FREE NEJM E-TOC    HOME   |   SUBSCRIBE   |   CURRENT ISSUE   |   PAST ISSUES   |   COLLECTIONS   |   Search Term  Advanced Search

Sign in | Get NEJM's E-Mail Table of Contents — Free | Subscribe

A correction has been published: N Engl J Med 2001;344(9):686.

Volume 343:1350-1354 November 9, 2000 Number 19 Next

Abstract PDF Editorial by Weinstein, J. N. Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited Related Article Related Article by Buckner, J. C. PubMed Citation

ABSTRACT

Background The DNA-repair enzyme O ⁶-methylguanine-DNA methyltransferase (MGMT) inhibits the killing of tumor cells by alkylating agents. MGMT activity is controlled by a promoter; methylation of the promoter silences the gene in cancer, and the cells no longer produce MGMT. We examined gliomas to determine whether methylation of the MGMT promoter is related to the responsiveness of the tumor to alkylating agents.

Methods We analyzed the MGMT promoter in tumor DNA by a methylation-specific polymerase-chain-reaction assay. The gliomas were obtained from patients who had been treated with carmustine (1,3-bis(2-chloroethyl)-1-nitrosourea, or BCNU). The molecular data were correlated with the clinical outcome.

Results The MGMT promoter was methylated in gliomas from 19 of 47 patients (40 percent). This finding was associated with regression of the tumor and prolonged overall and disease-free survival. It was an independent and stronger prognostic factor than age, stage, tumor grade, or performance status.

Conclusions Methylation of the MGMT promoter in gliomas is a useful predictor of the responsiveness of the tumors to alkylating agents.

The level of MGMT varies widely according to the type of tumor, and even varies among tumors of the same type. For example, approximately 30 percent of gliomas lack MGMT.^5,6 This deficiency of the enzyme may increase the sensitivity of brain tumors to alkylating agents.^7,8,9 Because the MGMT gene is not commonly mutated or deleted, a lack of MGMT may be caused by changes that do not alter the genetic information of the cell. Methylation of DNA is the main type of such epigenetic modifications in humans,¹⁰ and it plays an important part in tumorigenesis. In particular, methylation of normally unmethylated sites, known as CpG (cytidine phosphate guanosine) islands, in the promoter regions of tumor-suppressor and DNA-repair genes is correlated with loss of expression of these genes in cancer cell lines and primary tumors.¹⁰ Methylation of the CpG island in the MGMT gene prevents transcription of the gene, and in cell lines that cannot repair alkylation of O ⁶-methylguanine, the promoter of MGMT is methylated.^11,12,13,14 Furthermore, in vitro treatment with demethylating drugs restores the expression of the MGMT gene in such cells (Figure 1).^11,15

View larger version (96K): [in this window] [in a new window]   Figure 1. Mechanism of Enhanced Chemosensitivity Resulting from Epigenetic Inactivation of the DNA Repair-Gene MGMT. Gliomas with a methylated MGMT promoter and exon 1 region (circles) have transcriptional silencing of MGMT, leading to the loss of MGMT protein. DNA adducts produced by carmustine in these tumors are not efficiently removed, leading to tumor-cell death and drug toxicity. In contrast, gliomas with an unmethylated MGMT promoter and exon 1 region express MGMT protein, which removes guanine adducts from the DNA produced by the administration of carmustine (BCNU), resulting in resistance to the tumorocidal and toxic effects drug.

 
We performed a study to determine whether methylation of the promoter region of the MGMT gene could be used to identify gliomas that were responsive to alkylating drugs.

Methods

Patients and Tumor Specimens

We studied specimens of brain tumors from 47 consecutive patients referred to the University Hospital of Navarre, in Pamplona, Spain, between April 1993 and November 1998. All the patients provided written informed consent. All had histologically verified tumors: 18 had an anaplastic astrocytoma, and 29 had a glioblastoma multiforme. Patients were 38 to 70 years old (median age at diagnosis, 55 years); 30 were men, and 17 were women. Tumor specimens were obtained by resection or biopsy performed before the initiation of treatment with radiation and chemotherapy and were immediately frozen and stored at –80°C. All patients were treated with intraarterial cisplatin (50 mg per square meter of body-surface area), whole-brain radiotherapy, and a median of three courses of intravenous carmustine (1,3-bis(2-chloroethyl)-1-nitrosourea, or BCNU; 100 mg per square meter) given at four-week intervals. Fifteen of the patients also underwent autologous bone marrow transplantation plus high-dose chemotherapy treatment with three doses of intravenous carmustine (300 mg per square meter) per day and one dose of intraarterial cisplatin (100 mg).

