The New England Journal of Medicine
e-mail icon  FREE NEJM E-TOC    HOME   |   SUBSCRIBE   |   CURRENT ISSUE   |   PAST ISSUES   |   COLLECTIONS   |    Advanced Search
Sign in | Get NEJM's E-Mail Table of Contents — Free | Subscribe
 
Original Article
Brief Report
PreviousPrevious
Volume 342:1871-1876 June 22, 2000 Number 25
NextNext

Acromegaly Caused by Secretion of Growth Hormone by a Non-Hodgkin's Lymphoma
Felix Beuschlein, M.D., Christian J. Strasburger, M.D., Volker Siegerstetter, M.D., Darius Moradpour, M.D., Peter Lichter, Ph.D., Martin Bidlingmaier, M.D., Hubert E. Blum, M.D., and Martin Reincke, M.D.

 

This Article
- PDF

Tools and Services
-Add to Personal Archive
-Add to Citation Manager
-Notify a Friend
-E-mail When Cited

More Information
-PubMed Citation
Acromegaly is a systemic disorder caused by sustained hypersecretion of growth hormone. The typical features include thickening of the skin, enlargement of the hands, feet, and mandible, and visceromegaly.1,2 Active disease is indicated by the presence of excessive sweating and soft-tissue swelling.1,2 Most patients with acromegaly have a growth hormone–secreting pituitary adenoma,3 but a few (less than 1 percent) have hypothalamic or other tumors that secrete growth hormone–releasing hormone.4 Isolated ectopic secretion of growth hormone has been reported only once, in a patient with a pancreatic islet-cell tumor.5,6 Here we describe a patient with recurrent non-Hodgkin's lymphoma and acromegaly caused by ectopic production of growth hormone by the lymphoma.

Case Report

In October 1994, a 57-year-old woman was referred to another hospital for evaluation of malignant lymphoma. She had a six-month history of excessive sweating, bone pain, swelling and stiffness of the hands, and weight loss of 7 kg, followed by a weight gain of 5 kg. In July 1994, she underwent bilateral decompression of the median nerve because of carpal tunnel syndrome. Abdominal lymphadenopathy was detected by ultrasonography and verified by abdominal computed tomography, which suggested the presence of a malignant lymphoma; a lymph-node biopsy revealed follicular non-Hodgkin's lymphoma grade 1 (according to the classification system of the World Health Organization7). Although her symptoms suggested that the patient had an excess of growth hormone secretion, the presence of acromegaly was not recognized at that time.

The patient was treated with four cycles of cyclophosphamide, vincristine, doxorubicin, etoposide, and prednisolone. The lymphoma responded well to treatment, and the symptoms and signs of active acromegaly resolved. The patient was well until the end of 1997, when excessive sweating and swelling and stiffness of her hands and feet gradually reappeared (Figure 1A). She also noticed enlargement of her nose, lips, and jaw (Figure 1B). She was hospitalized at our institution in July 1998 and evaluated for growth hormone excess.


View larger version (86K):
[in this window]
[in a new window]
 
Figure 1. Photographs and Computed Tomographic and Magnetic Resonance Images of a Patient with Acromegaly and Lymphoma.

The patient's hands (Panel A) and face (Panel B) show clinical signs of acromegaly. In Panel C, the pituitary gland (arrow) has a normal appearance on magnetic resonance imaging. Multiple enlarged para-aortic lymph nodes (arrows) are evident on computed tomography of the abdomen (Panel D).

 
The physical examination was normal except for the features of acromegaly and axillary and inguinal lymphadenopathy. Serum growth hormone concentrations were high (Table 1), with little diurnal variation, as were serum concentrations of insulin-like growth factor I (IGF-I) and insulin-like growth factor–binding protein 3 (IGFBP-3). Plasma growth hormone–releasing hormone (GHRH) concentrations were below the limit of detection. Growth hormone secretion did not change after the oral administration of 75 g of glucose, the subcutaneous administration of 100 µg of octreotide (Sandostatin, Novartis Pharma, Nuremberg, Germany), or the intravenous administration of 200 µg of thyrotropin-releasing hormone (Relefact TRH, Hoechst Marion Roussel, Bad Soden, Germany) and 1 µg of GHRH per kilogram of body weight (Ferring, Kiel, Germany).

View this table:
[in this window]
[in a new window]
 
Table 1. Serum and Cell-Culture Concentrations of Hormones in a Patient with Acromegaly and Lymphoma.

