FREE NEJM E-TOC    HOME   |   SUBSCRIBE   |   CURRENT ISSUE   |   PAST ISSUES   |   COLLECTIONS   |   Search Term  Advanced Search

Sign in | Get NEJM's E-Mail Table of Contents — Free | Subscribe

Previous Volume 342:1560-1567 May 25, 2000 Number 21 Next

Abstract PDF Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited PubMed Citation

ABSTRACT

Background Mutations in the parkin gene have recently been identified in patients with early-onset Parkinson's disease, but the frequency of the mutations and the associated phenotype have not been assessed in a large series of patients.

Methods We studied 73 families in which at least one of the affected family members was affected at or before the age of 45 years and had parents who were not affected, as well as 100 patients with isolated Parkinson's disease that began at or before the age of 45 years. All subjects were screened for mutations in the parkin gene with use of a semiquantitative polymerase-chain-reaction assay that simultaneously amplified several exons. We sequenced the coding exons in a subgroup of patients. We also compared the clinical features of patients with parkin mutations and those without mutations.

Results Among the families with early-onset Parkinson's disease, 36 (49 percent) had parkin mutations. The age at onset ranged from 7 to 58 years. Among the patients with isolated Parkinson's disease, mutations were detected in 10 of 13 patients (77 percent) with an age at onset of 20 years or younger, but in only 2 of 64 patients (3 percent) with an age at onset of more than 30 years. The mean (±SD) age at onset in the patients with parkin mutations was younger than that in those without mutations (32±11 vs. 42± 11 years, P<0.001), and they were more likely to have symmetric involvement and dystonia at onset, to have hyperreflexia at onset or later, to have a good response to levodopa therapy, and to have levodopa-induced dyskinesias during treatment. Nineteen different rearrangements of exons (deletions and multiplications) and 16 different point mutations were detected.

Conclusions Mutations in the parkin gene are a major cause of early-onset autosomal recessive familial Parkinson's disease and isolated juvenile-onset Parkinson's disease (at or before the age of 20 years). Accurate diagnosis of these cases cannot be based only on the clinical manifestations of the disease.

The phenotype associated with mutations in the parkin gene has not been clearly established, making the selection of patients for genetic testing difficult. In Japanese patients with parkin mutations, the disease is characterized by an early onset, dystonia at onset, hyperreflexia, early complications resulting from levodopa treatment, and slow progression.^9,10,11 In contrast, the clinical characteristics of some European and North African patients with parkin mutations were indistinguishable from those of patients with idiopathic Parkinson's disease, with an age at onset of up to 58 years.^13,14 The number of families analyzed so far is small, however, and the correlations between genotype and phenotype are uncertain. Brain tissue from the patients studied did not contain Lewy bodies, suggesting that the pathologic process might differ from that of idiopathic Parkinson's disease.^15,16

We performed a clinical and molecular study of 73 families with early-onset autosomal recessive Parkinson's disease, including 152 affected family members, and 100 patients with early-onset isolated Parkinson's disease. They were screened for mutations in the parkin gene by a semiquantitative polymerase-chain-reaction (PCR) assay designed to detect exon rearrangements (deletions and multiplications) and by genomic sequencing. Correlations between genotype and phenotype were assessed both in patients with parkin mutations and in those without such mutations.

Methods

Patients and Families

We studied 73 families (152 patients with Parkinson's disease and 53 unaffected relatives) that met the following criteria: symptoms of parkinsonism in affected family members that were reduced by at least 30 percent by treatment with levodopa (the response could not be assessed in 3 untreated patients); a mode of inheritance compatible with autosomal recessive transmission (affected siblings without affected parents); an age at onset of 45 years or younger in at least one of the affected siblings; and the absence of extensor plantar reflexes, ophthalmoplegia, early dementia, or early autonomic failure in the family members we examined. Twenty of the families originated from Italy, 14 from France, 12 from Great Britain, 10 from the Netherlands, 9 from Germany, 2 from Portugal, and 1 each from Spain, Algeria, Morocco, Argentina, India, and Vietnam. Eight of the families were consanguineous, and 12 have been described previously.^13,14 In addition, we studied 100 patients with isolated Parkinson's disease with an age at onset of 45 years or younger, most of whom were European, and 8 of whom were from consanguineous marriages. These 100 patients were selected according to the same clinical criteria used for the patients with familial disease but who had no family history of Parkinson's disease. Eight of these 100 patients had never received treatment.

The enrollment of the subjects was random. For each subject, we obtained clinical information from the subject or the subject's records and peripheral blood for DNA analysis. DNA was extracted from peripheral-blood leukocytes according to standard procedures. The study was approved by ethics committees in the countries of all the participating investigators, and written informed consent was obtained from all the study subjects.

Molecular Analysis

Screening for mutations in the parkin gene was performed in all index patients (except those known to be homozygous or to have compound heterozygosity for such mutations^13,14) with the use of a semiquantitative PCR assay for the detection of rearrangements of parkin exons. Exons 2 through 12 were amplified simultaneously in three groups by PCR (multiplex PCR): group 1 consisted of exons 4, 7, 8, and 11; group 2 consisted of exons 5, 6, 8, and 10; and group 3 consisted of exons 2, 3, 9, and 12 and an external control, C328, a 328-bp sequence of the transthyretin gene on chromosome 18. The primers used were the same as those described by Kitada et al.⁹ except for the primer for exon 3, for which exonic primers were used: 5'AATTGTGACCTGGATCAGC3' (Ex3iFor) as the forward primer and 5'CTGGACTTCCAGCTGGTGGTGAG3' (Ex3iRev) as the reverse primer. The C328 forward primer was 5'ACGTTCCTGATAATGGGATC3' (TTRForHex), and the reverse primer was 5'CCTCTCTCTACCAAGTGAGG3' (TTR328Rev). All forward primers were fluorescently labeled with HEX-phosphoramitide. The PCR products (2.5 µl) were analyzed by 5 percent denaturing polyacrylamide-gel electrophoresis with an automated sequencer (model ABI 377) and GeneScan version 3.1 and Genotyper version 1.1.1 software (all from Applied Biosystems). All reactions were performed at least twice. The DNA from a patient known to have a heterozygous deletion of exons 8 and 9 was always processed in parallel as an internal control.

We calculated the ratios of all the peak heights in a given reaction and then compared the ratios with the ratios measured in a specimen from a normal subject. This comparison yielded the following rules: values of 0.6 or less were interpreted as indicating a heterozygous deletion of an exon; values of 0.8 to 1.2 were interpreted as normal; values of 1.3 to 1.7 were interpreted as indicating a heterozygous duplication of an exon; values of 1.8 to 2.3 were interpreted as indicating a homozygous duplication or heterozygous triplication of an exon; and values of more than 2.6 were interpreted as indicating a homozygous triplication of an exon. An exon rearrangement was confirmed only if all the ratios concerning this exon were abnormal. The consequence of the rearrangements at the protein level (a frame shift vs. an in-frame rearrangement) was deduced from the exon sequences published by Kitada et al.⁹ (DNA Data Bank of Japan accession number AB009973).

Each PCR reaction involved, in a total volume of 25 µl, 40 ng of DNA, with 3 mM magnesium chloride, 0.2 mM of each deoxynucleoside triphosphate, and 1 U of Taq polymerase. Denaturation for 5 minutes at 95°C was followed by 23 cycles consisting of 30 seconds of denaturation at 95°C, 45 seconds of annealing at 53°C, and 2.5 minutes of extension at 68°C, with a final period of extension at 68°C for 5 minutes. Primer concentrations were chosen to yield — within the exponential phase of the PCR (data not shown) — similar peak heights in each multiplex reaction and ranged from 0.4 to 1.9 µM. Deletions and insertions of bases were deduced from the size of the PCR products.

