Orthostatic Intolerance and Tachycardia Associated with Norepinephrine-Transporter Deficiency
John R. Shannon, M.D., Nancy L. Flattem, B.S., Jens Jordan, M.D., Giris Jacob, M.D., D.Sc., Bonnie K. Black, B.S.N., Italo Biaggioni, M.D., Randy D. Blakely, Ph.D., and David Robertson, M.D.
Background Orthostatic intolerance is a syndrome characterizedby lightheadedness, fatigue, altered mentation, and syncopeand associated with postural tachycardia and plasma norepinephrineconcentrations that are disproportionately high in relationto sympathetic outflow. We tested the hypothesis that impairedfunctioning of the norepinephrine transporter contributes tothe pathophysiologic mechanism of orthostatic intolerance.
Methods In a patient with orthostatic intolerance and her relatives,we measured postural blood pressure, heart rate, plasma catecholamines,and systemic norepinephrine spillover and clearance, and wesequenced the norepinephrine-transporter gene and evaluatedits function.
Results The patient had a high mean plasma norepinephrine concentrationwhile standing, as compared with the mean (±SD) concentrationin normal subjects (923 vs. 439±129 pg per milliliter[5.46 vs. 2.59±0.76 nmol per liter]), reduced systemicnorepinephrine clearance (1.56 vs. 2.42±0.71 liters perminute), impairment in the increase in the plasma norepinephrineconcentration after the administration of tyramine (12 vs. 56±63pg per milliliter [0.07 vs. 0.33± 0.37 pmol per liter]),and a disproportionate increase in the concentration of plasmanorepinephrine relative to that of dihydroxyphenylglycol. Analysisof the norepinephrine-transporter gene revealed that the probandwas heterozygous for a mutation in exon 9 (encoding a changefrom guanine to cytosine at position 237) that resulted in morethan a 98 percent loss of function as compared with that ofthe wild-type gene. Impairment of synaptic norepinephrine clearancemay result in a syndrome characterized by excessive sympatheticactivation in response to physiologic stimuli. The mutant allelein the proband's family segregated with the postural heart rateand abnormal plasma catecholamine homeostasis.
Conclusions Genetic or acquired deficits in norepinephrine inactivationmay underlie hyperadrenergic states that lead to orthostaticintolerance.
Orthostatic intolerance is a syndrome characterized by adrenergicsymptoms that occur when an upright posture is assumed: theheart rate increases by at least 30 beats per minute, withoutorthostatic hypotension.1 Most patients with orthostatic intoleranceare women between the ages of 20 and 50 years old.2 This syndrome,first described by Da Costa3 more than 100 years ago, has beencalled soldier's heart,4 neurocirculatory asthenia,5 and themitral valve prolapse syndrome.6 It is similar to the chronicfatigue syndrome in many respects.7
Most attempts to explain the physiologic and biochemical abnormalitiesassociated with orthostatic intolerance have focused on an increasedrelease of norepinephrine in response to the change from a supineto an upright position. An alternative explanation is that thereis an abnormality in the clearance of norepinephrine from thesynaptic cleft. The primary mechanism of inactivation of norepinephrinein the synapse is uptake into the neuron by the norepinephrinetransporter. Approximately 80 to 90 percent of the norepinephrinereleased into many synapses is cleared by this mechanism, andthe remaining 10 to 20 percent spills over into the circulationor extraneuronal tissue.8 It is noteworthy that drugs that inhibitthe norepinephrine transporter (e.g., cocaine, amphetamines,and tricyclic antidepressants) cause features typical of orthostaticintolerance (tachycardia, orthostatic symptoms, and high plasmacatecholamine concentrations).
We evaluated a patient and her identical twin, both of whomhad symptoms typical of orthostatic intolerance, and in bothfound clinical and laboratory signs of disordered uptake ofnorepinephrine. Because the norepinephrine transporter has apivotal role in norepinephrine uptake at the synaptic cleft,we determined whether the impaired uptake of norepinephrinein these patients could have been caused by a mutation in thegene that encodes the norepinephrine transporter.
Methods
The proband was a 33-year-old woman with a 20-year history ofexertional and orthostatic tachycardia, dyspnea, difficultyconcentrating, and syncope. Her blood pressure had varied substantiallyafter each of three cesarean sections, with values as high as210/180 mm Hg. Treatment with beta-adrenergicantagonistdrugs, compression stockings, and fludrocortisone was ineffective.Implantation of a dual-chamber pacemaker decreased the frequencyof the syncope, but the symptoms of orthostatic intolerancepersisted. An echocardiogram revealed slight mitral regurgitationand possible mitral-valve prolapse. The proband's identicaltwin also had a history of mitral-valve prolapse as well astachycardia and syncope that were worsened by exertion and anupright posture.
The study was approved by the Vanderbilt University investigationalreview board, and all subjects, including family members, gavewritten informed consent.
Clinical Studies
The proband and her twin were admitted to the General ClinicalResearch Center at Vanderbilt University Medical Center. Useof all medications had been discontinued two weeks before admission.For three days, the women were given a caffeine-free, low-monoaminediet containing 150 mmol of sodium per day and 70 mmol of potassiumper day. Urine was then collected for 24 hours for measurementof catecholamines and catecholamine metabolites. After an overnightfast, the women's blood pressure, heart rate, and plasma catecholamineswere measured while they were supine and after 30 minutes ofstanding. Plasma and urine catecholamines were measured by high-performanceliquid chromatography.9,10 Testing of autonomic reflexes wasperformed as previously described.11 In the proband, brachialblood pressure and plasma norepinephrine were measured beforeand at the time of maximal blood pressure after the injectionof a 3-mg bolus of tyramine. Systemic spillover and clearanceof norepinephrine before and during baroreflex-mediated sympatheticactivation, induced by the administration of sodium nitroprusside(Ohmeda, Liberty Corner, N.J.), were measured in the probandduring continuous monitoring of intraarterial blood pressureand heart rate, as follows. Tritiated norepinephrine was infusedintravenously at a rate of 1 µCi per minute after theadministration of a loading dose of 25 µCi per minute,as previously described,12,13 and plasma norepinephrine andthe specific activity of tritiated norepinephrine were measured.13Nitroprusside was then infused into a contralateral antecubitalvein. When the systolic blood pressure had decreased by 20 mmHg (at a rate of 1.2 µg of nitroprusside per kilogramof body weight per minute), the measurements were repeated.
Blood pressure, heart rate, and plasma catecholamine concentrationsin the proband and her twin sister were compared with thosein 10 unrelated normal subjects recruited from a pool of normalvolunteers; the sisters' plasma catecholamine responses aftertyramine administration were compared with those in 9 unrelatednormal subjects; and their norepinephrine spillover and clearancewere compared with those in 8 unrelated normal subjects.
Blood samples were obtained from the proband, her nine siblings,and her mother for DNA analysis. In the mother and all the siblingsexcept for one sister, blood pressure and heart rate were determinedin the supine position and after 5 minutes of standing, andplasma catecholamines were measured after the subjects had beensupine for 20 minutes and then after they had been standingfor 30 minutes.
