Acromegaly Caused by Secretion of Growth Hormone by a Non-Hodgkin's Lymphoma
Felix Beuschlein, M.D., Christian J. Strasburger, M.D., Volker Siegerstetter, M.D., Darius Moradpour, M.D., Peter Lichter, Ph.D., Martin Bidlingmaier, M.D., Hubert E. Blum, M.D., and Martin Reincke, M.D.
Acromegaly is a systemic disorder caused by sustained hypersecretionof growth hormone. The typical features include thickening ofthe skin, enlargement of the hands, feet, and mandible, andvisceromegaly.1,2 Active disease is indicated by the presenceof excessive sweating and soft-tissue swelling.1,2 Most patientswith acromegaly have a growth hormonesecreting pituitaryadenoma,3 but a few (less than 1 percent) have hypothalamicor other tumors that secrete growth hormonereleasinghormone.4 Isolated ectopic secretion of growth hormone has beenreported only once, in a patient with a pancreatic islet-celltumor.5,6 Here we describe a patient with recurrent non-Hodgkin'slymphoma and acromegaly caused by ectopic production of growthhormone by the lymphoma.
Case Report
In October 1994, a 57-year-old woman was referred to anotherhospital for evaluation of malignant lymphoma. She had a six-monthhistory of excessive sweating, bone pain, swelling and stiffnessof the hands, and weight loss of 7 kg, followed by a weightgain of 5 kg. In July 1994, she underwent bilateral decompressionof the median nerve because of carpal tunnel syndrome. Abdominallymphadenopathy was detected by ultrasonography and verifiedby abdominal computed tomography, which suggested the presenceof a malignant lymphoma; a lymph-node biopsy revealed follicularnon-Hodgkin's lymphoma grade 1 (according to the classificationsystem of the World Health Organization7). Although her symptomssuggested that the patient had an excess of growth hormone secretion,the presence of acromegaly was not recognized at that time.
The patient was treated with four cycles of cyclophosphamide,vincristine, doxorubicin, etoposide, and prednisolone. The lymphomaresponded well to treatment, and the symptoms and signs of activeacromegaly resolved. The patient was well until the end of 1997,when excessive sweating and swelling and stiffness of her handsand feet gradually reappeared (Figure 1A). She also noticedenlargement of her nose, lips, and jaw (Figure 1B). She washospitalized at our institution in July 1998 and evaluated forgrowth hormone excess.
Figure 1. Photographs and Computed Tomographic and Magnetic Resonance Images of a Patient with Acromegaly and Lymphoma.
The patient's hands (Panel A) and face (Panel B) show clinical signs of acromegaly. In Panel C, the pituitary gland (arrow) has a normal appearance on magnetic resonance imaging. Multiple enlarged para-aortic lymph nodes (arrows) are evident on computed tomography of the abdomen (Panel D).
The physical examination was normal except for the featuresof acromegaly and axillary and inguinal lymphadenopathy. Serumgrowth hormone concentrations were high (Table 1), with littlediurnal variation, as were serum concentrations of insulin-likegrowth factor I (IGF-I) and insulin-like growth factorbindingprotein 3 (IGFBP-3). Plasma growth hormonereleasing hormone(GHRH) concentrations were below the limit of detection. Growthhormone secretion did not change after the oral administrationof 75 g of glucose, the subcutaneous administration of 100 µgof octreotide (Sandostatin, Novartis Pharma, Nuremberg, Germany),or the intravenous administration of 200 µg of thyrotropin-releasinghormone (Relefact TRH, Hoechst Marion Roussel, Bad Soden, Germany)and 1 µg of GHRH per kilogram of body weight (Ferring,Kiel, Germany).
Table 1. Serum and Cell-Culture Concentrations of Hormones in a Patient with Acromegaly and Lymphoma.
The results of magnetic resonance imaging of the pituitary glandwere normal (Figure 1C), and jugular venous sampling did notreveal a pituitary-to-peripheral gradient in the serum growthhormone concentration. Abdominal computed tomography revealedenlargement of the liver, spleen, and multiple lymph nodes inthe para-aortic region compressing the vena cava (Figure 1D).Inguinal lymph-node biopsy revealed follicular non-Hodgkin'slymphoma with characteristic expression of the B-cell markersCD20 and CD79a. Indium-111 pentetreotide scintigraphy revealedno uptake in the pituitary or in the lymphoma tissue.