 
The results of magnetic resonance imaging of the pituitary gland were normal (Figure 1C), and jugular venous sampling did not reveal a pituitary-to-peripheral gradient in the serum growth hormone concentration. Abdominal computed tomography revealed enlargement of the liver, spleen, and multiple lymph nodes in the para-aortic region compressing the vena cava (Figure 1D). Inguinal lymph-node biopsy revealed follicular non-Hodgkin's lymphoma with characteristic expression of the B-cell markers CD20 and CD79a. Indium-111 pentetreotide scintigraphy revealed no uptake in the pituitary or in the lymphoma tissue.

After one cycle of cyclophosphamide, vincristine, and prednisone, clinical and biochemical signs of acromegaly persisted, and the lymphoma was unchanged in size. The patient was therefore treated with fludarabine, mitoxantrone, and dexamethasone, which resulted in rapid clinical improvement and a rapid decrease in the serum concentration of growth hormone and IGF-I (Figure 2). The patient has since remained in remission.


View larger version (10K):
[in this window]
[in a new window]
 
Figure 2. Serum Concentrations of Growth Hormone (GH) and Insulin-like Growth Factor I (IGF-I) during Treatment in a Patient with Acromegaly and Lymphoma.

Chemotherapy with cyclophosphamide, vincristine, and prednisone (COP) had no effect on the tumor or on serum growth hormone concentrations; symptoms of acromegaly persisted. Chemotherapy with fludarabine, mitoxantrone, and dexamethasone (FND) induced a rapid and sustained remission of the lymphoma and a decline in serum concentrations of growth hormone and insulin-like growth factor I. The dotted line indicates the upper limit of the normal range of serum growth hormone values. The shaded band shows the age-adjusted normal range of serum insulin-like growth factor I. Intervals between dates are not drawn to scale.

 
Methods

Assays

Serum growth hormone was measured by a commercial radioimmunoassay (Sorin Biomedica, Düsseldorf, Germany). To determine whether the tumor secreted the pituitary or placental growth hormone isoforms,9 both serum and cell-culture supernatants were analyzed in an immunofunctional assay,10 which recognizes pituitary and placental growth hormone equally well, and by a sandwich immunoassay specific for pituitary growth hormone.11 Serum IGF-I (Mediagnost, Tübingen, Germany) and GHRH12 were measured by radioimmunoassay, and IGFBP-3 by enzyme-linked immunosorbent assay (Diagnostic Systems Laboratories, Webster, Tex.).

Tissue and Cell Studies

Portions of the inguinal lymph node were subjected to primary cell culture or immediately frozen and stored at –80°C. Frozen sections of growth hormone–producing pituitary adenoma, normal liver, and normal lymph node from patients without acromegaly served as controls. The use of tissue samples for research was approved by the ethics committee of the University of Freiburg, and the patient gave written informed consent for the studies.

Reverse-Transcriptase Polymerase Chain Reaction

Total RNA was extracted with use of RNeasy Mini Kit (Qiagen, Hilden, Germany). The reverse-transcriptase polymerase chain reaction was performed according to the manufacturer's instructions (Perkin–Elmer Cetus), with 35 cycles of amplification (each consisting of 1 minute at 95°C, 1 minute at 55°C, and 1 minute at 72°C), followed by a final extension cycle of 10 minutes at 72°C. The primer sequences for pituitary growth hormone were 5'GTGCAGTTCCTCAGGAGTGTCT3' and 5'GAGTAGTGCGTCATCGTTGTGT3'. The primers for the growth hormone receptor13 and GHRH14 have been reported previously. To characterize the growth hormone receptor amplification product, we hybridized it with a full-length [32P]-{alpha}-cytosine triphosphate–labeled insert of pcDNA1 growth hormone–receptor plasmid, as described elsewhere.15 An ovarian-cancer cell line expressing GHRH messenger RNA (mRNA) served as a positive control for the amplification of GHRH.14

Immunofluorescence Microscopy

Ten-micrometer cryostat sections were fixed in cold acetone and dried overnight. After incubation with methanol–hydrogen peroxide (0.6 percent) to inhibit endogenous peroxidase activity, the sections were washed in 0.05 M TRIS–hydrochloric acid and 0.15 M sodium chloride at a pH of 7.6 and incubated at 4°C overnight with a rabbit polyclonal antibody against growth hormone (Dako Diagnostika, Hamburg, Germany) at a concentration of 30 µg per milliliter in phosphate-buffered saline containing 3 percent bovine serum albumin. Bound primary antibody was visualized with a fluorescein isothiocyanate–conjugated sheep F(ab')2 fragment directed against rabbit IgG (Boehringer, Mannheim, Germany).