Detection of Mutations
Amplification and sequencing were performed at the VanderbiltCenter for Molecular Neuroscience DNA Sequencing Core. GenomicDNA was isolated from venous blood with the PureGene DNA ExtractionKit (Gentra Systems, Minneapolis), and the exons of the humannorepinephrine-transporter gene (SLC6A2; McKusick no. 16397014)were amplified with the use of the polymerase chain reactionand sense and antisense primers (the sequences of oligonucleotidesused for the exonic polymerase chain reaction and the conditionsfor amplification are available on request). The amplified products(60 ng per aliquot) were directly sequenced with fluorescentdideoxynucleotide chain terminators (AmpliTaq FS, Perkin ElmerApplied Biosystems, Foster City, Calif.) on an automated DNAsequencer (ABI 310, Perkin Elmer Applied Biosystems).
Functional Analysis of the Identified Mutation
DNA encoding a human norepinephrine transporter with alaninereplaced by proline at position 457 (Ala457Pro) was createdwith the use of a kit (QuikChange Site-Directed MutagenesisKit, Stratagene, La Jolla, Calif.) with the oligonucleotides5'CCTTCAGTACTTTCCTTCTCCCCCTGTTCTGCATAACCAAG3' and 5'CTTGGTTATGCAGAACAGGGGGAGAAGGAAAGTACTGA-AGG3'.The underlined bases are those that were introduced to createa mutation in which guanine was replaced by cytosine at position237 (G237C) or to introduce a ScaI restriction site that couldbe used to identify mutant plasmids. Amplified DNA was clonedinto a construct (pcDNA3, Invitrogen, Carlsbad, Calif.) containingwild-type human norepinephrine-transporter complementary DNA(cDNA) in which a silent mutation, or one that does not resultin a change in amino acid (in this case, leucine at position438), had previously been introduced to create a unique AflII restriction site and thus facilitate subcloning of the mutatedsequence back into the wild-type construct. The subcloned regionwas sequenced with the norepinephrine-transporter oligonucleotides5'CATTCT-GGGCTGTTGTGT3' and 5'GTGGTTGTGGTCAGCATCATC3'. DNA frommultiple isolates of mutant clones was purified (Qiagen, SantaClarita, Calif.) to test the effect of the Ala457Pro mutationon transporter activity.
Wild-type norepinephrine transporter, norepinephrine transporterwith the Ala457Pro mutation, and pcDNA3 plasmids were transientlytransfected into Chinese-hamster-ovary cells (American TypeCulture Collection, Rockville, Md.) with the use of lipofectamine.The cells were assayed for tritiated norepinephrine-transporteractivity (20 nmol per liter) 72 hours after transfection, aspreviously described.15
Genotyping of Ala457Pro Alleles
Allele-specific oligonucleotide hybridization was used to testfor the presence of the Ala457Pro mutation, with hybridizationof 5'CCTTCTCGCCCTGTT3' to the wild-type allele and hybridizationof 5'CCTTCTCCCCCTGTT3' to the mutant allele. The underlinedbases are those used to identify the single-nucleotide polymorphismin the mutant allele. All samples of genomic DNA were codedbefore genotype analysis in order to preserve the anonymityof the subjects. Genotypes were then used to associate genotypeswith phenotypes.
Statistical Analysis
Paired and unpaired t-tests were used to compare clinical findingsbetween the groups of subjects and within each group beforeand after exposure to various stimuli. Data were analyzed withPrism software (GraphPad Software, San Diego, Calif.). All Pvalues are two-sided.
Results
Autonomic Responses
The proband and her twin sister had normal autonomic reflexes,but their blood pressure and heart rate were variable (Figure 1).Their blood pressure, heart rate, and plasma catecholamineconcentrations in the supine and upright positions and thosein the unrelated normal subjects13 are shown in Table 1. Inthe proband and her twin, the plasma concentrations of dihydroxyphenylglycol,an intraneuronal metabolite of norepinephrine,9 were low inrelation to the plasma norepinephrine concentrations (ratioof dihydroxyphenylglycol to norepinephrine in the supine position,3.06 in the proband and 2.41 in her twin, vs. 5.52 in the normalsubjects; ratio in the upright position, 1.05 in the probandand 1.17 in her twin, vs. 3.44 in the normal subjects). Urinaryexcretion of norepinephrine was high in both the proband andher twin (435 and 125 µg per 24 hours [2.57 and 0.74 µmolper 24 hours], respectively; normal value, <90 µg per24 hours [0.53 µmol per 24 hours]).
Figure 1. Continuous Recordings of Blood Pressure and Heart Rate in the Proband and Her Twin Sister.
Beat-by-beat recordings of blood pressure as determined by photoplethysmography and continuous recordings of heart rate show spontaneous increases of up to 50 mm Hg in blood pressure and 25 beats per minute in heart rate in the proband and her twin sister. In the proband, a 75-degree tilt increased the variation in blood pressure and heart rate.
Table 1. Blood Pressure, Heart Rate, and Plasma Catecholamine Concentrations in the Proband, Her Twin Sister, and 10 Unrelated Normal Subjects.
Response to Tyramine
After it is taken up into neurons by the norepinephrine transporter,tyramine has a hypertensive effect caused by the release ofnorepinephrine.16,17 In the normal subjects, the mean (±SD)systolic blood pressure increased by 19±2 mm Hg and themean plasma norepinephrine concentration increased by 56 ±21pg per milliliter (0.33±0.12 nmol per liter) in responseto 3 mg of tyramine. In the proband, the same dose of tyramineincreased systolic blood pressure by 18 mm Hg but increasedthe plasma norepinephrine concentration by only 12 pg per milliliter(0.07 nmol per milliliter).
Spillover and Clearance of Systemic Norepinephrine
The arterial plasma norepinephrine concentration at rest wasslightly higher in the proband than in the normal subjects (280pg per milliliter [1.66 nmol per liter] vs. 204±51 pgper milliliter [1.21±0.30 nmol per liter]). This increasewas due primarily to a decrease in the rate of removal of norepinephrinefrom the circulation (norepinephrine clearance): although therate at which norepinephrine entered the circulation (norepinephrinespillover) was lower in the proband than in the normal subjects(436 vs. 514±277 ng per minute [2.58 vs. 3.04±1.64nmol per minute]), norepinephrine clearance in the proband wasless than half that in the normal subjects (1.56 vs. 2.42±0.71liters per minute). During the infusion of nitroprusside, norepinephrinespillover increased to 1072 ng per minute (6.34 nmol per minute)in the proband but only to 745±212 ng per minute (4.40±1.25nmol per minute) in the normal subjects. Norepinephrine clearancedid not change appreciably after the nitroprusside infusionin either the proband (1.76 liters per minute) or the normalsubjects (2.31±0.68 liters per minute).
Identification of a Functional Missense Mutation in the Norepinephrine-Transporter Gene
The combination in the proband of a low ratio of plasma dihydroxyphenylglycolto norepinephrine, a blunted response of plasma norepinephrineto tyramine, and a decreased plasma norepinephrine clearancesuggested a potential defect in the norepinephrine transporter.The presence of similar findings in her twin sister suggesteda genetic origin.
Direct sequence analysis of the norepinephrine-transporter genein the proband revealed no divergence from previously publishedsequences14,18 in exons 1 through 8 and exons 10 through 15.However, two novel polymorphisms were identified in exon 9:a silent polymorphism in which cytosine was replaced by adenineat position 154 (C154A) and a missense mutation in which guaninewas replaced by cytosine at position 237 (G237C) (position numbersrefer to the GenBank sequence for exon 9). The proband was heterozygousfor both the C154A and the G237C polymorphisms (Figure 2A).The G237C mutation results in a change from alanine to proline(Ala457Pro) within a highly conserved region of transmembranedomain 9 (Figure 2B and Figure 2C).