After one cycle of cyclophosphamide, vincristine, and prednisone,clinical and biochemical signs of acromegaly persisted, andthe lymphoma was unchanged in size. The patient was thereforetreated with fludarabine, mitoxantrone, and dexamethasone, whichresulted in rapid clinical improvement and a rapid decreasein the serum concentration of growth hormone and IGF-I (Figure 2).The patient has since remained in remission.
Figure 2. Serum Concentrations of Growth Hormone (GH) and Insulin-like Growth Factor I (IGF-I) during Treatment in a Patient with Acromegaly and Lymphoma.
Chemotherapy with cyclophosphamide, vincristine, and prednisone (COP) had no effect on the tumor or on serum growth hormone concentrations; symptoms of acromegaly persisted. Chemotherapy with fludarabine, mitoxantrone, and dexamethasone (FND) induced a rapid and sustained remission of the lymphoma and a decline in serum concentrations of growth hormone and insulin-like growth factor I. The dotted line indicates the upper limit of the normal range of serum growth hormone values. The shaded band shows the age-adjusted normal range of serum insulin-like growth factor I. Intervals between dates are not drawn to scale.
Methods
Assays
Serum growth hormone was measured by a commercial radioimmunoassay(Sorin Biomedica, Düsseldorf, Germany). To determine whetherthe tumor secreted the pituitary or placental growth hormoneisoforms,9 both serum and cell-culture supernatants were analyzedin an immunofunctional assay,10 which recognizes pituitary andplacental growth hormone equally well, and by a sandwich immunoassayspecific for pituitary growth hormone.11 Serum IGF-I (Mediagnost,Tübingen, Germany) and GHRH12 were measured by radioimmunoassay,and IGFBP-3 by enzyme-linked immunosorbent assay (DiagnosticSystems Laboratories, Webster, Tex.).
Tissue and Cell Studies
Portions of the inguinal lymph node were subjected to primarycell culture or immediately frozen and stored at 80°C.Frozen sections of growth hormoneproducing pituitaryadenoma, normal liver, and normal lymph node from patients withoutacromegaly served as controls. The use of tissue samples forresearch was approved by the ethics committee of the Universityof Freiburg, and the patient gave written informed consent forthe studies.
Reverse-Transcriptase Polymerase Chain Reaction
Total RNA was extracted with use of RNeasy Mini Kit (Qiagen,Hilden, Germany). The reverse-transcriptase polymerase chainreaction was performed according to the manufacturer's instructions(PerkinElmer Cetus), with 35 cycles of amplification(each consisting of 1 minute at 95°C, 1 minute at 55°C,and 1 minute at 72°C), followed by a final extension cycleof 10 minutes at 72°C. The primer sequences for pituitarygrowth hormone were 5'GTGCAGTTCCTCAGGAGTGTCT3' and 5'GAGTAGTGCGTCATCGTTGTGT3'.The primers for the growth hormone receptor13 and GHRH14 havebeen reported previously. To characterize the growth hormonereceptor amplification product, we hybridized it with a full-length[32P]--cytosine triphosphatelabeled insert of pcDNA1growth hormonereceptor plasmid, as described elsewhere.15An ovarian-cancer cell line expressing GHRH messenger RNA (mRNA)served as a positive control for the amplification of GHRH.14
Immunofluorescence Microscopy
Ten-micrometer cryostat sections were fixed in cold acetoneand dried overnight. After incubation with methanolhydrogenperoxide (0.6 percent) to inhibit endogenous peroxidase activity,the sections were washed in 0.05 M TRIShydrochloric acidand 0.15 M sodium chloride at a pH of 7.6 and incubated at 4°Covernight with a rabbit polyclonal antibody against growth hormone(Dako Diagnostika, Hamburg, Germany) at a concentration of 30µg per milliliter in phosphate-buffered saline containing3 percent bovine serum albumin. Bound primary antibody was visualizedwith a fluorescein isothiocyanateconjugated sheep F(ab')2fragment directed against rabbit IgG (Boehringer, Mannheim,Germany).