Cell-Culture Experiments

Lymphoma tissue was placed in RPMI 1640 medium containing 10 percent fetal-calf serum, 2 percent l-glutamine, gentamicin (50 µg per milliliter), amphotericin B (1 µg per milliliter), and interleukin-4 (10 ng per milliliter); the tissue was mechanically dispersed until a suspension of single cells was obtained. The cells were grown in serum-free RPMI 1640 medium in six-well plates at a density of about 100,000 cells per well. The medium was changed every 12 hours, and the supernatant was stored at –20°C for measurement of growth hormone, IGF-I, and GHRH. As controls, peripheral-blood lymphocytes obtained from a normal subject after separation on a Ficoll–Hypaque gradient and cells from two patients with low-grade non-Hodgkin's lymphomas were grown under identical conditions, and the culture medium was subjected to hormone analysis.

Results

Expression of mRNA in Lymphoma Tissue

We detected mRNA encoding growth hormone and growth hormone receptors in the patient's lymphoma tissue (Figure 3, top), whereas GHRH mRNA was undetectable.


View larger version (56K):
[in this window]
[in a new window]
 
Figure 3. Results of Molecular and Imaging Studies.

Panel A shows the results of reverse-transcriptase–polymerase-chain-reaction (RT-PCR) amplification of messenger RNA (mRNA) from growth hormone–releasing hormone (GHRH), growth hormone (GH), growth hormone receptor (GHR), and beta-actin in various tissues: lane 1, growth hormone–producing lymphoma (from the patient); lane 2, growth hormone–producing pituitary adenoma; lane 3, inactive pituitary adenoma; lane 4, normal lymph node; lane 5, normal liver tissue; lane 6, human ovarian cancer-cell line; and lane 7, water (control). RT-PCR products were separated by electrophoresis on a 1.2 percent agarose gel and stained with ethidium bromide. To prevent coamplification of genomic DNA, the RNA samples were subjected to digestion with DNase. All primers were designed as intron-spanning pairs. Amplification of the desired gene product was verified by digestion with appropriate restriction enzymes (data not shown). Control reactions included samples without template, samples without reverse transcriptase, and samples without DNase digestion.

Panels B, C, D, and E show the results of immunofluorescence microscopy for the localization of growth hormone immunoreactivity in the growth hormone–producing lymphoma (Panel B, x400) and in a patient with a growth hormone–producing pituitary adenoma (Panel D, x400). Negative control sections (Panels C and E) were incubated with a nonrelevant monoclonal antibody supplied by the manufacturer (Dako). In addition, control sections of an inactive pituitary adenoma showed no growth hormone immunoreactivity (data not shown).

 
Immunofluorescence Microscopy

The patient's lymphoma tissue showed strong immunoreactivity to growth hormone; the immunoreactivity was similar to that of tissue from a growth hormone–secreting pituitary adenoma from another patient with acromegaly (Figure 3, bottom). Nearly all the patient's tumor cells stained for growth hormone. At the cellular level, the immunoreactivity in the patient's lymphoma was restricted to the cytoplasmic compartment.

In Vitro Secretion of Growth Hormone

The cultured lymphoma cells from the patient secreted large amounts of growth hormone into the medium (Table 1). By comparison, no growth hormone was detected in the medium from the cultures of peripheral-blood lymphocytes from the normal subject or the two other lymphomas. The patient's lymphoma secreted only pituitary growth hormone and no placental growth hormone. GHRH was not detected in any sample of culture medium.

Discussion

Ectopic secretion of growth hormone has been suggested by the in vitro detection of immunoreactive growth hormone in some endocrine and nonendocrine tumors.16,17,18,19,20,21,22 However, most reported cases have not met the criteria for the diagnosis of ectopic growth hormone secretion5: marked arteriovenous gradients of serum growth hormone concentrations across the ectopic source, cure of acromegaly after the removal of the tumor, and evidence of the expression of growth hormone gene by tumor tissue. We evaluated a patient with acromegaly due to the secretion of growth hormone by a non-Hodgkin's lymphoma. That the patient's lymphoma produced and secreted growth hormone was demonstrated by the decrease in serum growth hormone concentrations during chemotherapy, the presence of growth hormone mRNA and growth hormone immunoreactivity in tumor cells, and the secretion of growth hormone by tumor cells in vitro. GHRH mRNA or protein was not detected. Magnetic resonance imaging of the pituitary did not reveal somatotroph hyperplasia, a feature of ectopic GHRH secretion, and selective venous sampling did not reveal a pituitary-to-peripheral gradient in serum growth hormone concentrations.