Figure 2. Evaluation of the Norepinephrine-Transporter (NET) Mutation.
DNA sequencing of the norepinephrine-transporter gene (Panel A) identified both cytosine (C) and guanine (G) (arrows) at position 237 of exon 9 in both the sense (top) and antisense (bottom) DNA strands, indicating heterozygosity at this locus. This change from cytosine to guanine results in a change from alanine to proline at amino acid position 457 (Ala457Pro). The Ala457Pro mutation is in transmembrane domain 9 of the norepinephrine transporter (Panel B). S-S denotes a disulfide bond, and Ph canonical sites for protein phosphorylation. Transmembrane domain 9 is highly conserved among the related murine and bovine norepinephrine transporters and the frog epinephrine transporter (ET) (Panel C). Shading indicates areas of homology among species. The asterisk denotes the site of mutation. As compared with the wild-type norepinephrine transporter, the transporter with the Ala457Pro mutation results in impairment of mean norepinephrine uptake in transiently transfect-ed Chinese-hamster-ovary cells (Panel D). I bars indicate 1 SD. Panel E is a schematic diagram of the hybridization study and shows the presence of the mutant (P, for proline) and wild-type (A, for alanine) alleles. Panel F shows a pedigree of the proband. P (for proline) denotes the mutant allele and A (for alanine) the wild-type allele. Circles denote female family members, and squares male family members. The slash denotes a deceased family member, and the arrow indicates the proband.
Heterologous expression of the wild-type norepinephrine-transportergene and human cDNA encoding the Ala457Pro mutation revealedthat norepinephrine transport was greatly diminished by theAla457Pro mutation. In Chinese-hamster-ovary cells that hadbeen transiently transfected with cDNA encoding the human norepinephrinetransporter, uptake of tritiated norepinephrine was 10 timesthat in vector-transfected cells, whereas in cells transfectedwith cDNA encoding the Ala457Pro mutation in the norepinephrinetransporter, the uptake was 2 percent or less (Figure 2D). Multipleclones were tested, and in another cell line (LLC-PK1, providedby M. Hahn), all the clones were devoid of transport activity(data not shown).
Segregation of the Ala457Pro Mutation with a Phenotype
The proband's mother and eight of the proband's siblings weregenotyped by allele-specific oligonucleotide hybridization.The mother and four siblings (including the twin sister) wereheterozygous for the mutant allele (Figure 2E). Their heartrates while supine were slightly but not significantly greaterthan those of their family members with the wild-type genotype,but their heart rates while standing were significantly higher(Figure 3A and Figure 3B). Likewise, plasma norepinephrine concentrationsin the supine position were somewhat higher and plasma norepinephrineconcentrations in the upright position were significantly higherin the heterozygous family members than in those with the normalgenotype (Figure 3C and Figure 3D). Finally, the ratios of dihydroxyphenylglycolto norepinephrine in plasma in both the supine and upright positionswere significantly lower in those who were heterozygous forthe mutation than in the other family members (Figure 3E andFigure 3F).
Figure 3. Heart Rate and Plasma Catecholamine Concentrations in the Proband and Her Family in the Supine and Upright Positions.
Heart rate, plasma concentrations of norepinephrine, and the ratio of its intraneuronal metabolite, dihydroxyphenylglycol (DHPG), to norepinephrine were determined in the proband and nine family members (three family members with the Ala457Pro mutation and six with the normal genotype). In the supine position, the heart rate in the family members with the mutation was similar to that in those without the mutation. However, in the upright position, the heart rate and plasma norepinephrine concentrations were significantly higher in those with the mutation than in those without it. Plasma norepinephrine concentrations in the supine position were somewhat higher in the family members with the mutation than in the others. The ratio of the plasma DHPG concentration to the plasma norepinephrine concentration was significantly lower in both the supine and the upright positions in those with the mutation, a finding consistent with impairment of norepinephrine uptake. Each point represents one subject, and the horizontal lines represent the mean values. To convert plasma norepinephrine values to nanomoles per liter, multiply by 0.005911. P values are for the comparison between family members with the Ala457Pro mutation and those with the normal genotype.
Discussion
The deficiency in norepinephrine transport in the proband andseveral members of her family was the result of a functionalmutation in the gene encoding the norepinephrine transporter.Previously detected coding polymorphisms in this gene have noreported effect on norepinephrine transport.19 In contrast,the Ala457Pro mutation renders the transporter nonfunctionaland segregates with altered heart-rate regulation and alterednorepinephrine metabolism. The proband had a defect in norepinephrineuptake. Her heart rate while supine was about 10 beats per minutefaster than the mean value for age-matched normal subjects20and rose substantially when she stood. This change in heartrate was accompanied by an increase in the plasma norepinephrineconcentration to almost four times its value in the supine position.These changes may have been caused by either an increase inthe release (spillover) of norepinephrine or a decrease in itsclearance.8,21 The blunting of the increase in plasma norepinephrinein the proband in response to the administration of tyramineand her low systemic norepinephrine clearance suggest that theuptake of norepinephrine was impaired. The abnormal relationbetween plasma concentrations of dihydroxyphenylglycol and norepinephrineprovides further evidence of impaired norepinephrine uptake.Some of the norepinephrine taken up into neurons by the norepinephrinetransporter reaches the vesicles, where it is stored for laterrelease, but much of it is converted to dihydroxyphenylglycolby monoamine oxidase.8 The dihydroxyphenylglycol then entersthe circulation and can serve as a marker of norepinephrineuptake and monoamine oxidase activity9 (Figure 4). The relativelylow ratios of dihydroxyphenylglycol to norepinephrine in plasmain the proband and her twin sister indicate that norepinephrinetransport in these women was impaired.
Figure 4. Neuronal Metabolism of Norepinephrine in Persons with Norepinephrine-Transporter Deficiency.
Under normal conditions, norepinephrine is released from vesicles in the neuron into the synaptic space, where it can interact with presynaptic and postsynaptic - and ß-adrenergic receptors. Approximately 80 percent of the norepinephrine in the synaptic space is taken up by the norepinephrine transporter into the neuron that released it, and approximately 20 percent spills over into the circulation. Norepinephrine taken up by the neuron that released it is preferentially converted to dihydroxyphenylglycol (DHPG) by monoamine oxidase; some is repackaged into the synaptic vesicles. DHPG diffuses out of the neuron into the circulation. In persons with norepinephrine-transporter deficiency, the release of norepinephrine into the synaptic space is normal, but because of the decreased activity of the norepinephrine transporter, less than 80 percent of norepinephrine is taken up into the neuron that released it, so that the spillover into the circulation is greater than 20 percent. In addition, more norepinephrine is available for interaction with the adrenergic receptors in the synaptic space. Because of the decreased uptake of norepinephrine, the production of DHPG is decreased. The reduced DHPG concentration in the neuron results in lower concentrations of this metabolite in the plasma and, consequently, a ratio of plasma DHPG to plasma norepinephrine that is lower than normal.