The response to treatment was evaluated after the patients had completed therapy. A complete response was defined as the absence of any evidence of the tumor on computed tomographic (CT) and magnetic resonance imaging (MRI) scans, with no need for steroid treatment and an improvement in the patient's general condition. Patients with persistent CT abnormalities but with more than a 50 percent reduction in both the diameter and the volume of the tumor, a reduced need for steroid treatment, and a stabilized neurologic condition were considered to have a partial response. The disease was considered to have progressed if both the diameter and volume of the tumor increased by 25 percent or more of the initial measurements, if a new lesion was evident on CT or MRI scans, or if the patient's neurologic condition worsened and required an increased dose of steroids.

Analysis of Methylation

DNA was extracted according to standard protocols. Methylation patterns in the CpG island of MGMT were determined by chemical modification of unmethylated, but not methylated, cytosines to uracil. Methylation-specific polymerase chain reaction (PCR) was performed with primers specific for either methylated or the modified unmethylated DNA, as previously described.^13,16 DNA (1 µg) was denatured with sodium hydroxide and modified with sodium bisulfite. DNA samples were then purified with the Wizard DNA purification resin (Promega, Madison, Wis.), again treated with sodium hydroxide, precipitated with ethanol, and resuspended in water. Primer sequences for the unmethylated reaction were 5'TTTGTGTTTTGATGTTTGTAGGTTTTTGT3' (forward primer) and 5'AACTCCACACTCTTCCAAAAACAAAACA3' (reverse primer), and for the methylated reaction they were 5'TTTCGACGTTCGTAGGTTTTCGC3' (forward primer) and 5'GCACTCTTCCGAAAACGAAACG3' (reverse primer). The annealing temperature was 59°C. Placental DNA treated in vitro with Sss I methyltransferase (New England Biolabs, Beverly, Mass.) was used as a positive control for methylated alleles of MGMT, and DNA from normal lymphocytes was used as a negative control. Controls without DNA were used for each set of methylation-specific PCR assays. Ten microliters of each 50-µl methylation-specific PCR product was loaded directly onto nondenaturing 6 percent polyacrylamide gels, stained with ethidium bromide, and examined under ultraviolet illumination.

Statistical Analysis

Continuous variables were compared with the use of Student's t-test. Contingency tables were analyzed by Fisher's exact test. Disease-free and overall survival curves were estimated by the Kaplan–Meier method and were compared with the use of the log-rank test. Multivariate survival analyses were performed with the Cox proportional-hazards model, and proportional-hazards assumptions were checked with the use of Schoenfeld residuals and graphic methods. Descriptive or stratified analyses always preceded parametric modeling in order to confirm that the assumptions underlying the models were met. The results are reported as two-sided P values with 95 percent confidence intervals. Analyses were performed with the use of JMP software (version 3.1, SAS Institute, Cary, N.C.) and Stata software (version 6.0, Stata, College Station, Tex.).

Results

We analyzed 47 newly diagnosed grade III or IV gliomas (classified as anaplastic astrocytoma in 18 patients and as glioblastoma multiforme in 29). The characteristics of the patients are shown in Table 1. Methylation of the MGMT promoter was found in 19 of the 47 tumors (40 percent) (Figure 2), a frequency similar to that found in our previous study¹³ and consistent with that in other reports.^5,6 Methylation was not associated with the patient's age, the Karnofsky score for performance status, or the grade of the tumor (P>0.3 for each comparison).

View this table: [in this window] [in a new window]   Table 1. Characteristics of Patients with Gliomas, According to the Methylation Status of the MGMT Promoter.