In the case of 54 index patients with familial disease and 91 index patients with isolated disease, exon rearrangements or deletions or insertions of bases were not found on both chromosomes and thus did not account for the phenotype. Therefore, the entire coding region of the parkin gene (including exon–intron boundaries) was sequenced as described previously¹⁴ in 53 index patients with familial disease and 50 patients with isolated disease.

Whether the parkin variants we identified cosegregated with the disease was assessed by genotyping of all available members, affected or not, of the respective families. In addition, 114 chromosomes from mostly European, unrelated controls who had no movement disorders were analyzed for the point mutations and the rearrangements of the exons represented in multiplex group 3. The techniques used were restriction assays, polyacrylamide-gel electrophoresis, and the semiquantitative PCR assay. For two point mutations — the substitution of A for G at nucleotide 939 of complementary DNA (cDNA) and the substitution of T for C at nucleotide 1101 of cDNA — mismatched reverse primers were used in order to create a restriction site that depended on the point mutation being looked for: 5'GGCAGGGAGTAGCCAAGTTGAGGAT3' for digestion with Alw I and 5'AGCCCCGCTCCACAGCCAGCGC3' for digestion with Bst UI (in each primer, the underlined nucleotide differs from the wild-type sequence).

Statistical Analysis

Means (±SD) were compared with the nonparametric Mann–Whitney U test. Frequencies were compared with the chi-square test, with Yates' correction when appropriate.

Results

Frequency of Mutations in the parkin Gene

Twenty-five families (56 patients) with autosomal recessive Parkinson's disease had homozygous or compound heterozygous mutations on each allele of the parkin gene (Table 1). In addition, 11 families (27 patients) with a mutation in one allele were considered to have parkin-related disease, on the basis of the assumption that the second mutation was not detected by the methods used in this study. Thus, mutations in the parkin gene were detected in 36 of 73 families (49 percent), including 12 previously described families.^13,14 Among the 100 patients with isolated Parkinson's disease, 18 (18 percent) had parkin mutations. The frequency of mutations among consanguineous patients with isolated Parkinson's disease, a pattern that is suggestive of autosomal recessive inheritance, was similar to that among consanguineous patients with familial disease (50 percent vs. 62 percent). The frequency of mutations in the patients with isolated Parkinson's disease decreased significantly with increasing age at onset: mutations were detected in 10 of 13 patients (77 percent) with an age at onset of disease of 20 years or younger, but only in 2 of 64 patients (3 percent) with an age at onset of 31 to 45 years (Table 2). Sequencing of the parkin gene in 22 of the 64 patients with isolated Parkinson's disease who were older than 30 years at the onset of symptoms revealed a point mutation in only 1 patient. In 14 families in which the affected family members had parkin mutations on both chromosomes, none of 28 unaffected siblings had two parkin mutations, indicating the high penetrance of the mutations.

View this table: [in this window] [in a new window]   Table 1. Frequency of Mutations in the parkin Gene in 73 Families with Autosomal Recessive Early-Onset Parkinson's Disease and 100 Patients with Isolated Early-Onset Parkinson's Disease.

 

View this table: [in this window] [in a new window]   Table 2. Frequency of Mutations in the parkin Gene in 100 Patients with Isolated Early-Onset Parkinson's Disease, According to the Age at Onset.

 
Clinical Studies

The 36 families with Parkinson's disease and parkin mutations and the 18 patients with isolated Parkinson's disease and parkin mutations came from a variety of regions: France (in 15 cases), Italy (in 13), Great Britain (in 7), the Netherlands (in 3), Spain (in 3), Germany (in 3), Portugal (in 2), Algeria (in 2) and Lebanon, India, Pakistan, Vietnam, Japan, and Argentina (in 1 case each).

As a group, the 100 patients with parkin mutations had a mean (±SD) age at onset of 32±11 years (range, 7 to 58); the age at onset was not known for 1 patient (Table 3). Among the patients with an age at onset of 45 years or younger, the onset of the disease was earlier in the 18 patients with isolated Parkinson's disease and parkin mutations than in the 75 patients with familial Parkinson's disease and mutations (mean age, 21±9 vs. 32±9 years; median, 20 vs. 33 years; P<0.001). This difference was not due to selection bias, because the mean ages at onset were similar in the two groups when all initially included patients with an age at onset of 45 years or younger were compared, whether or not they had parkin mutations (age at onset in 118 patients with familial disease, 34±9 years; in 100 patients with isolated disease, 32±9 years). The mean age at onset was significantly younger in the patients with parkin mutations than in those without mutations, both in the total sample (Table 3) and in the group with familial cases alone (34±10 years for 82 patients with familial disease and mutations and 43±12 years for 65 patients with familial disease but without mutations; P<0.001).

View this table: [in this window] [in a new window]   Table 3. Characteristics of Patients with Parkinson's Disease According to the Presence or Absence of Mutations in the parkin Gene.

 
The initial manifestations of the disease in most patients with parkin mutations were tremor (65 percent) and bradykinesia (63 percent) (Table 3). The patients with parkin mutations had significantly higher frequencies of dystonia and symmetric symptoms at onset and of hyperreflexia at onset or later, as well as a better response to levodopa despite having had the disease for a longer period (Table 3) than those with no parkin mutations. Dystonia began in the lower limbs in 28 of 31 patients with mutations, but 2 patients first had torticollis and 1 had right-arm dystonia. Dyskinesia as a result of levodopa treatment was significantly more common in patients with mutations than in those with no mutations, but such dyskinesia occurred in both groups, on average, after nearly 5 years of treatment (range, 1 month to 20 years). There were no significant differences between the 24 patients with at least one missense mutation and the 52 patients with two truncating mutations; the 25 patients with single heterozygous truncating mutations were not assigned to either group, since the nature of the suspected second mutation was unknown.

Nineteen different homozygous and heterozygous exon rearrangements were found in 35 index patients, including 4 from previously described families with homozygous deletions of exons (Table 4 and Figure 1A).^13,14 In addition to identifying the suspected deletions of an exon, our approach provided evidence of four duplications of an exon and one triplication of an exon. The results were highly reproducible and confirmed by cosegregation analysis. Rearrangements of exons 2, 3, 9, and 12 were not found in the controls.

View this table: [in this window] [in a new window]   Table 4. Frequency of Homozygous, Compound Heterozygous, and Single Heterozygous Mutations among 45 Index Patients with Familial or Isolated Parkinson's Disease, According to the Type of Mutation.

 

View larger version (20K): [in this window] [in a new window]   Figure 1. Mutations in the parkin Gene. Panel A shows the exon rearrangements identified. Deletions are indicated above the sequence, and duplications (dup) and triplications (trip) are indicated below the sequence. Their deduced effect on the protein is represented by a dotted line for in-frame rearrangements and by a solid line for frame-shift rearrangements. The number of index patients with the rearrangement and the type of mutation — heterozygous (h) or homozygous (H) — are indicated above each mutation. Panel B shows the point mutations resulting in truncation of the sequence of 12 exons or in a missense mutation. The hatched regions indicate the ubiquitin-like domain and the RING–IBR–RING finger motif.19 The 6 truncating mutations are indicated above the sequence, and the 10 missense mutations are indicated below the sequence. For mutations identified in more than one index patient, the number of index patients with the mutation is given in parentheses. The nucleotide change and the restriction enzymes used to screen family members and unrelated control subjects without movement disorders are given in parentheses below the mutation (mm denotes the mismatch primer used for the PCR, and PAGE polyacrylamide-gel electrophoresis). Mutations that were not based on published sequences14 are underlined. Nucleotides prefaced by a small c indicate the numbers in the complementary DNA sequences described by Kitada et al.9 The ATG of the initiator methionine codon begins at nucleotide 102. The putative site of phosphorylation (P) and an N-myristoylation site (M) affected by the Thr415Asn and Trp453Stop mutations, respectively, are indicated. UTR denotes untranslated region.