Cell-Culture Experiments
Lymphoma tissue was placed in RPMI 1640 medium containing 10percent fetal-calf serum, 2 percent l-glutamine, gentamicin(50 µg per milliliter), amphotericin B (1 µg permilliliter), and interleukin-4 (10 ng per milliliter); the tissuewas mechanically dispersed until a suspension of single cellswas obtained. The cells were grown in serum-free RPMI 1640 mediumin six-well plates at a density of about 100,000 cells per well.The medium was changed every 12 hours, and the supernatant wasstored at 20°C for measurement of growth hormone,IGF-I, and GHRH. As controls, peripheral-blood lymphocytes obtainedfrom a normal subject after separation on a FicollHypaquegradient and cells from two patients with low-grade non-Hodgkin'slymphomas were grown under identical conditions, and the culturemedium was subjected to hormone analysis.
Results
Expression of mRNA in Lymphoma Tissue
We detected mRNA encoding growth hormone and growth hormonereceptors in the patient's lymphoma tissue (Figure 3, top),whereas GHRH mRNA was undetectable.
Figure 3. Results of Molecular and Imaging Studies.
Panel A shows the results of reverse-transcriptasepolymerase-chain-reaction (RT-PCR) amplification of messenger RNA (mRNA) from growth hormonereleasing hormone (GHRH), growth hormone (GH), growth hormone receptor (GHR), and beta-actin in various tissues: lane 1, growth hormoneproducing lymphoma (from the patient); lane 2, growth hormoneproducing pituitary adenoma; lane 3, inactive pituitary adenoma; lane 4, normal lymph node; lane 5, normal liver tissue; lane 6, human ovarian cancer-cell line; and lane 7, water (control). RT-PCR products were separated by electrophoresis on a 1.2 percent agarose gel and stained with ethidium bromide. To prevent coamplification of genomic DNA, the RNA samples were subjected to digestion with DNase. All primers were designed as intron-spanning pairs. Amplification of the desired gene product was verified by digestion with appropriate restriction enzymes (data not shown). Control reactions included samples without template, samples without reverse transcriptase, and samples without DNase digestion.
Panels B, C, D, and E show the results of immunofluorescence microscopy for the localization of growth hormone immunoreactivity in the growth hormoneproducing lymphoma (Panel B, x400) and in a patient with a growth hormoneproducing pituitary adenoma (Panel D, x400). Negative control sections (Panels C and E) were incubated with a nonrelevant monoclonal antibody supplied by the manufacturer (Dako). In addition, control sections of an inactive pituitary adenoma showed no growth hormone immunoreactivity (data not shown).
Immunofluorescence Microscopy
The patient's lymphoma tissue showed strong immunoreactivityto growth hormone; the immunoreactivity was similar to thatof tissue from a growth hormonesecreting pituitary adenomafrom another patient with acromegaly (Figure 3, bottom). Nearlyall the patient's tumor cells stained for growth hormone. Atthe cellular level, the immunoreactivity in the patient's lymphomawas restricted to the cytoplasmic compartment.
In Vitro Secretion of Growth Hormone
The cultured lymphoma cells from the patient secreted largeamounts of growth hormone into the medium (Table 1). By comparison,no growth hormone was detected in the medium from the culturesof peripheral-blood lymphocytes from the normal subject or thetwo other lymphomas. The patient's lymphoma secreted only pituitarygrowth hormone and no placental growth hormone. GHRH was notdetected in any sample of culture medium.