These findings in both the proband and her identical twin stronglysuggested the presence of an abnormality in the norepinephrine-transportergene, which has been mapped to chromosome 16q.22 Analysis ofthis gene in the proband revealed a missense mutation that resultedin the replacement of an alanine residue with a proline residuein a highly conserved transmembrane region of the transporter.Because the substitution of proline disrupts alpha-helical secondarystructures that are supported by alanine residues, this mutationmay disrupt the transport of norepinephrine. Functional analysisof the proband's mutant norepinephrine transporter demonstratedthat it had 2 percent or less of the activity of the transporterencoded by the wild-type gene.
The pathophysiologic features of orthostatic intolerance havebeen thought to be due to a primary23 or secondary23,24,25,26activation of sympathetic outflow. A deficiency of the norepinephrinetransporter may explain several of the clinical findings inpatients with this disorder: the high heart rate in the supineposition, the high plasma concentration of norepinephrine inassociation with the relatively low plasma concentration ofdihydroxyphenylglycol, the impaired response of norepinephrineto tyramine,13 the reduced systemic clearance of norepinephrine,13and the disparity between the changes in heart rate and plas-manorepinephrine concentrations and the change in muscle sympathetic-nerveactivity in the upright position.27 In many patients with orthostaticintolerance, the disproportionately greater increase in heartrate than in diastolic pressure in the upright posture13 mayalso be explained by a deficiency of the norepinephrine transporter.The noradrenergic synaptic clefts in the heart are approximatelythree times as narrow as the synaptic clefts in the vasculature,28making the removal of norepinephrine from the synapses in theheart far more dependent on the activity of the norepinephrinetransporter than is removal from synapses in the vascular beds.29Therefore, a decrease in transporter activity could result ina disproportionately greater effect on heart rate than on bloodpressure, as is observed in patients with orthostatic intolerance.
Impairment of the norepinephrine transporter in the centralnervous system may also contribute to the phenotype. Norepinephrinereleased in the brain can either increase30,31 or decrease32sympathetic outflow. Because acute pharmacologic blockade ofthe norepinephrine transporter causes a decrease in sympatheticoutflow,33 one would expect a decrease in sympathetic tone witha deficiency of the norepinephrine transporter. Yet in the probandand in many other patients with orthostatic intolerance, centralsympathetic tone seems to be increased.34,35 This paradoxicalincrease may represent the sum of the effects of partial inhibitionof norepinephrine transport at multiple sites in the centralnervous system.
The Ala457Pro mutation does not explain all cases of orthostaticintolerance. The mutation was not present in any of 254 unrelatedpersons, including normal subjects, patients with hypertension,and other patients with orthostatic intolerance (data not shown).Furthermore, in the current study, family members who had themutation also had some of the physiologic and biochemical abnormalitiesdetected in the proband and her twin sister, but none had thefull-blown syndrome. Thus, other genetic or environmental factorsmust have contributed to the phenotype in the two affected women.
In conclusion, the identification of defective norepinephrinetransport in patients with orthostatic intolerance suggestsa previously unrecognized mechanism in some patients with thisclinical problem.
Supported in part by grants from the National Institutes ofHealth (MH58921, to Dr. Blakely; PO1 HL56693, to Dr. Robertson;and RR00095, to Drs. Robertson and Shannon), the National Aeronauticsand Space Administration (NAS 9 19483, to Drs. Robertson andBiaggioni), and the Nathan Blaser ShyDrager ResearchProgram of Vanderbilt University.
We are indebted to Drs. Graeme Eisenhofer, Bojan Pohar, RogelioMosqueda-Garcia, Raffaello Furlan, R. Andrew Gaffney, Rose MarieRobertson, and Jack Alexander of Red Wing, Minnesota, and toDorothea Boemer for their contributions to this study.
Source Information
From the Autonomic Dysfunction Center (J.R.S., J.J., G.J., B.K.B., I.B., D.R.) and the Center for Molecular Neuroscience (N.L.F., R.D.B.), Departments of Medicine, Pharmacology, and Neurology, Vanderbilt University, Nashville.
Address reprint requests to Dr. Robertson at the General Clinical Research Center, AA3228 MCN, Vanderbilt University, Nashville, TN 37232-2195, or at david.robertson{at}mcmail.vanderbilt.edu.
References
Jacob G, Shannon JR, Black B, et al. Effects of volume loading and pressor agents in idiopathic orthostatic tachycardia. Circulation 1997;96:575-580. [Free Full Text]
Orthostatic disorders of blood pressure control: definitions and classification. In: Streeten DHP. Orthostatic disorders of the circulation: mechanisms, manifestations, and treatment. New York: Plenum Medical Book, 1987:111-25.
Fraser F, Wilson RM. The sympathetic nervous system and the "irritable heart of soldiers." BMJ 1918;2:27-29. [Free Full Text]
Wooley CF. Where are the diseases of yesteryear? DaCosta's syndrome, soldiers heart, the effort syndrome, neurocirculatory asthenia -- and the mitral valve prolapse syndrome. Circulation 1976;53:749-751. [Free Full Text]
Boudoulas H, Reynolds JC, Mazzaferri E, Wooley CF. Metabolic studies in mitral valve prolapse syndrome: a neuroendocrine-cardiovascular process. Circulation 1980;61:1200-1205. [Free Full Text]
Schondorf R, Freeman R. The importance of orthostatic intolerance in the chronic fatigue syndrome. Am J Med Sci 1999;317:117-123. [CrossRef][Medline]
Esler M, Jennings G, Lambert G, Meredith I, Horne M, Eisenhofer G. Overflow of catecholamine neurotransmitters to the circulation: source, fate, functions. Physiol Rev 1990;70:963-985. [Free Full Text]
Goldenstein DS, Eisenhofer G, Stull R, Folio CJ, Keiser HR, Kopin IJ. Plasma dihydroxyphenylglycol and the intraneuronal disposition of norepinephrine in humans. J Clin Invest 1988;81:213-220.
Shoup RE, Kissinger PT. Determination of urinary normetanephrine, metanephrine, and 3-methoxytyramine by liquid chromatography, with amperometric detection. Clin Chem 1977;23:1268-1274. [Free Full Text]
Mosqueda-Garcia R. Evaluation of the autonomic nervous system. In: Robertson D, Biaggioni I, eds. Disorders of the autonomic nervous system. London: Harwood Academic, 1995:25-59.
Riley M, Elborn JS, McKane W, Bell N, Stanford CF, Nicholls DP. Resting energy expenditure in chronic cardiac failure. Clin Sci (Colch) 1991;80:633-639. [Medline]
Jacob G, Shannon JR, Costa F, et al. Abnormal norepinephrine clearance and adrenergic receptor sensitivity in idiopathic orthostatic intolerance. Circulation 1999;99:1706-1712. [Free Full Text]
Pacholczyk T, Blakely RD, Amara SG. Expression cloning of a cocaine- and antidepressant-sensitive human noradrenaline transporter. Nature 1991;350:350-354. [CrossRef][Medline]
Apparsundaram S, Galli A, DeFelice LJ, Hartzell HC, Blakely RD. Acute regulation of norepinephrine transport. I. Protein kinase C-linked muscarinic receptors influence transport capacity and transporter density in SK-N-SH cells. J Pharmacol Exp Ther 1998;287:733-743. [Free Full Text]
Blakely RD, De Felice LJ, Hartzell HC. Molecular physiology of norepinephrine and serotonin transporters. J Exp Biol 1994;196:263-281. [Free Full Text]
Demanet JC. Usefulness of noradrenaline and tyramine infusion tests in the diagnosis of orthostatic hypotension. Cardiology 1976;61:Suppl 1:213-224.