 
Sixteen different exonic point mutations were found in 28 index patients, including 8 from previously described families¹⁴ (Table 4 and Figure 1B). In addition, an intronic deletion of 5 bp (IVS8 –21 to –17del) was detected. All point mutations cosegregated with the disease, and none were found in any control. The amino acids modified by mutations were conserved in the parkin orthologues in rats²⁰ and mice (Gene Bank accession numbers AF210434 and AB019558, respectively). However, in two patients from one family, the homozygous point mutation Arg334Cys was associated with the homozygous intronic 5-bp deletion and the heterozygous Asp280Asn mutation, so that the pathogenicity of the latter two mutations cannot be ascertained.

Many of the exon rearrangements were found repeatedly among the index patients, particularly deletions of exon 3 (in 10 patients), exon 2 (in 4), exon 4 (in 4), and exons 3 and 4 (in 4) (Figure 1A). Six point mutations were found in more than one index patient: the deletion of A at nucleotide 255 of cDNA (in six index patients), the deletion of A and G at nucleotide 202 to 203 of cDNA (in five), Arg275Trp (in five), the insertion of G and T between nucleotide 321 and nucleotide 322 of cDNA (in two), Lys211Asn (in two), and Gly430Asp (in two) (Figure 1).

Discussion

We detected mutations in the parkin gene in almost half the families with autosomal recessive Parkinson's disease in which at least one affected member was 45 years of age or younger at the onset of symptoms. The frequency of such mutations was lower in a group of patients with isolated early-onset Parkinson's disease.

On average, patients with parkin mutations began to have symptoms in their early 30s, but the age at onset ranged widely, from 7 to 58 years. The fact that the onset occurred at an earlier age in patients with isolated Parkinson's disease and parkin mutations than in those with familial Parkinson's disease and parkin mutations suggests that among patients who are older than 30 years at the onset of isolated Parkinson's disease, the disease is mainly due to causes other than parkin mutations.

Can patients with parkin mutations be distinguished clinically from patients with early-onset Parkinson's disease from other causes? As a group, those with parkin mutations had an earlier onset of disease, were more likely to have dystonia and symmetric signs at onset, as well as hyperreflexia at onset or later, and were more likely to have a better response to levodopa, but were also more likely to have dyskinesia during treatment, than were patients without parkin mutations. These signs were less frequent, however, than in previous reports^11,21 and could not be used specifically to identify patients with mutations. Furthermore, the clinical manifestations of the parkin mutations were independent of the age at onset.

In addition, patients with late-onset disease who have mutations can be difficult to distinguish from those with idiopathic Parkinson's disease. In general, however, the disease progressed slowly in the patients with mutations. Despite having had symptoms for many years, the majority of patients with parkin mutations had good responses to low doses of levodopa. Although levodopa-induced dyskinesia was reported to develop early,^9,11,21 the mean delay in our patients was about 5 years, with a maximum of 20 years. This time frame was similar to that for the patients without parkin mutations.

Finally, dementia was rare among the patients with mutations. This might be explained by a less widespread neuronal loss in patients with mutations, in whom the substantia nigra and, to a lesser extent, the locus caeruleus are selectively affected, as compared with patients with idiopathic Parkinson's disease.^15,16 However, the low frequency of dementia in the patients with mutations could also be due to a younger mean age at examination or to the exclusion of patients who had dementia early in the course of the disease.

There were no clinical differences between patients with missense mutations and those with truncating mutations. This finding was surprising, since missense mutations might be expected to interfere less with the function of the parkin protein than truncating mutations and therefore to result in a milder phenotype. We therefore assume that the 10 conserved amino acids that were affected by the missense mutations are of crucial importance for the function of the protein or that their modification results in decreased protein synthesis or more rapid degradation.²² In addition, the wide range of clinical signs, even within single families with mutations (e.g., variation of up to 20 years in the age at onset) suggests that additional factors contribute to the phenotype.

The chief histopathological differences between patients with parkin mutations and those with idiopathic Parkinson's disease that have been detected so far are the absence of Lewy bodies and the restriction of neuronal cell loss to the substantia nigra and the locus caeruleus in the patients with parkin mutations.¹⁶ Thus, parkin gene mutations are responsible for the death of selective cells, the mechanism of which might differ from that in idiopathic Parkinson's disease.

The PCR-based technique that we used revealed numerous rearrangements of exons, including those identified in eight families in which no mutations were found by direct sequencing.¹⁴ In combination with genomic sequencing, this technique greatly improves the sensitivity of the molecular diagnosis in patients with parkin gene mutations. The various combinations of exon deletions, the exon multiplications, and the newly identified point mutations increase the already wide variety of disease-related mutations identified in the parkin gene. The position of the mutations indicates functionally important protein regions such as the RING–IBR–RING domain, as does conservation of the corresponding amino acids in mice and rats.²⁰

The presence of both deletions and multiplications of some exons (e.g., exon 2 and 3) suggests that a mechanism such as unequal recombination might be involved. The observation that 13 of the mutations were found repeatedly in as many as 10 families raises the possibility of a founder effect. However, many of the mutations were found in families from different European countries, suggesting that these alterations are recurrent. The point mutations that accounted for the disease in approximately 40 percent of our patients seem to be less frequent among Japanese patients.¹¹ Finally, the identification of 15 index patients with single heterozygous mutations indicates that other mutations remain to be discovered, perhaps in noncoding regions of the parkin gene.

In conclusion, mutations of the parkin gene are frequent among patients with autosomal recessive Parkinson's disease. Although dystonia at the onset of disease, hyperreflexia, and a slow rate of disease progression are characteristic features of patients with parkin mutations, there are no specific clinical signs that distinguish these patients from patients with other causes of Parkinson's disease. The wide spectrum of mutations in the parkin gene renders molecular diagnosis difficult, but the relatively simple semiquantitative PCR method that we used detected approximately 70 percent of the mutations found in this series of patients.

Supported by the Assistance Publique–Hôpitaux de Paris; the Association France–Parkinson; the Italian Ministry for University, Scientific and Technological Research; the Parkinson's Disease Society (United Kingdom); the Doris Hillier Award (British Medical Association); by a grant from the European Community Biomed 2 (BMH4CT960664); and by the Prinses Beatrix Fund. Drs. Lücking and Gasser were supported by the Deutsche Forschungsgemeinschaft.

We are indebted to Drs. N. Vanacore (Rome), L. Capus, A. Amoroso (Trieste, Italy), B.-P. Bejjani (Beirut, Lebanon), S. Medjbeur, P. Ferroir (Paris), F. Dubas (Angers, France), and M.W.I.M. Horstink (Nijmegen, the Netherlands) for directing patients to the study; to C. Penet, A. Camuzat, J. Bou, V. Chesneaux, and Y. Pothin (Paris) for expert technical assistance; to the families for their participation; and to Dr. Merle Ruberg for helpful discussions.

^* Other participants in the study are listed in the Appendix.