Discussion
Ectopic secretion of growth hormone has been suggested by thein vitro detection of immunoreactive growth hormone in someendocrine and nonendocrine tumors.16,17,18,19,20,21,22 However,most reported cases have not met the criteria for the diagnosisof ectopic growth hormone secretion5: marked arteriovenous gradientsof serum growth hormone concentrations across the ectopic source,cure of acromegaly after the removal of the tumor, and evidenceof the expression of growth hormone gene by tumor tissue. Weevaluated a patient with acromegaly due to the secretion ofgrowth hormone by a non-Hodgkin's lymphoma. That the patient'slymphoma produced and secreted growth hormone was demonstratedby the decrease in serum growth hormone concentrations duringchemotherapy, the presence of growth hormone mRNA and growthhormone immunoreactivity in tumor cells, and the secretion ofgrowth hormone by tumor cells in vitro. GHRH mRNA or proteinwas not detected. Magnetic resonance imaging of the pituitarydid not reveal somatotroph hyperplasia, a feature of ectopicGHRH secretion, and selective venous sampling did not reveala pituitary-to-peripheral gradient in serum growth hormone concentrations.
Ectopic hormone secretion is a typical feature of neuroendocrinetumors and many others. Although we are not aware of other casesin which there was ectopic growth hormone secretion from thelymphatic system, a growing body of evidence suggests that growthhormone is a paracrine growth factor within the immune system.23The hormone has immunomodulatory properties, is required fordevelopment and function of the immune system,24,25,26 and hasa profound influence on both cellular and humoral immunity.22For example, the secretion of thymulin, a hormone produced bythymic epithelial cells, is up-regulated by growth hormone.27In aging rats, the administration of growth hormone increasedthe total number of thymocytes.28,29 Normal lymphocytes havereceptors for growth hormone,30,31 and both rodent and humanmononuclear cells synthesize and secrete growth hormonelikemolecules.32,33,34,35 Growth hormone mRNA has been detectedin normal lymphoid tissues and in B-cell and T-cell lymphomas.36These findings support the concept of an autocrine or paracrineeffect of growth hormone produced by the lymphoma cells on tumorproliferation. In this context, so-called ectopic growth hormoneproduction by the lymphoma is not genuinely ectopic but, rather,a modification of normal cell function.37
The mechanisms by which growth hormone gene expression was up-regulatedin the patient's lymphoma are not known. Amplification of thegrowth hormone gene locus or chromosomal translocation causinggene rearrangement or mutations in the growth hormone promotercould have contributed to the hypersecretion of growth hormoneby the lymphoma. The majority of malignant lymphomas expresssomatostatin receptors and can be visualized by pentetreotidescintigraphy.38,39 In our patient, the pentetreotide scan wasnegative, despite the extensive lymphoma. In addition, the patient'sserum growth hormone concentrations did not decrease after theadministration of octreotide. The absence of the expressionof somatostatin receptors may have contributed to growth hormoneexcess because of the lack of inhibitory effects of endogenoussomatostatin.
Supported by grants (to Dr. Reincke) from the Zentrum fürKlinische Forschung 1, University of Freiburg, and the DeutscheForschungsgemeinschaft (Re 752/11-1).
We are indebted to Professor F. Hirsch of the Klinikum Offenburgand Dr. H. Jäger, Appenweier, Germany, for providing thefollow-up data; to Dr. R.J. Ross of the Department of Medicine,Sheffield University, United Kingdom, for providing the pcDNA1growth hormonereceptor plasmid; to Mrs. P. Mora and Dr.A. Klink for excellent technical assistance; to Professor A.Lindemann and Dr. A. Mackensen for providing the non-Hodgkin'slymphomas for use as controls and for their assistance withthe cell-culture experiments; and to Professor B. Allolio forhelpful discussions.
Source Information
From the Department of Medicine II, Klinikum der Albert-Ludwigs-Universität Freiburg, Freiburg (F.B., V.S., D.M., H.E.B., M.R.); the Medical Department, Klinikum Innenstadt der Ludwig-Maximilians-Universität, Munich (C.J.S., M.B.); and the German Cancer Research Center, Heidelberg (P.L.) all in Germany.
Address reprint requests to Dr. Reincke at Abteilung Innere Medizin II, Klinikum der Albert-Ludwigs-Universität Freiburg, Hugstetter Strasse 55, D-79106 Freiburg, Germany, or at reincke{at}med1.ukl.uni-freiburg.de.