Pörzgen P, Bonisch H, Bruss M. Molecular cloning and organization of the coding region of the human norepinephrine transporter gene. Biochem Biophys Res Commun 1995;215:1145-1150. [Erratum, Biochem Biophys Res Commun 1996;227:642-3.] [CrossRef][Medline]
Stober G, Nothen MM, Porzgen P, et al. Systematic search for variation in the human norepinephrine transporter gene: identification of five naturally occurring missense mutations and study of association with major psychiatric disorders. Am J Med Genet 1996;67:523-532. [CrossRef][Medline]
Shannon JR, Jordan J, Black BK, Costa F, Robertson D. Uncoupling of the baroreflex by NN-cholinergic blockade in dissecting the components of cardiovascular regulation. Hypertension 1998;32:101-107. [Free Full Text]
Davis D, Sinoway LI, Robison J, et al. Norepinephrine kinetics during orthostatic stress in congestive heart failure. Circ Res 1987;61:I87-I90.
Bruss M, Kunz J, Lingen B, Bonisch H. Chromosomal mapping of the human gene for the tricyclic antidepressant-sensitive noradrenaline transporter. Hum Genet 1993;91:278-280. [Medline]
Novak V, Novak P, Opfer-Gehrking TL, Low PA. Postural tachycardia syndrome: time frequency mapping. J Auton Nerv Syst 1996;61:313-320. [CrossRef][Medline]
Fouad FM, Tadena-Thome L, Bravo EL, Tarazi RC. Idiopathic hypovolemia. Ann Intern Med 1986;104:298-303.
Rosen SG, Cryer PE. Postural tachycardia syndrome: reversal of sympathetic hyperresponsiveness and clinical improvement during sodium loading. Am J Med 1982;72:847-850. [CrossRef][Medline]
Schondorf R, Low PA. Idiopathic postural orthostatic tachycardia syndrome: an attenuated form of acute pandysautonomia? Neurology 1993;43:132-137. [Free Full Text]
Furlan R, Jacob G, Snell M, et al. Chronic orthostatic intolerance: a disorder with discordant cardiac and vascular sympathetic control. Circulation 1998;98:2154-2159. [Free Full Text]
Novi AM. An electron microscopic study of the innervation of papillary muscles in the rat. Anat Rec 1968;160:123-141. [CrossRef][Medline]
Goldstein DS, Brush JE Jr, Eisenhofer G, Stull R, Esler M. In vivo measurement of neuronal uptake of norepinephrine in the human heart. Circulation 1988;78:41-48. [Free Full Text]
Goldberg MR, Tung CS, Ring M, Oates JA, Gerkens JF, Robertson D. Evidence that alpha-methylepinephrine is an antihypertensive metabolite of alpha-methyldopa. Clin Exp Hypertens 1982;4:595-604.
Tung CS, Goldberg MR, Hollister AS, Oates JA, Robertson D. Central and peripheral cardiovascular effects of alpha-methylepinephrine. J Pharmacol Exp Ther 1983;227:484-490. [Free Full Text]
Adler-Graschinsky E, Langer SZ. Possible role of a beta-adrenoceptor in the regulation of noradrenaline release by nerve stimulation through a positive feed-back mechanism. Br J Pharmacol 1975;53:43-50. [Medline]
Esler MD, Wallin G, Dorward PK, et al. Effects of desipramine on sympathetic nerve firing and norepinephrine spillover to plasma in humans. Am J Physiol 1991;260:R817-R823. [Free Full Text]
Novak V, Spies JM, Novak P, McPhee BR, Rummans TA, Low PA. Hypocapnia and cerebral hypoperfusion in orthostatic intolerance. Stroke 1998;29:1876-1881. [Free Full Text]
Shannon JR, Jordan J, Black BK, Diedrich A, Biaggioni I, Robertson D. Sympathetic support of the circulation in idiopathic orthostatic intolerance. Circulation 1998;98:Suppl I:I-336.abstract
Carew, S., Cooke, J., O'Connor, M., Donnelly, T., Costelloe, A., Sheehy, C., Lyons, D.
(2009). What is the optimal duration of tilt testing for the assessment of patients with suspected postural tachycardia syndrome?. Europace
11: 635-637
[Abstract][Full Text]
Raj, V, Haman, K L, Raj, S R, Byrne, D, Blakely, R D, Biaggioni, I, Robertson, D, Shelton, R C
(2009). Psychiatric profile and attention deficits in postural tachycardia syndrome. J. Neurol. Neurosurg. Psychiatry
80: 339-344
[Abstract][Full Text]
Carew, S., Connor, M. O., Cooke, J., Conway, R., Sheehy, C., Costelloe, A., Lyons, D.
(2009). A review of postural orthostatic tachycardia syndrome. Europace
11: 18-25
[Abstract][Full Text]
Goldstein, D. S., Holmes, C.
(2008). Neuronal Source of Plasma Dopamine. Clin. Chem.
54: 1864-1871
[Abstract][Full Text]
Lambert, E., Eikelis, N., Esler, M., Dawood, T., Schlaich, M., Bayles, R., Socratous, F., Agrotis, A., Jennings, G., Lambert, G., Vaddadi, G.
(2008). Altered Sympathetic Nervous Reactivity and Norepinephrine Transporter Expression in Patients With Postural Tachycardia Syndrome. Circ Arrhythmia Electrophysiol
1: 103-109
[Abstract][Full Text]
Grubb, B. P.
(2008). Postural Tachycardia Syndrome. Circulation
117: 2814-2817
[Full Text]
Moldovanova, I., Schroeder, C., Jacob, G., Hiemke, C., Diedrich, A., Luft, F. C., Jordan, J.
(2008). Hormonal Influences on Cardiovascular Norepinephrine Transporter Responses in Healthy Women. Hypertension
51: 1203-1209
[Abstract][Full Text]
Strempel, S., Schroeder, C., Hemmersbach, R., Boese, A., Tank, J., Diedrich, A., Heer, M., Luft, F. C., Jordan, J.
(2008). Norepinephrine transporter inhibition alters the hemodynamic response to hypergravitation. J. Appl. Physiol.
104: 756-760
[Abstract][Full Text]
Stewart, J. M., Taneja, I., Medow, M. S.
(2007). Reduced central blood volume and cardiac output and increased vascular resistance during static handgrip exercise in postural tachycardia syndrome. Am. J. Physiol. Heart Circ. Physiol.
293: H1908-H1917
[Abstract][Full Text]
Garland, E. M., Raj, S. R., Black, B. K., Harris, P. A., Robertson, D.
(2007). The hemodynamic and neurohumoral phenotype of postural tachycardia syndrome. Neurology
69: 790-798
[Abstract][Full Text]
Garland, E. M., Black, B. K., Harris, P. A., Robertson, D.
(2007). Dopamine-beta-hydroxylase in postural tachycardia syndrome. Am. J. Physiol. Heart Circ. Physiol.