Source Information

From INSERM Unité 289, Hôpital de la Salpêtrière, Paris (C.B.L., A.D., Y.A., A.B.); the Dipartimento di Scienze Neurologiche, Università La Sapienza, Rome (V.B., G.M.); the Institute of Neurology, London (J.V., N.W.W.); the Dipartimento di Scienze Neurologiche, Università Federico II, Naples, Italy (G.D.); the Neurologische Klinik, Klinikum Großhadern, Ludwig Maximilians Universität, Munich, Germany (T.G.); the Department of Epidemiology and Biostatistics, Erasmus University Medical School, Rotterdam, the Netherlands (B.S.H); and Evry Genomics Center, Aventis Pharma France, Evry, France (P.D.). Other authors were D. Nicholl, M.D. (University of Birmingham, Birmingham, United Kingdom); M.M.B. Breteler, M.D. (Erasmus University Medical School, Rotterdam, the Netherlands); B.A. Oostra, M.D. (Erasmus University, Rotterdam, the Netherlands); M. De Mari, M.D. (Università degli Studi di Bari, Bari, Italy); R. Marconi, M.D. (Ospedale della Misericordia, Grosseto, Italy); A. Filla, M.D. (Università Federico II, Naples, Italy); A.-M. Bonnet, M.D. (Hôpital de la Salpêtrière, Paris); E. Broussolle, M.D. (Hôpital Pierre Wertheimer, Lyons, France); P. Pollak, M.D. (Centre Hospitalier Universitaire de Grenoble, Grenoble, France); O. Rascol, M.D. (INSERM Unité 455, Toulouse, France); and M. Rosier, Ph.D., and I. Arnould, Ph.D. (Aventis Pharma France, Evry, France).

Address reprint requests to Dr. Brice at INSERM Unité 289, Hôpital de la Salpêtrière, 47 Blvd. de l'Hôpital, 75651 Paris CEDEX 13, France, or at brice{at}ccr.jussieu.fr.

References

1. de Rijk MC, Tzourio C, Breteler MMB, et al. Prevalence of parkinsonism and Parkinson's disease in Europe: the EUROPARKINSON Collaborative Study: European community concerted action on the epidemiology of Parkinson's disease. J Neurol Neurosurg Psychiatry 1997;62:10-15. [Free Full Text]
2. Fearnley JM, Lees AJ. Ageing and Parkinson's disease: substantia nigra regional selectivity. Brain 1991;114:2283-2301. [Free Full Text]
3. Wood N. Genes and parkinsonism. J Neurol Neurosurg Psychiatry 1997;62:305-309. [Free Full Text]
4. Piccini P, Burn DJ, Ceravolo R, Maraganore D, Brooks DJ. The role of inheritance in sporadic Parkinson's disease: evidence from a longitudinal study of dopaminergic function in twins. Ann Neurol 1999;45:577-582. [CrossRef][Medline]
5. Polymeropoulos MH, Lavedan C, Leroy E, et al. Mutation in the alpha-synuclein gene identified in families with Parkinson's disease. Science 1997;276:2045-2047. [Free Full Text]
6. Leroy E, Boyer R, Auburger G, et al. The ubiquitin pathway in Parkinson's disease. Nature 1998;395:451-452. [CrossRef][Medline]
7. Gasser T, Müller-Myhsok B, Wszolek ZK, et al. A susceptibility locus for Parkinson's disease maps to chromosome 2p13. Nat Genet 1998;18:262-265. [CrossRef][Medline]
8. Farrer M, Gwinn-Hardy K, Muenter M, et al. A chromosome 4p haplotype segregating with Parkinson's disease and postural tremor. Hum Mol Genet 1999;8:81-85. [Free Full Text]
9. Kitada T, Asakawa S, Hattori N, et al. Mutations in the parkin gene cause autosomal recessive juvenile parkinsonism. Nature 1998;392:605-608. [CrossRef][Medline]
10. Hattori N, Matsumine H, Asakawa S, et al. Point mutations (Thr240Arg and Ala311Stop) in the parkin gene. Biochem Biophys Res Commun 1998;249:754-758. [Erratum, Biochem Biophys Res Commun 1998;251:666.] [CrossRef][Medline]
11. Hattori N, Kitada T, Matsumine H, et al. Molecular genetic analysis of a novel parkin gene in Japanese families with autosomal recessive juvenile parkinsonism: evidence for variable homozygous deletions in the parkin gene in affected individuals. Ann Neurol 1998;44:935-941. [CrossRef][Medline]
12. Leroy E, Anastasopoulos D, Konitsiotis S, Lavedan C, Polymeropoulos MH. Deletions in the parkin gene and genetic heterogeneity in a Greek family with early onset Parkinson's disease. Hum Genet 1998;103:424-427. [CrossRef][Medline]
13. Lücking CB, Abbas N, Dürr A, et al. Homozygous deletions in parkin gene in European and North African families with autosomal recessive juvenile parkinsonism. Lancet 1998;352:1355-1356. [CrossRef][Medline]
14. Abbas N, Lücking CB, Ricard S, et al. A wide variety of mutations in the parkin gene are responsible for autosomal recessive parkinsonism in Europe. Hum Mol Genet 1999;8:567-574. [Free Full Text]
15. Takahashi H, Ohama E, Suzuki S, et al. Familial juvenile parkinsonism: clinical and pathologic study in a family. Neurology 1994;44:437-441. [Free Full Text]
16. Mori H, Kondo T, Yokochi M, et al. Pathologic and biochemical studies of juvenile parkinsonism linked to chromosome 6q. Neurology 1998;51:890-892. [Free Full Text]
17. Fahn S, Elton RL, UPDRS Development Committee. Unified Parkinson's Disease Rating Scale. In: Fahn S, Marsden CD, Goldstein M, Calne DB, eds. Recent developments in Parkinson's disease. Vol. 2. Florham Park, N.J.: Macmillan Healthcare Information, 1987:153-63.
18. Hoehn MM, Yahr MD. Parkinsonism: onset, progression and mortality. Neurology 1967;17:427-442. [Free Full Text]
19. Morett E, Bork P. A novel transactivation domain in parkin. Trends Biochem Sci 1999;24:229-231. [CrossRef][Medline]
20. Gu W-J, Abbas N, Lagune-Zarate M, et al. Cloning of rat parkin cDNA and distribution of parkin in rat brain. J Neurochem 2000;74:1773-1776. [CrossRef][Medline]
21. Ishikawa A, Tsuji S. Clinical analysis of 17 patients in 12 Japanese families with autosomal-recessive type juvenile parkinsonism. Neurology 1996;47:160-166. [Free Full Text]
22. Bross P, Corydon TJ, Andresen BS, Jorgensen MM, Bolund L, Gregersen N. Protein misfolding and degradation in genetic diseases. Hum Mutat 1999;14:186-198. [CrossRef][Medline]

In addition to the authors, the following persons also participated in the study: M. Martinez, J. Feingold, E. Fabrizio, G. Volpe, and B. Bereznai (the European Consortium on Genetic Susceptibility in Parkinson's Disease); N. Abbas, M. Borg, A. Destée, F. Durif, G. Fénelon, J.-R. Fève, F. Gasparini, F. Tison, C. Tranchant, M. Vérin, F. Viallet, M. Vidailhet, and J.-M. Warter (the French Parkinson's Disease Genetics Study Group); and E. Turlotte, D. Debono, S. Ricard, L. Pradier, and G.A. Böhme.

Abstract PDF Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited PubMed Citation

This article has been cited by other articles:

• Rugbjerg, K., Friis, S., Ritz, B., Schernhammer, E. S., Korbo, L., Olsen, J. H. (2009). Autoimmune disease and risk for Parkinson disease: A population-based case-control study. Neurology 73: 1462-1468 [Abstract] [Full Text]  
• Muller, U. (2009). The monogenic primary dystonias. Brain 132: 2005-2025 [Abstract] [Full Text]  
• Ribeiro, M.-J., Thobois, S., Lohmann, E., du Montcel, S. T., Lesage, S., Pelissolo, A., Dubois, B., Mallet, L., Pollak, P., Agid, Y., Broussolle, E., Brice, A., Remy, P., and The French Parkinson's Disease Genetics Study, (2009). A Multitracer Dopaminergic PET Study of Young-Onset Parkinsonian Patients With and Without Parkin Gene Mutations. JNM 50: 1244-1250 [Abstract] [Full Text]  
• Pankratz, N., Kissell, D. K., Pauciulo, M. W., Halter, C. A., Rudolph, A., Pfeiffer, R. F., Marder, K. S., Foroud, T., Nichols, W. C., For the Parkinson Study Group-PROGENI Investigator, (2009). Parkin dosage mutations have greater pathogenicity in familial PD than simple sequence mutations. Neurology 73: 279-286 [Abstract] [Full Text]  
• Clot, F., Grabli, D., Cazeneuve, C., Roze, E., Castelnau, P., Chabrol, B., Landrieu, P., Nguyen, K., Ponsot, G., Abada, M., Doummar, D., Damier, P., Gil, R., Thobois, S., Ward, A. J., Hutchinson, M., Toutain, A., Picard, F., Camuzat, A., Fedirko, E., San, C., Bouteiller, D., LeGuern, E., Durr, A., Vidailhet, M., Brice, A., the French Dystonia Network, (2009). Exhaustive analysis of BH4 and dopamine biosynthesis genes in patients with Dopa-responsive dystonia. Brain 132: 1753-1763 [Abstract] [Full Text]  
• Hart, M. P., Xu, A. (2009). Mice Expressing Mutant Parkin Exhibit Hallmark Features of Parkinson's Disease. J. Neurosci. 29: 7392-7394 [Full Text]  
• Brooks, J, Ding, J, Simon-Sanchez, J, Paisan-Ruiz, C, Singleton, A B, Scholz, S W (2009). Parkin and PINK1 mutations in early-onset Parkinson's disease: comprehensive screening in publicly available cases and control. J. Med. Genet. 46: 375-381 [Abstract] [Full Text]  
• Hristova, V. A., Beasley, S. A., Rylett, R. J., Shaw, G. S. (2009). Identification of a Novel Zn2+-binding Domain in the Autosomal Recessive Juvenile Parkinson-related E3 Ligase Parkin. J. Biol. Chem. 284: 14978-14986 [Abstract] [Full Text]  
• Rubio de la Torre, E., Luzon-Toro, B., Forte-Lago, I., Minguez-Castellanos, A., Ferrer, I., Hilfiker, S. (2009). Combined kinase inhibition modulates parkin inactivation. Hum Mol Genet 18: 809-823 [Abstract] [Full Text]  
• Rascol, O. (2009). "Disease-modification" trials in Parkinson disease: Target populations, endpoints and study design. Neurology 72: S51-S58 [Abstract] [Full Text]  
• Lohmann, E., Thobois, S., Lesage, S., Broussolle, E., du Montcel, S. T., Ribeiro, M. -J., Remy, P., Pelissolo, A., Dubois, B., Mallet, L., Pollak, P., Agid, Y., Brice, A., The French Parkinson's Disease Genetics Study Grou, (2009). A multidisciplinary study of patients with early-onset PD with and without parkin mutations. Neurology 72: 110-116 [Abstract] [Full Text]  
• Klein, C., Lohmann, K. (2009). Parkinson disease(s): Is "Parkin disease" a distinct clinical entity?. Neurology 72: 106-107 [Full Text]  
• Mena, M. A., Garcia de Yebenes, J. (2008). Glial Cells as Players in Parkinsonism: The "Good," the "Bad," and the "Mysterious" Glia. Neuroscientist 14: 544-560 [Abstract]  
• Healy, D G, Wood, N W, Schapira, A H V (2008). Test for LRRK2 mutations in patients with Parkinson's disease. PN 8: 381-385 [Abstract] [Full Text]  
• Frank-Cannon, T. C., Tran, T., Ruhn, K. A., Martinez, T. N., Hong, J., Marvin, M., Hartley, M., Trevino, I., O'Brien, D. E., Casey, B., Goldberg, M. S., Tansey, M. G. (2008). Parkin Deficiency Increases Vulnerability to Inflammation-Related Nigral Degeneration. J. Neurosci. 28: 10825-10834 [Abstract] [Full Text]  
• Ishihara-Paul, L., Hulihan, M. M., Kachergus, J., Upmanyu, R., Warren, L., Amouri, R., Elango, R., Prinjha, R. K., Soto, A., Kefi, M., Zouari, M., Sassi, S. B., Yahmed, S. B., El Euch-Fayeche, G., Matthews, P. M., Middleton, L. T., Gibson, R. A., Hentati, F., Farrer, M. J. (2008). PINK1 mutations and parkinsonism. Neurology 71: 896-902 [Abstract] [Full Text]  
• Kumazawa, R., Tomiyama, H., Li, Y., Imamichi, Y., Funayama, M., Yoshino, H., Yokochi, F., Fukusako, T., Takehisa, Y., Kashihara, K., Kondo, T., Elibol, B., Bostantjopoulou, S., Toda, T., Takahashi, H., Yoshii, F., Mizuno, Y., Hattori, N. (2008). Mutation Analysis of the PINK1 Gene in 391 Patients With Parkinson Disease. Arch Neurol 65: 802-808 [Abstract] [Full Text]  
• Schroeder, C., Walter, M., Berg, D., Leitner, P., Bauer, P., Kohl, Z., Winkler, J., Riess, O., Bonin, M. (2008). High-Throughput Homogeneous Mass Cleave Assay Technology for the Diagnosis of Autosomal Recessive Parkinson's Disease. J. Mol. Diagn. 10: 217-224 [Abstract] [Full Text]  
• Klein, C., Ziegler, A. (2008). How to Predict the Risk of Parkinson Disease in Relatives of Parkin Mutation Carriers: A Complex Puzzle of Age, Penetrance, and Number of Mutated Alleles. Arch Neurol 65: 443-444 [Full Text]  
• Wang, Y., Clark, L. N., Louis, E. D., Mejia-Santana, H., Harris, J., Cote, L. J., Waters, C., Andrews, H., Ford, B., Frucht, S., Fahn, S., Ottman, R., Rabinowitz, D., Marder, K. (2008). Risk of Parkinson Disease in Carriers of Parkin Mutations: Estimation Using the Kin-Cohort Method. Arch Neurol 65: 467-474 [Abstract] [Full Text]  
• Moro, E., Volkmann, J., Konig, I. R., Winkler, S., Hiller, A., Hassin-Baer, S., Herzog, J., Schnitzler, A., Lohmann, K., Pinsker, M. O., Voges, J., Djarmatic, A., Seibler, P., Lozano, A. M., Rogaeva, E., Lang, A. E., Deuschl, G., Klein, C. (2008). Bilateral subthalamic stimulation in Parkin and PINK1 parkinsonism. Neurology 70: 1186-1191 [Abstract] [Full Text]  
• Lee, J. T., Wheeler, T. C., Li, L., Chin, L.-S. (2008). Ubiquitination of {alpha}-synuclein by Siah-1 promotes {alpha}-synuclein aggregation and apoptotic cell death. Hum Mol Genet 17: 906-917 [Abstract] [Full Text]  
• Solano, R. M., Casarejos, M. J., Menendez-Cuervo, J., Rodriguez-Navarro, J. A., Garcia de Yebenes, J., Mena, M. A. (2008). Glial Dysfunction in Parkin Null Mice: Effects of Aging. J. Neurosci. 28: 598-611 [Abstract] [Full Text]  