 

View larger version (34K): [in this window] [in a new window]   Figure 2. Methylation Status of the MGMT Promoter in Six Glioma Samples. A methylation-specific PCR assay was used, with the SW48 cancer cell line as a positive control for methylation, normal lymphocytes (NL) as a negative control for methylation, and water as a negative PCR control. PBR322/Msp digest was used as the molecular-weight marker. U denotes the presence of unmethylated genes, and M the presence of methylated genes. Three glioma samples (2, 4, and 6) show methylation, and three samples (1, 3, and 5) are unmethylated.

 
In univariate analyses, methylation of the promoter was positively correlated with the clinical response and with overall and disease-free survival. Twelve of the 19 patients with methylated tumors (63 percent) had a partial or complete response to carmustine, as compared with 1 of the 28 patients with unmethylated tumors (4 percent, P<0.001) (Table 2). The lack of methylation was associated with a much higher risk of death (hazard ratio, 9.5; 95 percent confidence interval, 3.0 to 42.7; P<0.001) (Figure 3A). In univariate analysis, no other factor had a statistically significant relation with survival. The median time to the progression of disease was 21 months for methylated gliomas and 8 months for unmethylated gliomas (P<0.001), and the hazard ratio associated with nonmethylation was 10.8 (95 percent confidence interval, 4.4 to 30.8) (Figure 3B). The small number of deaths among patients with gliomas containing a methylated promoter (four deaths) made multivariate analyses unreliable. The hazard ratio associated with a nonmethylated glioma was either unchanged or increased when other predictors were added individually to the model.

View this table: [in this window] [in a new window]   Table 2. Clinical Response According to the Methylation Status of the MGMT Promoter.

 

View larger version (11K): [in this window] [in a new window]   Figure 3. Overall Survival (Panel A) and Time to the Progression of Disease (Panel B) among Patients with Gliomas Treated with Carmustine, According to the Methylation Status of the MGMT Promoter. Both overall survival and the time to the progression of disease were significantly greater in the group of patients with methylation of the MGMT promoter than in the group without methylation. The association was independent of the type of tumor, the patient's age, and the Karnofsky score for performance status.

 
Discussion

The DNA-repair enzyme MGMT is a key factor in resistance to alkylating agents, because the transfer of alkyl groups to MGMT prevents the formation of lethal cross-links in DNA.^3,4 It has been reported that lack of MGMT in gliomas from patients who were treated with chloroethylnitrosoureas had only a moderate effect on overall survival, and the time to progression of disease was affected minimally or not at all.^7,8,9 Using a different method to evaluate the status of the MGMT gene, we found a much stronger influence of the presence or absence of the enzyme. The accumulation of normal cells in the tumor, including infiltrating lymphocytes, may complicate accurate assessment of MGMT. The mixture of normal cells may explain, in part, the difference between the biochemical activity measured in tumor homogenates⁹ and the results of direct immunohistochemical examination of MGMT in tumor cells.^7,8 The use of methylation-specific PCR permits an assessment of methylation of the MGMT promoter. Methylation status is an indicator of the transcriptional activity of the gene in glioma cells, and thus the presence or absence of the DNA-repair enzyme.

In our study, methylation of the MGMT promoter was associated with responsiveness to carmustine and an increase in overall survival and the time to progression of disease. Moreover, the methylation status of the promoter was more predictive of the outcome of carmustine treatment than the grade of the tumor, the Karnofsky performance status, or the patient's age. If further study confirms that methylation of the MGMT promoter predicts responsiveness to carmustine, the use of this alkylating agent might be reserved for patients with gliomas in which the promoter is methylated. Moreover, it might be possible to increase the sensitivity of resistant tumors (those without methylation) with the use of agents that inhibit the MGMT enzyme. One such inhibitor, O ⁶-benzylguanine,^17,18 is being investigated for this purpose. It is a substrate for MGMT that inactivates the enzyme. O ⁶-benzylguanine has been shown to enhance the response to alkyl nitrosoureas in vitro and in vivo.^17,19 The use of such an agent to increase the sensitivity of gliomas to carmustine only in cases of resistant tumors might prevent the toxic effects of the combination of these drugs on normal tissues in patients who are already sensitive to carmustine.