293: H684-H690
[Abstract][Full Text]
Heusser, K., Engeli, S., Tank, J., Diedrich, A., Wiesner, S., Janke, J., Luft, F. C., Jordan, J.
(2007). Sympathetic Vasomotor Tone Determines Blood Pressure Response to Long-Term Sibutramine Treatment. J. Clin. Endocrinol. Metab.
92: 1560-1563
[Abstract][Full Text]
Farhan, H., Reiterer, V., Korkhov, V. M., Schmid, J. A., Freissmuth, M., Sitte, H. H.
(2007). Concentrative Export from the Endoplasmic Reticulum of the {gamma}-Aminobutyric Acid Transporter 1 Requires Binding to SEC24D. J. Biol. Chem.
282: 7679-7689
[Abstract][Full Text]
McEvoy, M. D., Low, P. A., Hebbar, L.
(2007). Postural Orthostatic Tachycardia Syndrome: Anesthetic Implications in the Obstetric Patient. Anesth. Analg.
104: 166-167
[Abstract][Full Text]
Kim, C.-H., Hahn, M. K., Joung, Y., Anderson, S. L., Steele, A. H., Mazei-Robinson, M. S., Gizer, I., Teicher, M. H., Cohen, B. M., Robertson, D., Waldman, I. D., Blakely, R. D., Kim, K.-S.
(2006). A polymorphism in the norepinephrine transporter gene alters promoter activity and is associated with attention-deficit hyperactivity disorder. Proc. Natl. Acad. Sci. USA
103: 19164-19169
[Abstract][Full Text]
Schroeder, C., Birkenfeld, A. L., Mayer, A. F., Tank, J., Diedrich, A., Luft, F. C., Jordan, J.
(2006). Norepinephrine Transporter Inhibition Prevents Tilt-Induced Pre-Syncope. J Am Coll Cardiol
48: 516-522
[Abstract][Full Text]
Corbett, W. L., Reiter, C. M., Schultz, J. R., Kanter, R. J., Habib, A. S.
(2006). Anaesthetic management of a parturient with the postural orthostatic tachycardia syndrome: a case report. Br J Anaesth
97: 196-199
[Abstract][Full Text]
Esler, M., Alvarenga, M., Pier, C., Richards, J., El-Osta, A., Barton, D., Haikerwal, D., Kaye, D., Schlaich, M., Guo, L., Jennings, G., Socratous, F., Lambert, G.
(2006). The neuronal noradrenaline transporter, anxiety and cardiovascular disease. J Psychopharmacol
20: 60-66
[Abstract]
Mayer, A. F., Schroeder, C., Heusser, K., Tank, J., Diedrich, A., Schmieder, R. E., Luft, F. C., Jordan, J.
(2006). Influences of Norepinephrine Transporter Function on the Distribution of Sympathetic Activity in Humans. Hypertension
48: 120-126
[Abstract][Full Text]
Jacob, G., Garland, E. M., Costa, F., Stein, C. M., Xie, H.-G., Robertson, R. M., Biaggioni, I., Robertson, D.
(2006). {beta}2-Adrenoceptor Genotype and Function Affect Hemodynamic Profile Heterogeneity in Postural Tachycardia Syndrome. Hypertension
47: 421-427
[Abstract][Full Text]
Alvarenga, M. E., Richards, J. C., Lambert, G., Esler, M. D.
(2006). Psychophysiological Mechanisms in Panic Disorder: A Correlative Analysis of Noradrenaline Spillover, Neuronal Noradrenaline Reuptake, Power Spectral Analysis of Heart Rate Variability, and Psychological Variables. Psychosom. Med.
68: 8-16
[Abstract][Full Text]
Garland, E. M., Winker, R., Williams, S. M., Jiang, L., Stanton, K., Byrne, D. W., Biaggioni, I., Cascorbi, I., Phillips, J. A. III, Harris, P. A., Rudiger, H., Robertson, D.
(2005). Endothelial NO Synthase Polymorphisms and Postural Tachycardia Syndrome. Hypertension
46: 1103-1110
[Abstract][Full Text]
Schondorf, R., Benoit, J., Stein, R.
(2005). Cerebral autoregulation is preserved in postural tachycardia syndrome. J. Appl. Physiol.
99: 828-835
[Abstract][Full Text]
Muenter Swift, N., Charkoudian, N., Dotson, R. M., Suarez, G. A., Low, P. A.
(2005). Baroreflex control of muscle sympathetic nerve activity in postural orthostatic tachycardia syndrome. Am. J. Physiol. Heart Circ. Physiol.
289: H1226-H1233
[Abstract][Full Text]
Prasad, H. C., Zhu, C.-B., McCauley, J. L., Samuvel, D. J., Ramamoorthy, S., Shelton, R. C., Hewlett, W. A., Sutcliffe, J. S., Blakely, R. D.
(2005). Human serotonin transporter variants display altered sensitivity to protein kinase G and p38 mitogen-activated protein kinase. Proc. Natl. Acad. Sci. USA
102: 11545-11550
[Abstract][Full Text]
Hahn, M. K., Mazei-Robison, M. S., Blakely, R. D.
(2005). Single Nucleotide Polymorphisms in the Human Norepinephrine Transporter Gene Affect Expression, Trafficking, Antidepressant Interaction, and Protein Kinase C Regulation. Mol. Pharmacol.
68: 457-466
[Abstract][Full Text]
Ruoho, A. E.
(2005). How the Monoamine Transporter Garden Grows. Mol. Pharmacol.
68: 272-274
[Abstract][Full Text]
Grubb, B. P.
(2005). Neurocardiogenic Syncope and Related Disorders of Orthostatic Intolerance. Circulation
111: 2997-3006
[Full Text]
Schwartz, J. W., Novarino, G., Piston, D. W., DeFelice, L. J.
(2005). Substrate Binding Stoichiometry and Kinetics of the Norepinephrine Transporter. J. Biol. Chem.
280: 19177-19184
[Abstract][Full Text]
Raj, S. R., Biaggioni, I., Yamhure, P. C., Black, B. K., Paranjape, S. Y., Byrne, D. W., Robertson, D.
(2005). Renin-Aldosterone Paradox and Perturbed Blood Volume Regulation Underlying Postural Tachycardia Syndrome. Circulation
111: 1574-1582
[Abstract][Full Text]
Kreek, M. J., Bart, G., Lilly, C., Laforge, K. S., Nielsen, D. A.
(2005). Pharmacogenetics and Human Molecular Genetics of Opiate and Cocaine Addictions and Their Treatments. Pharmacol. Rev.
57: 1-26
[Abstract][Full Text]
Winker, R., Barth, A., Bidmon, D., Ponocny, I., Weber, M., Mayr, O., Robertson, D., Diedrich, A., Maier, R., Pilger, A., Haber, P., Rudiger, H. W.
(2005). Endurance Exercise Training in Orthostatic Intolerance: A Randomized, Controlled Trial. Hypertension
45: 391-398
[Abstract][Full Text]
Goldstein, D. S., Eldadah, B., Holmes, C., Pechnik, S., Moak, J., Sharabi, Y.
(2005). Neurocirculatory Abnormalities in Chronic Orthostatic Intolerance. Circulation
111: 839-845
[Abstract][Full Text]
Márquez, M. F., Urias, K. I., Hermosillo, A. G., Jardón, J. L., Iturralde, P., Colín, L., Nava, S., Cárdenas, M.