• Lesage, S, Lohmann, E, Tison, F, Durif, F, Durr, A, Brice, A, for the French Parkinson's Disease Genetics Study, (2008). Rare heterozygous parkin variants in French early-onset Parkinson disease patients and controls. J. Med. Genet. 45: 43-46 [Abstract] [Full Text]  
• Klein, C., Schlossmacher, M. G. (2007). Parkinson disease, 10 years after its genetic revolution: Multiple clues to a complex disorder. Neurology 69: 2093-2104 [Abstract] [Full Text]  
• Cookson, M. R., Dauer, W., Dawson, T., Fon, E. A., Guo, M., Shen, J. (2007). The Roles of Kinases in Familial Parkinson's Disease. J. Neurosci. 27: 11865-11868 [Abstract] [Full Text]  
• Inzelberg, R., Jankovic, J. (2007). Are Parkinson disease patients protected from some but not all cancers?. Neurology 69: 1542-1550 [Abstract] [Full Text]  
• Olzmann, J. A., Li, L., Chudaev, M. V., Chen, J., Perez, F. A., Palmiter, R. D., Chin, L.-S. (2007). Parkin-mediated K63-linked polyubiquitination targets misfolded DJ-1 to aggresomes via binding to HDAC6. JCB 178: 1025-1038 [Abstract] [Full Text]  
• Inoue, H., Lin, L., Lee, X., Shao, Z., Mendes, S., Snodgrass-Belt, P., Sweigard, H., Engber, T., Pepinsky, B., Yang, L., Beal, M. F., Mi, S., Isacson, O. (2007). Inhibition of the leucine-rich repeat protein LINGO-1 enhances survival, structure, and function of dopaminergic neurons in Parkinson's disease models. Proc. Natl. Acad. Sci. USA 104: 14430-14435 [Abstract] [Full Text]  
• Binkofski, F., Reetz, K., Gaser, C., Hilker, R., Hagenah, J., Hedrich, K., van Eimeren, T., Thiel, A., Buchel, C., Pramstaller, P. P., Siebner, H. R., Klein, C. (2007). Morphometric fingerprint of asymptomatic Parkin and PINK1 mutation carriers in the basal ganglia. Neurology 69: 842-850 [Abstract] [Full Text]  
• Wang, C., Lu, R., Ouyang, X., Ho, M. W. L., Chia, W., Yu, F., Lim, K.-L. (2007). Drosophila Overexpressing Parkin R275W Mutant Exhibits Dopaminergic Neuron Degeneration and Mitochondrial Abnormalities. J. Neurosci. 27: 8563-8570 [Abstract] [Full Text]  
• Joch, M., Ase, A. R., Chen, C. X.-Q., MacDonald, P. A., Kontogiannea, M., Corera, A. T., Brice, A., Seguela, P., Fon, E. A. (2007). Parkin-mediated Monoubiquitination of the PDZ Protein PICK1 Regulates the Activity of Acid-sensing Ion Channels. Mol. Biol. Cell 18: 3105-3118 [Abstract] [Full Text]  
• Wang, Y., Clark, L. N., Marder, K., Rabinowitz, D. (2007). Nonparametric estimation of age-at-onset distributions from censored kin-cohort data. Biometrika 94: 403-403 [Abstract] [Full Text]  
• Deng, H., Le, W., Jankovic, J. (2007). Genetics of essential tremor. Brain 130: 1456-1464 [Abstract] [Full Text]  
• Mandemakers, W., Morais, V. A., De Strooper, B. (2007). A cell biological perspective on mitochondrial dysfunction in Parkinson disease and other neurodegenerative diseases. J. Cell Sci. 120: 1707-1716 [Abstract] [Full Text]  
• Wong, E. S. P., Tan, J. M. M., Wang, C., Zhang, Z., Tay, S.-P., Zaiden, N., Ko, H. S., Dawson, V. L., Dawson, T. M., Lim, K.-L. (2007). Relative Sensitivity of Parkin and Other Cysteine-containing Enzymes to Stress-induced Solubility Alterations. J. Biol. Chem. 282: 12310-12318 [Abstract] [Full Text]  
• Deng, H., Le, W.-D., Hunter, C. B., Mejia, N., Xie, W.-J., Jankovic, J. (2007). A Family With Parkinson Disease, Essential Tremor, Bell Palsy, and Parkin Mutations. Arch Neurol 64: 421-424 [Abstract] [Full Text]  
• Beasley, S. A., Hristova, V. A., Shaw, G. S. (2007). From the Cover: Structure of the Parkin in-between-ring domain provides insights for E3-ligase dysfunction in autosomal recessive Parkinson's disease. Proc. Natl. Acad. Sci. USA 104: 3095-3100 [Abstract] [Full Text]  
• Toft, M, Myhre, R, Pielsticker, L, White, L R, Aasly, J O, Farrer, M J (2007). PINK1 mutation heterozygosity and the risk of Parkinson's disease. J. Neurol. Neurosurg. Psychiatry 78: 82-84 [Abstract] [Full Text]  
• Chinnery, P. F., Crompton, D. E., Birchall, D., Jackson, M. J., Coulthard, A., Lombes, A., Quinn, N., Wills, A., Fletcher, N., Mottershead, J. P., Cooper, P., Kellett, M., Bates, D., Burn, J. (2007). Clinical features and natural history of neuroferritinopathy caused by the FTL1 460InsA mutation. Brain 130: 110-119 [Abstract] [Full Text]  
• Reinstein, E., Ciechanover, A. (2006). Narrative review: protein degradation and human diseases: the ubiquitin connection.. ANN INTERN MED 145: 676-684 [Abstract] [Full Text]  
• Tan, E.-K., Jankovic, J. (2006). Genetic testing in Parkinson disease: promises and pitfalls.. Arch Neurol 63: 1232-1237 [Full Text]  
• Chung, E. J., Ki, C.-S., Lee, W. Y., Kim, I.-S., Kim, J.-Y. (2006). Clinical Features and Gene Analysis in Korean Patients With Early-Onset Parkinson Disease.. Arch Neurol 63: 1170-1174 [Abstract] [Full Text]  
• Hampe, C., Ardila-Osorio, H., Fournier, M., Brice, A., Corti, O. (2006). Biochemical analysis of Parkinson's disease-causing variants of Parkin, an E3 ubiquitin-protein ligase with monoubiquitylation capacity. Hum Mol Genet 15: 2059-2075 [Abstract] [Full Text]  
• Beffert, U., Rosenberg, R. N. (2006). Increased risk for heterozygotes in recessive Parkinson disease.. Arch Neurol 63: 807-808 [Full Text]  
• Sun, M., Latourelle, J. C., Wooten, G. F., Lew, M. F., Klein, C., Shill, H. A., Golbe, L. I., Mark, M. H., Racette, B. A., Perlmutter, J. S., Parsian, A., Guttman, M., Nicholson, G., Xu, G., Wilk, J. B., Saint-Hilaire, M. H., DeStefano, A. L., Prakash, R., Williamson, S., Suchowersky, O., Labelle, N., Growdon, J. H., Singer, C., Watts, R. L., Goldwurm, S., Pezzoli, G., Baker, K. B., Pramstaller, P. P., Burn, D. J., Chinnery, P. F., Sherman, S., Vieregge, P., Litvan, I., Gillis, T., MacDonald, M. E., Myers, R. H., Gusella, J. F. (2006). Influence of heterozygosity for parkin mutation on onset age in familial Parkinson disease: the GenePD study.. Arch Neurol 63: 826-832 [Abstract] [Full Text]  
• Poewe, W. (2006). The need for neuroprotective therapies in Parkinson's disease: A clinical perspective. Neurology 66: S2-S9 [Abstract] [Full Text]  
• Jenner, P., Olanow, C. W. (2006). The pathogenesis of cell death in Parkinson's disease. Neurology 66: S24-S36 [Abstract] [Full Text]  