References
Ezzat S, Forster MJ, Berchtold P, Redelmeier DA, Boerlin V, Harris AG. Acromegaly: clinical and biochemical features in 500 patients. Medicine (Baltimore) 1994;73:233-240. [Medline]
Molitch ME. Clinical manifestations of acromegaly. Endocrinol Metab Clin North Am 1992;21:597-614. [Medline]
Melmed S, Ho K, Klibanski A, Reichlin S, Thorner M. Recent advances in pathogenesis, diagnosis, and management of acromegaly. J Clin Endocrinol Metab 1995;80:3395-3402. [CrossRef][Medline]
Sano T, Asa SL, Kovacs K. Growth hormone-releasing hormone-producing tumors: clinical, biochemical, and morphological manifestations. Endocr Rev 1988;9:357-373. [Free Full Text]
Melmed S, Ezrin C, Kovacs K, Goodman RS, Frohman LA. Acromegaly due to secretion of growth hormone by an ectopic pancreatic islet-cell tumor. N Engl J Med 1995;312:9-17. [Medline]
Ezzat S, Ezrin C, Yamashita S, Melmed S. Recurrent acromegaly resulting from ectopic growth hormone gene expression by a metastatic pancreatic tumor. Cancer 1993;71:66-70. [CrossRef][Medline]
Harris NL, Jaffe ES, Diebold J, et al. World Health Organization classification of neoplastic diseases of the hematopoietic and lymphoid tissues: report of the Clinical Advisory Committee meeting -- Airlie House, Virginia, November 1997. J Clin Oncol 1999;17:3835-3849. [Free Full Text]
Wilson JD, Foster DW, Kronenberg HM, Larsen PR, eds. Williams textbook of endocrinology. 9th ed. Philadelphia: W.B. Saunders, 1998:300.
Baumann G. Growth hormone heterogeneity: genes, isohormones, variants, and binding proteins. Endocr Rev 1991;12:424-449. [Free Full Text]
Strasburger CJ, Wu Z, Pflaum CD, Dressendorfer RA. Immunofunctional assay of human growth hormone (hGH) in serum: a possible consensus for quantitative hGH measurement. J Clin Endocrinol Metab 1996;81:2613-2620. [Abstract]
Wu Z, Kirk SE, Strasburger CJ. Quantitative measurement of human placental growth hormone (GH-V) by the immunofunctional HGH assay and a pituitary (GH-N)-specific sandwich immunoassay. Endocr Soc 1998;80:291. abstract.
Losa M, Wolfram G, Mojto J, et al. Presence of growth hormone-releasing hormone-like immunoreactivity in human tumors: characterization of immunological and biological properties. J Clin Endocrinol Metab 1990;70:62-68. [Free Full Text]
Shen XY, Holt RI, Miell JP, et al. Cirrhotic liver expresses low levels of the full-length and truncated growth hormone receptors. J Clin Endocrinol Metab 1998;83:2532-2538. [Free Full Text]
Kahan Z, Arencibia JM, Csernus VJ, et al. Expression of growth hormone-releasing hormone (GHRH) messenger ribonucleic acid and the presence of biologically active GHRH in human breast, endometrial, and ovarian cancers. J Clin Endocrinol Metab 1999;84:582-589. [Free Full Text]
Ross RJ, Esposito N, Shen XY, et al. A short isoform of the human growth hormone receptor functions as a dominant negative inhibitor of the full-length receptor and generates large amounts of binding protein. Mol Endocrinol 1997;11:265-273. [Free Full Text]
Cameron DP, Burger HG, DeKretzer DM, Catt KJ, Best JB. On the presence of immunoreactive growth hormone in a bronchogenic carcinoma. Australas Ann Med 1969;18:143-146. [Medline]
Sparagana M, Phillips G, Hoffman C, Kucera L. Ectopic growth hormone syndrome associated with lung cancer. Metabolism 1971;20:730-736. [CrossRef][Medline]
Greenberg PB, Martin TJ, Beck C, Burger HG. Synthesis and release of human growth hormone from lung carcinoma in cell culture. Lancet 1972;1:350-352. [Medline]
Kaganowicz A, Farkouh NH, Frantz AG, Blaustein AU. Ectopic human growth hormone in ovaries and breast cancer. J Clin Endocrinol Metab 1979;48:5-8. [Free Full Text]