(2005). Familial vasovagal syncope. Europace
7: 472-474
[Abstract][Full Text]
Seidel, S., Singer, E. A., Just, H., Farhan, H., Scholze, P., Kudlacek, O., Holy, M., Koppatz, K., Krivanek, P., Freissmuth, M., Sitte, H. H.
(2005). Amphetamines Take Two to Tango: an Oligomer-Based Counter-Transport Model of Neurotransmitter Transport Explores the Amphetamine Action. Mol. Pharmacol.
67: 140-151
[Abstract][Full Text]
Bonyhay, I., Freeman, R.
(2004). Sympathetic Nerve Activity in Response to Hypotensive Stress in the Postural Tachycardia Syndrome. Circulation
110: 3193-3198
[Abstract][Full Text]
Tsapakis, E. M., Basu, A., Aitchison, K. J.
(2004). Clinical relevance of discoveries in psychopharmacogenetics. Adv. Psychiatr. Treat.
10: 455-465
[Abstract][Full Text]
Keller, N. R., Diedrich, A., Appalsamy, M., Tuntrakool, S., Lonce, S., Finney, C., Caron, M. G., Robertson, D.
(2004). Norepinephrine Transporter-Deficient Mice Exhibit Excessive Tachycardia and Elevated Blood Pressure With Wakefulness and Activity. Circulation
110: 1191-1196
[Abstract][Full Text]
Eisenhofer, G., Kopin, I. J., Goldstein, D. S.
(2004). Catecholamine Metabolism: A Contemporary View with Implications for Physiology and Medicine. Pharmacol. Rev.
56: 331-349
[Abstract][Full Text]
Vincent, S., Bieck, P. R., Garland, E. M., Loghin, C., Bymaster, F. P., Black, B. K., Gonzales, C., Potter, W. Z., Robertson, D.
(2004). Clinical Assessment of Norepinephrine Transporter Blockade Through Biochemical and Pharmacological Profiles. Circulation
109: 3202-3207
[Abstract][Full Text]
Kim, H J, Camilleri, M, Carlson, P J, Cremonini, F, Ferber, I, Stephens, D, McKinzie, S, Zinsmeister, A R, Urrutia, R
(2004). Association of distinct {alpha}2 adrenoceptor and serotonin transporter polymorphisms with constipation and somatic symptoms in functional gastrointestinal disorders. Gut
53: 829-837
[Abstract][Full Text]
Kawada, T., Miyamoto, T., Uemura, K., Kashihara, K., Kamiya, A., Sugimachi, M., Sunagawa, K.
(2004). Effects of neuronal norepinephrine uptake blockade on baroreflex neural and peripheral arc transfer characteristics. Am. J. Physiol. Regul. Integr. Comp. Physiol.
286: R1110-R1120
[Abstract][Full Text]
Schroeder, C., Adams, F., Boschmann, M., Tank, J., Haertter, S., Diedrich, A., Biaggioni, I., Luft, F. C., Jordan, J.
(2004). Phenotypical evidence for a gender difference in cardiac norepinephrine transporter function. Am. J. Physiol. Regul. Integr. Comp. Physiol.
286: R851-R856
[Abstract][Full Text]
Jayanthi, L. D., Samuvel, D. J., Ramamoorthy, S.
(2004). Regulated Internalization and Phosphorylation of the Native Norepinephrine Transporter in Response to Phorbol Esters: EVIDENCE FOR LOCALIZATION IN LIPID RAFTS AND LIPID RAFT-MEDIATED INTERNALIZATION. J. Biol. Chem.
279: 19315-19326
[Abstract][Full Text]
Murphy, D. L., Lerner, A., Rudnick, G., Lesch, K.-P.
(2004). Serotonin Transporter: Gene, Genetic Disorders, and Pharmacogenetics. Mol. Interv.
4: 109-123
[Abstract][Full Text]
Robinson, M. B.
(2003). Signaling Pathways Take Aim at Neurotransmitter Transporters. Sci Signal
2003: pe50-pe50
[Abstract][Full Text]
Sharpe, I. A., Palant, E., Schroeder, C. I., Kaye, D. M., Adams, D. J., Alewood, P. F., Lewis, R. J.
(2003). Inhibition of the Norepinephrine Transporter by the Venom Peptide {chi}-MrIA: SITE OF ACTION, Na+ DEPENDENCE, AND STRUCTURE-ACTIVITY RELATIONSHIP. J. Biol. Chem.
278: 40317-40323
[Abstract][Full Text]
Horvath, G., Sutto, Z., Torbati, A., Conner, G. E., Salathe, M., Wanner, A.
(2003). Norepinephrine transport by the extraneuronal monoamine transporter in human bronchial arterial smooth muscle cells. Am. J. Physiol. Lung Cell. Mol. Physiol.
285: L829-L837
[Abstract][Full Text]
Rasmussen, L. E., Nedergaard, O. A.
(2003). Effects of Reboxetine on Sympathetic Neuroeffector Transmission in Rabbit Carotid Artery. J. Pharmacol. Exp. Ther.
306: 995-1002
[Abstract][Full Text]
Tank, J., Schroeder, C., Diedrich, A., Szczech, E., Haertter, S., Sharma, A. M., Luft, F. C., Jordan, J.
(2003). Selective Impairment in Sympathetic Vasomotor Control With Norepinephrine Transporter Inhibition. Circulation
107: 2949-2954
[Abstract][Full Text]
Yusuf, S., Camm, A. J.
(2003). Sinus Tachyarrhythmias and the Specific Bradycardic Agents: A Marriage Made in Heaven?. J CARDIOVASC PHARMACOL THER
8: 89-105
[Abstract]
Hahn, M. K., Robertson, D., Blakely, R. D.
(2003). A Mutation in the Human Norepinephrine Transporter Gene (SLC6A2) Associated with Orthostatic Intolerance Disrupts Surface Expression of Mutant and Wild-Type Transporters. J. Neurosci.
23: 4470-4478
[Abstract][Full Text]
Van Lieshout, J. J., Wieling, W., Karemaker, J. M., Secher, N. H.
(2003). Syncope, cerebral perfusion, and oxygenation. J. Appl. Physiol.
94: 833-848
[Abstract][Full Text]
Sung, U., Apparsundaram, S., Galli, A., Kahlig, K. M., Savchenko, V., Schroeter, S., Quick, M. W., Blakely, R. D.
(2003). A Regulated Interaction of Syntaxin 1A with the Antidepressant-Sensitive Norepinephrine Transporter Establishes Catecholamine Clearance Capacity. J. Neurosci.
23: 1697-1709
[Abstract][Full Text]
Horvath, G., Torbati, A., Conner, G. E., Salathe, M., Wanner, A.
(2002). Systemic Ovalbumin Sensitization Downregulates Norepinephrine Uptake by Rabbit Aortic Smooth Muscle Cells. Am. J. Respir. Cell Mol. Bio.
27: 746-751
[Abstract][Full Text]
Carson, R. P., Diedrich, A., Robertson, D.
(2002). Autonomic control after blockade of the norepinephrine transporter: a model of orthostatic intolerance. J. Appl. Physiol.
93: 2192-2198
[Abstract][Full Text]
Goldstein, D. S., Robertson, D., Esler, M., Straus, S. E., Eisenhofer, G.