Ectopic hormone secretion is a typical feature of neuroendocrine tumors and many others. Although we are not aware of other cases in which there was ectopic growth hormone secretion from the lymphatic system, a growing body of evidence suggests that growth hormone is a paracrine growth factor within the immune system.23 The hormone has immunomodulatory properties, is required for development and function of the immune system,24,25,26 and has a profound influence on both cellular and humoral immunity.22 For example, the secretion of thymulin, a hormone produced by thymic epithelial cells, is up-regulated by growth hormone.27 In aging rats, the administration of growth hormone increased the total number of thymocytes.28,29 Normal lymphocytes have receptors for growth hormone,30,31 and both rodent and human mononuclear cells synthesize and secrete growth hormone–like molecules.32,33,34,35 Growth hormone mRNA has been detected in normal lymphoid tissues and in B-cell and T-cell lymphomas.36 These findings support the concept of an autocrine or paracrine effect of growth hormone produced by the lymphoma cells on tumor proliferation. In this context, so-called ectopic growth hormone production by the lymphoma is not genuinely ectopic but, rather, a modification of normal cell function.37

The mechanisms by which growth hormone gene expression was up-regulated in the patient's lymphoma are not known. Amplification of the growth hormone gene locus or chromosomal translocation causing gene rearrangement or mutations in the growth hormone promoter could have contributed to the hypersecretion of growth hormone by the lymphoma. The majority of malignant lymphomas express somatostatin receptors and can be visualized by pentetreotide scintigraphy.38,39 In our patient, the pentetreotide scan was negative, despite the extensive lymphoma. In addition, the patient's serum growth hormone concentrations did not decrease after the administration of octreotide. The absence of the expression of somatostatin receptors may have contributed to growth hormone excess because of the lack of inhibitory effects of endogenous somatostatin.

Supported by grants (to Dr. Reincke) from the Zentrum für Klinische Forschung 1, University of Freiburg, and the Deutsche Forschungsgemeinschaft (Re 752/11-1).

We are indebted to Professor F. Hirsch of the Klinikum Offenburg and Dr. H. Jäger, Appenweier, Germany, for providing the follow-up data; to Dr. R.J. Ross of the Department of Medicine, Sheffield University, United Kingdom, for providing the pcDNA1 growth hormone–receptor plasmid; to Mrs. P. Mora and Dr. A. Klink for excellent technical assistance; to Professor A. Lindemann and Dr. A. Mackensen for providing the non-Hodgkin's lymphomas for use as controls and for their assistance with the cell-culture experiments; and to Professor B. Allolio for helpful discussions.


Source Information

From the Department of Medicine II, Klinikum der Albert-Ludwigs-Universität Freiburg, Freiburg (F.B., V.S., D.M., H.E.B., M.R.); the Medical Department, Klinikum Innenstadt der Ludwig-Maximilians-Universität, Munich (C.J.S., M.B.); and the German Cancer Research Center, Heidelberg (P.L.) — all in Germany.

Address reprint requests to Dr. Reincke at Abteilung Innere Medizin II, Klinikum der Albert-Ludwigs-Universität Freiburg, Hugstetter Strasse 55, D-79106 Freiburg, Germany, or at reincke{at}med1.ukl.uni-freiburg.de.