• von Coelln, R., Thomas, B., Andrabi, S. A., Lim, K. L., Savitt, J. M., Saffary, R., Stirling, W., Bruno, K., Hess, E. J., Lee, M. K., Dawson, V. L., Dawson, T. M. (2006). Inclusion body formation and neurodegeneration are parkin independent in a mouse model of alpha-synucleinopathy.. J. Neurosci. 26: 3685-3696 [Abstract] [Full Text]  
• Clark, L. N., Afridi, S., Karlins, E., Wang, Y., Mejia-Santana, H., Harris, J., Louis, E. D., Cote, L. J., Andrews, H., Fahn, S., Waters, C., Ford, B., Frucht, S., Ottman, R., Marder, K. (2006). Case-control study of the parkin gene in early-onset Parkinson disease.. Arch Neurol 63: 548-552 [Abstract] [Full Text]  
• Klein, C. (2006). Implications of genetics on the diagnosis and care of patients with Parkinson disease.. Arch Neurol 63: 328-334 [Abstract] [Full Text]  
• Ibanez, P., Lesage, S., Lohmann, E., Thobois, S., Michele, G. D., Borg, M., Agid, Y., Durr, A., Brice, A., and the French Parkinson's Disease Genetics Study, (2006). Mutational analysis of the PINK1 gene in early-onset parkinsonism in Europe and North Africa. Brain 129: 686-694 [Abstract] [Full Text]  
• Deng, H., Le, W.-D., Hunter, C. B., Ondo, W. G., Guo, Y., Xie, W.-J., Jankovic, J. (2006). Heterogeneous Phenotype in a Family With Compound Heterozygous Parkin Gene Mutations. Arch Neurol 63: 273-277 [Abstract] [Full Text]  
• Lesage, S., Durr, A., Tazir, M., Lohmann, E., Leutenegger, A.-L., Janin, S., Pollak, P., Brice, A., the French Parkinson's Disease Genetics Study Grou, (2006). LRRK2 G2019S as a Cause of Parkinson's Disease in North African Arabs. NEJM 354: 422-423 [Full Text]  
• Skipper, L., Li, Y., Bonnard, C., Pavanni, R., Yih, Y., Chua, E., Sung, W.-K., Tan, L., Wong, M.-C., Tan, E.-K., Liu, J. (2005). Comprehensive evaluation of common genetic variation within LRRK2 reveals evidence for association with sporadic Parkinson's disease. Hum Mol Genet 14: 3549-3556 [Abstract] [Full Text]  
• Madegowda, R H, Kishore, A, Anand, A (2005). Mutational screening of the parkin gene among South Indians with early onset Parkinson's disease. J. Neurol. Neurosurg. Psychiatry 76: 1588-1590 [Abstract] [Full Text]  
• Sriram, S. R., Li, X., Ko, H. S., Chung, K. K.K., Wong, E., Lim, K. L., Dawson, V. L., Dawson, T. M. (2005). Familial-associated mutations differentially disrupt the solubility, localization, binding and ubiquitination properties of parkin. Hum Mol Genet 14: 2571-2586 [Abstract] [Full Text]  
• Ko, H. S., von Coelln, R., Sriram, S. R., Kim, S. W., Chung, K. K. K., Pletnikova, O., Troncoso, J., Johnson, B., Saffary, R., Goh, E. L., Song, H., Park, B.-J., Kim, M. J., Kim, S., Dawson, V. L., Dawson, T. M. (2005). Accumulation of the Authentic Parkin Substrate Aminoacyl-tRNA Synthetase Cofactor, p38/JTV-1, Leads to Catecholaminergic Cell Death. J. Neurosci. 25: 7968-7978 [Abstract] [Full Text]  
• Hague, S M, Klaffke, S, Bandmann, O (2005). Neurodegenerative disorders: Parkinson's disease and Huntington's disease. J. Neurol. Neurosurg. Psychiatry 76: 1058-1063 [Abstract] [Full Text]  
• Li, Y., Tomiyama, H., Sato, K., Hatano, Y., Yoshino, H., Atsumi, M., Kitaguchi, M., Sasaki, S., Kawaguchi, S., Miyajima, H., Toda, T., Mizuno, Y., Hattori, N. (2005). Clinicogenetic study of PINK1 mutations in autosomal recessive early-onset parkinsonism. Neurology 64: 1955-1957 [Abstract] [Full Text]  
• Greene, J. C., Whitworth, A. J., Andrews, L. A., Parker, T. J., Pallanck, L. J. (2005). Genetic and genomic studies of Drosophila parkin mutants implicate oxidative stress and innate immune responses in pathogenesis. Hum Mol Genet 14: 799-811 [Abstract] [Full Text]  
• (2005). Park2tm1Rpa Mice. Sci Aging Knowl Environ 2005: tg2-tg2 [Full Text]  
• Lewis, S J G, Foltynie, T, Blackwell, A D, Robbins, T W, Owen, A M, Barker, R A (2005). Heterogeneity of Parkinson's disease in the early clinical stages using a data driven approach. J. Neurol. Neurosurg. Psychiatry 76: 343-348 [Abstract] [Full Text]  
• Lim, K. L., Chew, K. C. M., Tan, J. M. M., Wang, C., Chung, K. K. K., Zhang, Y., Tanaka, Y., Smith, W., Engelender, S., Ross, C. A., Dawson, V. L., Dawson, T. M. (2005). Parkin Mediates Nonclassical, Proteasomal-Independent Ubiquitination of Synphilin-1: Implications for Lewy Body Formation. J. Neurosci. 25: 2002-2009 [Abstract] [Full Text]  
• Yamamoto, A., Friedlein, A., Imai, Y., Takahashi, R., Kahle, P. J., Haass, C. (2005). Parkin Phosphorylation and Modulation of Its E3 Ubiquitin Ligase Activity. J. Biol. Chem. 280: 3390-3399 [Abstract] [Full Text]  
• Wu, R.-M., Bounds, R., Lincoln, S., Hulihan, M., Lin, C.-H., Hwu, W.-L., Chen, J., Gwinn-Hardy, K., Farrer, M. (2005). Parkin Mutations and Early-Onset Parkinsonism in a Taiwanese Cohort. Arch Neurol 62: 82-87 [Abstract] [Full Text]  
• Varrone, A., Pellecchia, M. T., Amboni, M., Sansone, V., Salvatore, E., Ghezzi, D., Garavaglia, B., Brice, A., Brunetti, A., Bonavita, V., De Michele, G., Salvatore, M., Pappata, S., Barone, P. (2004). Imaging of dopaminergic dysfunction with [123I]FP-CIT SPECT in early-onset parkin disease. Neurology 63: 2097-2103 [Abstract] [Full Text]  
• Hatano, Y., Sato, K., Elibol, B., Yoshino, H., Yamamura, Y., Bonifati, V., Shinotoh, H., Asahina, M., Kobayashi, S., Ng, A. R., Rosales, R. L., Hassin-Baer, S., Shinar, Y., Lu, C. S., Chang, H. C., Wu-Chou, Y. H., Atac, F. B., Kobayashi, T., Toda, T., Mizuno, Y., Hattori, N. (2004). PARK6-linked autosomal recessive early-onset parkinsonism in Asian populations. Neurology 63: 1482-1485 [Abstract] [Full Text]  
• Cummings, J. L. (2004). Dementia with Lewy Bodies: Molecular Pathogenesis and Implications for Classification. J Geriatr Psychiatry Neurol 17: 112-119 [Abstract]  
• Sasaki, S., Shirata, A., Yamane, K., Iwata, M. (2004). Parkin-positive autosomal recessive juvenile parkinsonism with {alpha}-synuclein-positive inclusions. Neurology 63: 678-682 [Abstract] [Full Text]  
• von Coelln, R., Thomas, B., Savitt, J. M., Lim, K. L., Sasaki, M., Hess, E. J., Dawson, V. L., Dawson, T. M. (2004). Loss of locus coeruleus neurons and reduced startle in parkin null mice. Proc. Natl. Acad. Sci. USA 101: 10744-10749 [Abstract] [Full Text]  