Dabek FT. Bronchial carcinoid tumour with acromegaly in two patients. J Clin Endocrinol Metab 1974;38:329-333. [Free Full Text]
Leveston SA, McKeel DW Jr, Buckley PJ, et al. Acromegaly and Cushing's syndrome associated with a foregut carcinoid tumor. J Clin Endocrinol Metab 1981;53:682-689. [Free Full Text]
Kayano K, Takeo M, Morisue S, Yamamoto M, Mizuno Y, Meguro F. A case of human growth hormone (h-GH)-producing adenocarcinoma of the lung. Nippon Kyobu Geka Gakkai Zasshi 1995;43:538-542. [Medline]
Clark R. The somatogenic hormones and insulin-like growth factor-1: stimulators of lymphopoiesis and immune function. Endocr Rev 1997;18:157-179. [Free Full Text]
Auernhammer CJ, Strasburger CJ. Effects of growth hormone and insulin-like growth factor I on the immune system. Eur J Endocrinol 1995;133:635-645. [Free Full Text]
LeRoith D, Yanowski J, Kaldjian EP, et al. The effects of growth hormone and insulin-like growth factor I on the immune system of aged female monkeys. Endocrinology 1996;137:1071-1079. [Abstract]
Timsit J, Savino W, Safieh B, et al. Growth hormone and insulin-like growth factor-I stimulate hormonal function and proliferation of thymic epithelial cells. J Clin Endocrinol Metab 1992;75:183-188. [Abstract]
Kelley KW, Brief S, Westly HJ, et al. GH3 pituitary adenoma cells can reverse thymic aging in rats. Proc Natl Acad Sci U S A 1986;83:5663-5667. [Free Full Text]
Li YM, Brunke DL, Dantzer R, Kelley KW. Pituitary epithelial cell implants reverse the accumulation of CD4-CD8- lymphocytes in thymus glands of aged rats. Endocrinology 1992;130:2703-2709. [Free Full Text]
Leung DW, Spencer SA, Cachianes G, et al. Growth hormone receptor and serum binding protein: purification, cloning, and expression. Nature 1987;330:537-543. [CrossRef][Medline]
Kiess W, Butenandt O. Specific growth hormone receptors on human peripheral mononuclear cells: reexpression, identification, and characterization. J Clin Endocrinol Metab 1985;60:740-746. [Free Full Text]
Weigent DA, Riley JE, Galin FS, LeBoeuf RD, Blalock JE. Detection of growth hormone and growth hormone-releasing hormone-related messenger RNA in rat leukocytes by the polymerase chain reaction. Proc Soc Exp Biol Med 1991;198:643-648. [Medline]
Hattori N, Ikekubo K, Ishihara T, Moridera K, Hino M, Kurahachi H. Spontaneous growth hormone (GH) secretion by unstimulated human lymphocytes and effects of GH-releasing hormone and somatostatin. J Clin Endocrinol Metab 1994;79:1678-1680. [Abstract]
Varma S, Sabharwal P, Sheridan JF, Malarkey WB. Growth hormone secretion by human peripheral blood mononuclear cells detected by an enzyme-linked immunoplaque assay. J Clin Endocrinol Metab 1993;76:49-53. [Abstract]
Weigent DA, Baxter JB, Wear WE, Smith LR, Bost KL, Blalock JE. Production of immunoreactive growth hormone by mononuclear leukocytes. FASEB J 1988;2:2812-2818. [Abstract]
Wu H, Devi R, Malarkey WB. Localization of growth hormone messenger ribonucleic acid in the human immune system -- a Clinical Research Center study. J Clin Endocrinol Metab 1996;81:1278-1282. [Abstract]
Odell WD. Endocrine/metabolic syndromes of cancer. Semin Oncol 1997;24:299-317. [Medline]
Krenning EP, Kwekkeboom DJ, Reubi JC, et al. 111In-octreotide scintigraphy in oncology. Metabolism 1992;41:Suppl 2:83-86. [CrossRef][Medline]
Lipp RW, Silly H, Ranner G, et al. Radiolabeled octreotide for the demonstration of somatostatin receptors in malignant lymphoma and lymphadenopathy. J Nucl Med 1995;36:13-18. [Free Full Text]