References

  1. Ezzat S, Forster MJ, Berchtold P, Redelmeier DA, Boerlin V, Harris AG. Acromegaly: clinical and biochemical features in 500 patients. Medicine (Baltimore) 1994;73:233-240. [Medline]
  2. Molitch ME. Clinical manifestations of acromegaly. Endocrinol Metab Clin North Am 1992;21:597-614. [Medline]
  3. Melmed S, Ho K, Klibanski A, Reichlin S, Thorner M. Recent advances in pathogenesis, diagnosis, and management of acromegaly. J Clin Endocrinol Metab 1995;80:3395-3402. [CrossRef][Medline]
  4. Sano T, Asa SL, Kovacs K. Growth hormone-releasing hormone-producing tumors: clinical, biochemical, and morphological manifestations. Endocr Rev 1988;9:357-373. [Free Full Text]
  5. Melmed S, Ezrin C, Kovacs K, Goodman RS, Frohman LA. Acromegaly due to secretion of growth hormone by an ectopic pancreatic islet-cell tumor. N Engl J Med 1995;312:9-17. [Medline]
  6. Ezzat S, Ezrin C, Yamashita S, Melmed S. Recurrent acromegaly resulting from ectopic growth hormone gene expression by a metastatic pancreatic tumor. Cancer 1993;71:66-70. [CrossRef][Medline]
  7. Harris NL, Jaffe ES, Diebold J, et al. World Health Organization classification of neoplastic diseases of the hematopoietic and lymphoid tissues: report of the Clinical Advisory Committee meeting -- Airlie House, Virginia, November 1997. J Clin Oncol 1999;17:3835-3849. [Free Full Text]
  8. Wilson JD, Foster DW, Kronenberg HM, Larsen PR, eds. Williams textbook of endocrinology. 9th ed. Philadelphia: W.B. Saunders, 1998:300.
  9. Baumann G. Growth hormone heterogeneity: genes, isohormones, variants, and binding proteins. Endocr Rev 1991;12:424-449. [Free Full Text]
  10. Strasburger CJ, Wu Z, Pflaum CD, Dressendorfer RA. Immunofunctional assay of human growth hormone (hGH) in serum: a possible consensus for quantitative hGH measurement. J Clin Endocrinol Metab 1996;81:2613-2620. [Abstract]
  11. Wu Z, Kirk SE, Strasburger CJ. Quantitative measurement of human placental growth hormone (GH-V) by the immunofunctional HGH assay and a pituitary (GH-N)-specific sandwich immunoassay. Endocr Soc 1998;80:291. abstract.
  12. Losa M, Wolfram G, Mojto J, et al. Presence of growth hormone-releasing hormone-like immunoreactivity in human tumors: characterization of immunological and biological properties. J Clin Endocrinol Metab 1990;70:62-68. [Free Full Text]
  13. Shen XY, Holt RI, Miell JP, et al. Cirrhotic liver expresses low levels of the full-length and truncated growth hormone receptors. J Clin Endocrinol Metab 1998;83:2532-2538. [Free Full Text]
  14. Kahan Z, Arencibia JM, Csernus VJ, et al. Expression of growth hormone-releasing hormone (GHRH) messenger ribonucleic acid and the presence of biologically active GHRH in human breast, endometrial, and ovarian cancers. J Clin Endocrinol Metab 1999;84:582-589. [Free Full Text]
  15. Ross RJ, Esposito N, Shen XY, et al. A short isoform of the human growth hormone receptor functions as a dominant negative inhibitor of the full-length receptor and generates large amounts of binding protein. Mol Endocrinol 1997;11:265-273. [Free Full Text]
  16. Cameron DP, Burger HG, DeKretzer DM, Catt KJ, Best JB. On the presence of immunoreactive growth hormone in a bronchogenic carcinoma. Australas Ann Med 1969;18:143-146. [Medline]
  17. Sparagana M, Phillips G, Hoffman C, Kucera L. Ectopic growth hormone syndrome associated with lung cancer. Metabolism 1971;20:730-736. [CrossRef][Medline]
  18. Greenberg PB, Martin TJ, Beck C, Burger HG. Synthesis and release of human growth hormone from lung carcinoma in cell culture. Lancet 1972;1:350-352. [Medline]
  19. Kaganowicz A, Farkouh NH, Frantz AG, Blaustein AU. Ectopic human growth hormone in ovaries and breast cancer. J Clin Endocrinol Metab 1979;48:5-8. [Free Full Text]
  20. Dabek FT. Bronchial carcinoid tumour with acromegaly in two patients. J Clin Endocrinol Metab 1974;38:329-333. [Free Full Text]
  21. Leveston SA, McKeel DW Jr, Buckley PJ, et al. Acromegaly and Cushing's syndrome associated with a foregut carcinoid tumor. J Clin Endocrinol Metab 1981;53:682-689. [Free Full Text]