(2002). Dysautonomias: Clinical Disorders of the Autonomic Nervous System. ANN INTERN MED
137: 753-763
[Abstract][Full Text]
Birkenfeld, A. L., Schroeder, C., Boschmann, M., Tank, J., Franke, G., Luft, F. C., Biaggioni, I., Sharma, A. M., Jordan, J.
(2002). Paradoxical Effect of Sibutramine on Autonomic Cardiovascular Regulation. Circulation
106: 2459-2465
[Abstract][Full Text]
Boschmann, M., Schroeder, C., Christensen, N. J., Tank, J., Krupp, G., Biaggioni, I., Klaus, S., Sharma, A. M., Luft, F. C., Jordan, J.
(2002). Norepinephrine Transporter Function and Autonomic Control of Metabolism. J. Clin. Endocrinol. Metab.
87: 5130-5137
[Abstract][Full Text]
Khan, M. H., Sinoway, L. I., MacLean, D. A.
(2002). Effects of graded LBNP on MSNA and interstitial norepinephrine. Am. J. Physiol. Heart Circ. Physiol.
283: H2038-H2044
[Abstract][Full Text]
Goldstein, D. S., Holmes, C., Frank, S. M., Dendi, R., Cannon, R. O. III, Sharabi, Y., Esler, M. D., Eisenhofer, G.
(2002). Cardiac Sympathetic Dysautonomia in Chronic Orthostatic Intolerance Syndromes. Circulation
106: 2358-2365
[Abstract][Full Text]
Freeman, R., Lirofonis, V., Farquhar, W. B., Risk, M.
(2002). Limb venous compliance in patients with idiopathic orthostatic intolerance and postural tachycardia. J. Appl. Physiol.
93: 636-644
[Abstract][Full Text]
Janssen, B. J. A., Smits, J. F. M.
(2002). Autonomic control of blood pressure in mice: basic physiology and effects of genetic modification. Am. J. Physiol. Regul. Integr. Comp. Physiol.
282: R1545-R1564
[Abstract][Full Text]
Carson, R. P., Robertson, D.
(2002). Genetic Manipulation of Noradrenergic Neurons. J. Pharmacol. Exp. Ther.
301: 410-417
[Abstract][Full Text]
Kim, C.-H., Hwang, D.-Y., Park, J.-J., Kim, K.-S.
(2002). A Proximal Promoter Domain Containing a Homeodomain-Binding Core Motif Interacts with Multiple Transcription Factors, Including HoxA5 and Phox2 Proteins, and Critically Regulates Cell Type-Specific Transcription of the Human Norepinephrine Transporter Gene. J. Neurosci.
22: 2579-2589
[Abstract][Full Text]
Cabassi, A., Vinci, S., Cantoni, A. M., Quartieri, F., Moschini, L., Cavazzini, S., Cavatorta, A., Borghetti, A.
(2002). Sympathetic Activation in Adipose Tissue and Skeletal Muscle of Hypertensive Rats. Hypertension
39: 656-661
[Abstract][Full Text]
Schroeder, C., Tank, J., Boschmann, M., Diedrich, A., Sharma, A. M., Biaggioni, I., Luft, F. C., Jordan, J.
(2002). Selective Norepinephrine Reuptake Inhibition as a Human Model of Orthostatic Intolerance. Circulation
105: 347-353
[Abstract][Full Text]
Ertl, A. C, Diedrich, A., Biaggioni, I., Levine, B. D, Robertson, R. M., Cox, J. F, Zuckerman, J. H, Pawelczyk, J. A, Ray, C. A, Buckey, J. C Jr, Lane, L. D, Shiavi, R., Gaffney, F A., Costa, F., Holt, C., Blomqvist, C G., Eckberg, D. L, Baisch, F. J, Robertson, D.
(2002). Human muscle sympathetic nerve activity and plasma noradrenaline kinetics in space. J. Physiol.
538: 321-329
[Abstract][Full Text]
Jordan, J., Shannon, J. R., Diedrich, A., Black, B. K., Robertson, D.
(2002). Increased Sympathetic Activation in Idiopathic Orthostatic Intolerance: Role of Systemic Adrenoreceptor Sensitivity. Hypertension
39: 173-178
[Abstract][Full Text]
Apparsundaram, S., Sung, U., Price, R. D., Blakely, R. D.
(2001). Trafficking-Dependent and -Independent Pathways of Neurotransmitter Transporter Regulation Differentially Involving p38 Mitogen-Activated Protein Kinase Revealed in Studies of Insulin Modulation of Norepinephrine Transport in SK-N-SH Cells. J. Pharmacol. Exp. Ther.
299: 666-677
[Abstract][Full Text]
Blakely, R. D.
(2001). Physiological Genomics of Antidepressant Targets: Keeping the Periphery in Mind. J. Neurosci.
21: 8319-8323
[Abstract][Full Text]
Zwart, R., Verhaagh, S., Buitelaar, M., Popp-Snijders, C., Barlow, D. P.
(2001). Impaired Activity of the Extraneuronal Monoamine Transporter System Known as Uptake-2 in Orct3/Slc22a3-Deficient Mice. Mol. Cell. Biol.
21: 4188-4196
[Abstract][Full Text]
Carson, R. P., Appalsamy, M., Diedrich, A., Davis, T. L., Robertson, D.
(2001). Animal Model of Neuropathic Tachycardia Syndrome. Hypertension
37: 1357-1361
[Abstract][Full Text]
Cabassi, A., Vinci, S., Quartieri, F., Moschini, L., Borghetti, A.
(2001). Norepinephrine Reuptake Is Impaired in Skeletal Muscle of Hypertensive Rats In Vivo. Hypertension
37: 698-702
[Abstract][Full Text]
Rumantir, M. S., Kaye, D. M., Jennings, G. L., Vaz, M., Hastings, J. A., Esler, M. D.
(2000). Phenotypic Evidence of Faulty Neuronal Norepinephrine Reuptake in Essential Hypertension. Hypertension
36: 824-829
[Abstract][Full Text]
Bauman, A. L., Apparsundaram, S., Ramamoorthy, S., Wadzinski, B. E., Vaughan, R. A., Blakely, R. D.
(2000). Cocaine and Antidepressant-Sensitive Biogenic Amine Transporters Exist in Regulated Complexes with Protein Phosphatase 2A. J. Neurosci.
20: 7571-7578
[Abstract][Full Text]
Jacob, G., Costa, F., Shannon, J. R., Robertson, R. M., Wathen, M., Stein, M., Biaggioni, I., Ertl, A., Black, B., Robertson, D.
(2000). The Neuropathic Postural Tachycardia Syndrome. NEJM
343: 1008-1014
[Abstract][Full Text]
Kim, C.-H., Ardayfio, P., Kim, K.-S.
(2001). An E-box Motif Residing in the Exon/Intron 1 Junction Regulates Both Transcriptional Activation and Splicing of the Human Norepinephrine Transporter Gene. J. Biol. Chem.
276: 24797-24805
[Abstract][Full Text]
Holschneider, D. P., Scremin, O. U., Roos, K. P., Chialvo, D. R., Chen, K., Shih, J. C.
(2002). Increased baroreceptor response in mice deficient in monoamine oxidase A and B. Am. J. Physiol. Heart Circ. Physiol.
282: H964-H972
[Abstract][Full Text]