Dr. Esteller is the recipient of an award from the Spanish Ministry of Education and Culture.

Source Information

From the Divisions of Cancer Biology (M.E., S.B.B., J.G.H.) and Biostatistics (S.N.G.), Johns Hopkins Oncology Center, Baltimore; and the Biotechnology Laboratory, Cell Therapy Area, Department of Oncology, Clinica Universitaria, Pamplona, Spain (J.G.-F., E.A., O.F.H., V.V.).

Address reprint requests to Dr. Herman at the Johns Hopkins Oncology Center, 1650 Orleans, Baltimore, MD 21231, or at hermanji{at}jhmi.edu.

References

1. Teicher BA. Antitumor alkylating agents. In: DeVita VT Jr, Hellman S, Rosenberg SA, eds. Cancer: principles and practice of oncology. 5th ed. Vol. 1. Philadelphia: Lippincott-Raven, 1997:405-18. 
2. Colvin M, Hilton J. Pharmacology of cyclophosphamide and metabolites. Cancer Treat Rep 1981;65:Suppl 3:89-95.
3. Ludlum DB. DNA alkylation by the haloethylnitrosoureas: nature of modifications produced and their enzymatic repair or removal. Mutat Res 1990;233:117-126. [CrossRef][Medline]
4. Pegg AE, Dolan ME, Moschel RC. Structure, function, and inhibition of O6-alkylguanine-DNA alkyltransferase. Prog Nucleic Acid Res Mol Biol 1995;51:167-223. [Medline]
5. Silber JR, Mueller BA, Ewers TG, Berger MS. Comparison of O6-methylguanine-DNA methyltransferase activity in brain tumors and adjacent normal brain. Cancer Res 1993;53:3416-3420. [Free Full Text]
6. Silber JR, Bobola MS, Ghatan S, Blank A, Kolstoe DD, Berger MS. O6-methylguanine-DNA methyltransferase activity in adult gliomas: relation to patient and tumor characteristics. Cancer Res 1998;58:1068-1073. [Free Full Text]
7. Belanich M, Pastor M, Randall T, et al. Retrospective study of the correlation between the DNA repair protein alkyltransferase and survival of brain tumor patients treated with carmustine. Cancer Res 1996;56:783-788. [Free Full Text]
8. Jaeckle KA, Eyre HJ, Townsend JJ, et al. Correlation of tumor O6 methylguanine-DNA methyltransferase levels with survival of malignant astrocytoma patients treated with bis-chloroethylnitrosourea: a Southwest Oncology Group study. J Clin Oncol 1998;16:3310-3315. [Abstract]
9. Silber JR, Blank A, Bobola MS, Ghatan S, Kolstoe DD, Berger MS. O6-methylguanine-DNA methyltransferase-deficient phenotype in human gliomas: frequency and time to tumor progression after alkylating agent-based chemotherapy. Clin Cancer Res 1999;5:807-814. [Free Full Text]
10. Baylin SB, Herman JG. DNA hypermethylation in tumorigenesis: epigenetics joins genetics. Trends Genet 2000;16:168-174. [CrossRef][Medline]
11. Qian XC, Brent TP. Methylation hot spots in the 5' flanking region denote silencing of the O6-methylguanine-DNA methyltransferase gene. Cancer Res 1997;57:3672-3677. [Free Full Text]
12. Watts GS, Pieper RO, Costello JF, Peng YM, Dalton WS, Futscher BW. Methylation of discrete regions of the O6-methylguanine DNA methyltransferase (MGMT) CpG island is associated with heterochromatinization of the MGMT transcription start site and silencing of the gene. Mol Cell Biol 1997;17:5612-5619. [Abstract]
13. Esteller M, Hamilton SR, Burger PC, Baylin SB, Herman JG. Inactivation of the DNA repair gene O6-methylguanine-DNA methyltransferase by promoter hypermethylation is a common event in primary human neoplasia. Cancer Res 1999;59:793-797. [Free Full Text]
14. Danam RP, Qian XC, Howell SR, Brent TP. Methylation of selected CpGs in the human O6-methylguanine-DNA methyltransferase promoter region as a marker of gene silencing. Mol Carcinog 1999;24:85-89. [CrossRef][Medline]
15. Esteller M, Toyota M, Sanchez-Cespedes M, et al. Inactivation of the DNA repair gene O6-methylguanine-DNA methyltransferase by promoter hypermethylation is associated with G to A mutations in K-ras in colorectal tumorigenesis. Cancer Res 2000;60:2368-2371. [Free Full Text]
16. Herman JG, Graff JR, Myohanen S, Nelkin BD, Baylin SB. Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands. Proc Natl Acad Sci U S A 1996;93:9821-9826. [Free Full Text]
17. Dolan ME, Pegg AE. O6-benzylguanine and its role in chemotherapy. Clin Cancer Res 1997;3:837-847. [Abstract]
18. Friedman HS, Kokkinakis DM, Pluda J, et al. Phase I trial of O6-benzylguanine for patients undergoing surgery for malignant glioma. J Clin Oncol 1998;16:3570-3575. [Abstract]
19. Dolan ME, Moschel RC, Pegg AE. Depletion of mammalian O6-alkylguanine-DNA alkyltransferase activity by O6-benzylguanine provides a means to evaluate the role of this protein in protection against carcinogenic and therapeutic alkylating agents. Proc Natl Acad Sci U S A 1990;87:5368-5372. [Free Full Text]