• West, A. B., Kapatos, G., O'Farrell, C., Gonzalez-de-Chavez, F., Chiu, K., Farrer, M. J., Maidment, N. T. (2004). N-myc Regulates Parkin Expression. J. Biol. Chem. 279: 28896-28902 [Abstract] [Full Text]  
• Scherfler, C., Khan, N. L., Pavese, N., Eunson, L., Graham, E., Lees, A. J., Quinn, N. P., Wood, N. W., Brooks, D. J., Piccini, P. P. (2004). Striatal and cortical pre- and postsynaptic dopaminergic dysfunction in sporadic parkin-linked parkinsonism. Brain 127: 1332-1342 [Abstract] [Full Text]  
• Khan, N. L., Katzenschlager, R., Watt, H., Bhatia, K. P., Wood, N. W., Quinn, N., Lees, A. J. (2004). Olfaction differentiates parkin disease from early-onset parkinsonism and Parkinson disease. Neurology 62: 1224-1226 [Abstract] [Full Text]  
• Mata, I. F., Lockhart, P. J., Farrer, M. J. (2004). Parkin genetics: one model for Parkinson's disease. Hum Mol Genet 13: R127-133 [Abstract] [Full Text]  
• Lockhart, P J, Lincoln, S, Hulihan, M, Kachergus, J, Wilkes, K, Bisceglio, G, Mash, D C, Farrer, M J (2004). DJ-1 mutations are a rare cause of recessively inherited early onset parkinsonism mediated by loss of protein function. J. Med. Genet. 41: e22-22 [Full Text]  
• Foltynie, T., Brayne, C. E. G., Robbins, T. W., Barker, R. A. (2004). The cognitive ability of an incident cohort of Parkinson's patients in the UK. The CamPaIGN study. Brain 127: 550-560 [Abstract] [Full Text]  
• Bandmann, O. (2004). DJ-1: The second gene for early onset Parkinson disease. Neurology 62: 357-358 [Full Text]  
• Hedrich, K., Djarmati, A., Schafer, N., Hering, R., Wellenbrock, C., Weiss, P. H., Hilker, R., Vieregge, P., Ozelius, L. J., Heutink, P., Bonifati, V., Schwinger, E., Lang, A. E., Noth, J., Bressman, S. B., Pramstaller, P. P., Riess, O., Klein, C. (2004). DJ-1 (PARK7) mutations are less frequent than Parkin (PARK2) mutations in early-onset Parkinson disease. Neurology 62: 389-394 [Abstract] [Full Text]  
• Winklhofer, K. F., Henn, I. H., Kay-Jackson, P. C., Heller, U., Tatzelt, J. (2003). Inactivation of Parkin by Oxidative Stress and C-terminal Truncations: A PROTECTIVE ROLE OF MOLECULAR CHAPERONES. J. Biol. Chem. 278: 47199-47208 [Abstract] [Full Text]  
• Cookson, M. R., Lockhart, P. J., McLendon, C., O'Farrell, C., Schlossmacher, M., Farrer, M. J. (2003). RING finger 1 mutations in Parkin produce altered localization of the protein. Hum Mol Genet 12: 2957-2965 [Abstract] [Full Text]  
• Ardley, H. C., Scott, G. B., Rose, S. A., Tan, N. G. S., Markham, A. F., Robinson, P. A. (2003). Inhibition of Proteasomal Activity Causes Inclusion Formation in Neuronal and Non-Neuronal Cells Overexpressing Parkin. Mol. Biol. Cell 14: 4541-4556 [Abstract] [Full Text]  
• Goldberg, M. S., Fleming, S. M., Palacino, J. J., Cepeda, C., Lam, H. A., Bhatnagar, A., Meloni, E. G., Wu, N., Ackerson, L. C., Klapstein, G. J., Gajendiran, M., Roth, B. L., Chesselet, M.-F., Maidment, N. T., Levine, M. S., Shen, J. (2003). Parkin-deficient Mice Exhibit Nigrostriatal Deficits but Not Loss of Dopaminergic Neurons. J. Biol. Chem. 278: 43628-43635 [Abstract] [Full Text]  
• Pankratz, N., Nichols, W. C., Uniacke, S. K., Halter, C., Murrell, J., Rudolph, A., Shults, C. W., Conneally, P. M., Foroud, T., the Parkinson Study Group, (2003). Genome-wide linkage analysis and evidence of gene-by-gene interactions in a sample of 362 multiplex Parkinson disease families. Hum Mol Genet 12: 2599-2608 [Abstract] [Full Text]  
• Zhao, J., Ren, Y., Jiang, Q., Feng, J. (2003). Parkin is recruited to the centrosome in response to inhibition of proteasomes. J. Cell Sci. 116: 4011-4019 [Abstract] [Full Text]  
• Schapira, A.H. V. (2003). Neuroprotection in PD--A role for dopamine agonists?. Neurology 61: S34-42 [Full Text]  
• Itier, J.-M., Ibanez, P., Mena, M. A., Abbas, N., Cohen-Salmon, C., Bohme, G. A., Laville, M., Pratt, J., Corti, O., Pradier, L., Ret, G., Joubert, C., Periquet, M., Araujo, F., Negroni, J., Casarejos, M. J., Canals, S., Solano, R., Serrano, A., Gallego, E., Sanchez, M., Denefle, P., Benavides, J., Tremp, G., Rooney, T. A., Brice, A., Garcia de Yebenes, J. (2003). Parkin gene inactivation alters behaviour and dopamine neurotransmission in the mouse. Hum Mol Genet 12: 2277-2291 [Abstract] [Full Text]  
• Lucking, C.-B., Chesneau, V., Lohmann, E., Verpillat, P., Dulac, C., Bonnet, A.-M., Gasparini, F., Agid, Y., Durr, A., Brice, A. (2003). Coding Polymorphisms in the Parkin Gene and Susceptibility to Parkinson Disease. Arch Neurol 60: 1253-1256 [Abstract] [Full Text]  
• Gray, D. A., Tsirigotis, M., Woulfe, J. (2003). Ubiquitin, Proteasomes, and the Aging Brain. Sci Aging Knowl Environ 2003: re6-6 [Abstract] [Full Text]  
• Dekker, M. C. J., Bonifati, V., van Duijn, C. M. (2003). Parkinson's disease: piecing together a genetic jigsaw. Brain 126: 1722-1733 [Abstract] [Full Text]  
• Tanner, C. M. (2003). PD or not PD?: That is the question. Neurology 61: 5-6 [Full Text]  
• Kahns, S., Kalai, M., Jakobsen, L. D., Clark, B. F. C., Vandenabeele, P., Jensen, P. H. (2003). Caspase-1 and Caspase-8 Cleave and Inactivate Cellular Parkin. J. Biol. Chem. 278: 23376-23380 [Abstract] [Full Text]  
• Marx, F. P., Holzmann, C., Strauss, K. M., Li, L., Eberhardt, O., Gerhardt, E., Cookson, M. R., Hernandez, D., Farrer, M. J., Kachergus, J., Engelender, S., Ross, C. A., Berger, K., Schols, L., Schulz, J. B., Riess, O., Kruger, R. (2003). Identification and functional characterization of a novel R621C mutation in the synphilin-1 gene in Parkinson's disease. Hum Mol Genet 12: 1223-1231 [Abstract] [Full Text]  
• Morrison, K. E. (2003). Parkin mutations and early onset parkinsonism. Brain 126: 1250-1251 [Full Text]  
• Periquet, M., Latouche, M., Lohmann, E., Rawal, N., De Michele, G., Ricard, S., Teive, H., Fraix, V., Vidailhet, M., Nicholl, D., Barone, P., Wood, N. W., Raskin, S., Deleuze, J.-F., Agid, Y., Durr, A., Brice, A. (2003). Parkin mutations are frequent in patients with isolated early-onset parkinsonism. Brain 126: 1271-1278 [Abstract] [Full Text]  
• Khan, N. L., Graham, E., Critchley, P., Schrag, A. E., Wood, N. W., Lees, A. J., Bhatia, K. P., Quinn, N. (2003). Parkin disease: a phenotypic study of a large case series. Brain 126: 1279-1292 [Abstract] [Full Text]