  22. Kayano K, Takeo M, Morisue S, Yamamoto M, Mizuno Y, Meguro F. A case of human growth hormone (h-GH)-producing adenocarcinoma of the lung. Nippon Kyobu Geka Gakkai Zasshi 1995;43:538-542. [Medline]
  23. Clark R. The somatogenic hormones and insulin-like growth factor-1: stimulators of lymphopoiesis and immune function. Endocr Rev 1997;18:157-179. [Free Full Text]
  24. Auernhammer CJ, Strasburger CJ. Effects of growth hormone and insulin-like growth factor I on the immune system. Eur J Endocrinol 1995;133:635-645. [Free Full Text]
  25. LeRoith D, Yanowski J, Kaldjian EP, et al. The effects of growth hormone and insulin-like growth factor I on the immune system of aged female monkeys. Endocrinology 1996;137:1071-1079. [Abstract]
  26. Harvey S, Hull KL. Growth hormone: a paracrine growth factor? Endocrine 1997;7:267-279. [Medline]
  27. Timsit J, Savino W, Safieh B, et al. Growth hormone and insulin-like growth factor-I stimulate hormonal function and proliferation of thymic epithelial cells. J Clin Endocrinol Metab 1992;75:183-188. [Abstract]
  28. Kelley KW, Brief S, Westly HJ, et al. GH3 pituitary adenoma cells can reverse thymic aging in rats. Proc Natl Acad Sci U S A 1986;83:5663-5667. [Free Full Text]
  29. Li YM, Brunke DL, Dantzer R, Kelley KW. Pituitary epithelial cell implants reverse the accumulation of CD4-CD8- lymphocytes in thymus glands of aged rats. Endocrinology 1992;130:2703-2709. [Free Full Text]
  30. Leung DW, Spencer SA, Cachianes G, et al. Growth hormone receptor and serum binding protein: purification, cloning, and expression. Nature 1987;330:537-543. [CrossRef][Medline]
  31. Kiess W, Butenandt O. Specific growth hormone receptors on human peripheral mononuclear cells: reexpression, identification, and characterization. J Clin Endocrinol Metab 1985;60:740-746. [Free Full Text]
  32. Weigent DA, Riley JE, Galin FS, LeBoeuf RD, Blalock JE. Detection of growth hormone and growth hormone-releasing hormone-related messenger RNA in rat leukocytes by the polymerase chain reaction. Proc Soc Exp Biol Med 1991;198:643-648. [CrossRef][Medline]
  33. Hattori N, Ikekubo K, Ishihara T, Moridera K, Hino M, Kurahachi H. Spontaneous growth hormone (GH) secretion by unstimulated human lymphocytes and effects of GH-releasing hormone and somatostatin. J Clin Endocrinol Metab 1994;79:1678-1680. [Abstract]
  34. Varma S, Sabharwal P, Sheridan JF, Malarkey WB. Growth hormone secretion by human peripheral blood mononuclear cells detected by an enzyme-linked immunoplaque assay. J Clin Endocrinol Metab 1993;76:49-53. [Abstract]
  35. Weigent DA, Baxter JB, Wear WE, Smith LR, Bost KL, Blalock JE. Production of immunoreactive growth hormone by mononuclear leukocytes. FASEB J 1988;2:2812-2818. [Abstract]
  36. Wu H, Devi R, Malarkey WB. Localization of growth hormone messenger ribonucleic acid in the human immune system -- a Clinical Research Center study. J Clin Endocrinol Metab 1996;81:1278-1282. [Abstract]
  37. Odell WD. Endocrine/metabolic syndromes of cancer. Semin Oncol 1997;24:299-317. [Medline]
  38. Krenning EP, Kwekkeboom DJ, Reubi JC, et al. 111In-octreotide scintigraphy in oncology. Metabolism 1992;41:Suppl 2:83-86. [CrossRef][Medline]
  39. Lipp RW, Silly H, Ranner G, et al. Radiolabeled octreotide for the demonstration of somatostatin receptors in malignant lymphoma and lymphadenopathy. J Nucl Med 1995;36:13-18. [Free Full Text]

 

This Article
- PDF

Tools and Services
-Add to Personal Archive
-Add to Citation Manager
-Notify a Friend
-E-mail When Cited

More Information
-PubMed Citation

This article has been cited by other articles:



HOME  |  SUBSCRIBE  |  SEARCH  |  CURRENT ISSUE  |  PAST ISSUES  |  COLLECTIONS  |  PRIVACY  |  TERMS OF USE  |  HELP  |  beta.nejm.org

Comments and questions? Please contact us.

The New England Journal of Medicine is owned, published, and copyrighted © 2010 Massachusetts Medical Society. All rights reserved.