Abstract PDF Editorial by Weinstein, J. N. Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited Related Article Related Article by Buckner, J. C. PubMed Citation

This article has been cited by other articles:

• Spiegl-Kreinecker, S., Pirker, C., Filipits, M., Lotsch, D., Buchroithner, J., Pichler, J., Silye, R., Weis, S., Micksche, M., Fischer, J., Berger, W. (2009). O6-Methylguanine DNA methyltransferase protein expression in tumor cells predicts outcome of temozolomide therapy in glioblastoma patients. Neuro Oncology 0: nop003v1-nop003 [Abstract] [Full Text]  
• Candiloro, I. L.M., Dobrovic, A. (2009). Detection of MGMT Promoter Methylation in Normal Individuals Is Strongly Associated with the T Allele of the rs16906252 MGMT Promoter Single Nucleotide Polymorphism. Cancer Prevention Research 2: 862-867 [Abstract] [Full Text]  
• Sanson, M., Marie, Y., Paris, S., Idbaih, A., Laffaire, J., Ducray, F., El Hallani, S., Boisselier, B., Mokhtari, K., Hoang-Xuan, K., Delattre, J.-Y. (2009). Isocitrate Dehydrogenase 1 Codon 132 Mutation Is an Important Prognostic Biomarker in Gliomas. JCO 27: 4150-4154 [Abstract] [Full Text]  
• Elias, A., Siegelin, M. D., Steinmuller, A., von Deimling, A., Lass, U., Korn, B., Mueller, W. (2009). Epigenetic Silencing of Death Receptor 4 Mediates Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand Resistance in Gliomas. Clin. Cancer Res. 15: 5457-5465 [Abstract] [Full Text]  
• Hegi, M. E., Sciuscio, D., Murat, A., Levivier, M., Stupp, R. (2009). Epigenetic Deregulation of DNA Repair and Its Potential for Therapy. Clin. Cancer Res. 15: 5026-5031 [Abstract] [Full Text]  
• Bailey, V. J., Easwaran, H., Zhang, Y., Griffiths, E., Belinsky, S. A., Herman, J. G., Baylin, S. B., Carraway, H. E., Wang, T.-H. (2009). MS-qFRET: A quantum dot-based method for analysis of DNA methylation. Genome Res 19: 1455-1461 [Abstract] [Full Text]  
• Yip, S., Miao, J., Cahill, D. P., Iafrate, A. J., Aldape, K., Nutt, C. L., Louis, D. N. (2009). MSH6 Mutations Arise in Glioblastomas during Temozolomide Therapy and Mediate Temozolomide Resistance. Clin. Cancer Res. 15: 4622-4629 [Abstract] [Full Text]  
• MELLAI, M., CALDERA, V., ANNOVAZZI, L., CHIO, A., LANOTTE, M., CASSONI, P., FINOCCHIARO, G., SCHIFFER, D. (2009). MGMT Promoter Hypermethylation in a Series of 104 Glioblastomas. Cancer Genomics Proteomics 6: 219-227 [Abstract] [Full Text]  
• McCabe, M. T., Brandes, J. C., Vertino, P. M. (2009). Cancer DNA Methylation: Molecular Mechanisms and Clinical Implications. Clin. Cancer Res. 15: 3927-3937 [Abstract] [Full Text]  
