin-vimentin-cytokeratin coprecipitation, involution of intermediate filament networks, and nuclear fragmentation: a model for many degenerative diseases. Proc Natl Acad Sci U S A 1994;91:2497-2501. [Free Full Text]
  18. Raats JM, Schaart G, Henderik JB, et al. Muscle-specific expression of a dominant negative desmin mutant in transgenic mice. Eur J Cell Biol 1996;71:221-236. [Medline]
  19. Hijikata T, Murakami T, Imamura M, Fujimaki N, Ishikawa H. Plectin is a linker of intermediate filaments to Z-discs in skeletal muscle fibers. J Cell Sci 1999;112:867-876. [Abstract]
  20. Banwell BL, Russel J, Fukudome T, Shen XM, Stilling G, Engel AG. Myopathy, myasthenic syndrome, and epidermolysis bullosa simplex due to plectin deficiency. J Neuropathol Exp Neurol 1999;58:832-846. [Medline]
  21. Dalakas MC. Diseases of muscle and the neuromuscular junction. Part 3 of Neurology. No. 11. In: Rubinstein E, ed. Scientific American medicine. Vol. 3. New York: Scientific American, 1997:111-1–111-14.
  22. Fatkin D, MacRae C, Sasaki T, et al. Missense mutations in the rod domain of the lamin A/C gene as causes of dilated cardiomyopathy and conduction-system disease. N Engl J Med 1999;341:1715-1724. [Free Full Text]
  23. Watson PA, Hannan R, Carl LL, Giger KE. Desmin gene expression in cardiac myocytes is responsive to contractile activity and stretch. Am J Physiol 1996;270:C1228-C1235. [Free Full Text]
  24. Weitzer G, Milner DJ, Kim JU, Bradley A, Capetanaki Y. Cytoskeletal control of myogenesis: a desmin null mutation blocks the myogenic pathway during embryonic stem cell differentiation. Dev Biol 1995;172:422-439. [CrossRef][Medline]
  25. Li Z, Colucci-Guyon E, Pincon-Raymond M, et al. Cardiovascular lesions and skeletal myopathy in mice lacking desmin. Dev Biol 1996;175:362-366. [CrossRef][Medline]
  26. Sjuve R, Arner A, Li Z, et al. Mechanical alterations in smooth muscle from mice lacking desmin. J Muscle Res Cell Motil 1998;19:415-429. [CrossRef][Medline]
  27. Sivakumar K, Vasconcelos O, Goldfarb L, Dalakas MC. Late-onset muscle weakness in partial phosphofructokinase deficiency: a unique myopathy with vacuoles, abnormal mitochondria, and absence of the common exon 5/intron 5 junction point mutation. Neurology 1996;46:1337-1342. [Free Full Text]
  28. Raats JMH, Henderik JBJ, Verdijk M, et al. Assembly of carboxy-terminally deleted desmin in vimentin-free cells. Eur J Cell Biol 1991;56:84-103. [Medline]
  29. Letai A, Coulombe PA, Fuchs E. Do the ends justify the means? Proline mutations at the ends of the keratin coiled-coil rod segment are more disruptive than internal mutations. J Cell Biol 1992;116:1181-1195. [Free Full Text]
  30. Li D, Tapscoft T, Gonzalez O, et al. Desmin mutation responsible for idiopathic dilated cardiomyopathy. Circulation 1999;100:461-464. [Free Full Text]
  31. Sjöberg G, Saavedra-Matiz CA, Rosen DR, et al. A missense mutation in the desmin rod domain is associated with autosomal dominant distal myopathy, and exerts a dominant negative effect on filament formation. Hum Mol Genet 1999;8:2191-2198. [Free Full Text]

 

This Article
-Abstract
- PDF

Tools and Services
-Add to Personal Archive
-Add to Citation Manager
-Notify a Friend
-E-mail When Cited

More Information
-PubMed Citation

This article has been cited by other articles:


HOME  |  SUBSCRIBE  |  SEARCH  |  CURRENT ISSUE  |  PAST ISSUES  |  COLLECTIONS  |  PRIVACY  |  TERMS OF USE  |  HELP  |  beta.nejm.org

Comments and questions? Please contact us.

The New England Journal of Medicine is owned, published, and copyrighted © 2009 Massachusetts Medical Society. All rights reserved.