• Cui, B., Johnson, S. P., Bullock, N., Ali-Osman, F., Bigner, D. D., Friedman, H. S. (2009). Bifunctional DNA Alkylator 1,3-Bis(2-chloroethyl)-1-nitrosourea Activates the ATR-Chk1 Pathway Independently of the Mismatch Repair Pathway. Mol. Pharmacol. 75: 1356-1363 [Abstract] [Full Text]  
• Hervouet, E., Debien, E., Campion, L., Charbord, J., Menanteau, J., Vallette, F. M., Cartron, P.-F. (2009). Folate Supplementation Limits the Aggressiveness of Glioma via the Remethylation of DNA Repeats Element and Genes Governing Apoptosis and Proliferation. Clin. Cancer Res. 15: 3519-3529 [Abstract] [Full Text]  
• Seligson, D. B., Horvath, S., McBrian, M. A., Mah, V., Yu, H., Tze, S., Wang, Q., Chia, D., Goodglick, L., Kurdistani, S. K. (2009). Global Levels of Histone Modifications Predict Prognosis in Different Cancers. Am. J. Pathol. 174: 1619-1628 [Abstract] [Full Text]  
• Quinn, J. A., Jiang, S. X., Reardon, D. A., Desjardins, A., Vredenburgh, J. J., Rich, J. N., Gururangan, S., Friedman, A. H., Bigner, D. D., Sampson, J. H., McLendon, R. E., Herndon, J. E. II, Walker, A., Friedman, H. S. (2009). Phase II Trial of Temozolomide Plus O6-Benzylguanine in Adults With Recurrent, Temozolomide-Resistant Malignant Glioma. JCO 27: 1262-1267 [Abstract] [Full Text]  
• Quinn, J. A., Jiang, S. X., Carter, J., Reardon, D. A., Desjardins, A., Vredenburgh, J. J., Rich, J. N., Gururangan, S., Friedman, A. H., Bigner, D. D., Sampson, J. H., McLendon, R. E., Herndon, J. E. II, Threatt, S., Friedman, H. S. (2009). Phase II Trial of Gliadel plus O6-Benzylguanine in Adults with Recurrent Glioblastoma Multiforme. Clin. Cancer Res. 15: 1064-1068 [Abstract] [Full Text]  
• Wick, W., Platten, M., Weller, M. (2009). New (alternative) temozolomide regimens for the treatment of glioma. Neuro Oncol Duke 11: 69-79 [Abstract] [Full Text]  
• Vredenburgh, J. J., Desjardins, A., Reardon, D. A., Friedman, H. S. (2009). Experience with irinotecan for the treatment of malignant glioma. Neuro Oncol Duke 11: 80-91 [Abstract] [Full Text]  
• Kitange, G. J., Carlson, B. L., Schroeder, M. A., Grogan, P. T., Lamont, J. D., Decker, P. A., Wu, W., James, C. D., Sarkaria, J. N. (2009). Induction of MGMT expression is associated with temozolomide resistance in glioblastoma xenografts. Neuro Oncol Duke 11: 281-291 [Abstract] [Full Text]  
• Everhard, S., Tost, J., El Abdalaoui, H., Criniere, E., Busato, F., Marie, Y., Gut, I. G., Sanson, M., Mokhtari, K., Laigle-Donadey, F., Hoang-Xuan, K., Delattre, J.-Y., Thillet, J. (2009). Identification of regions correlating MGMT promoter methylation and gene expression in glioblastomas. Neuro Oncol Duke 11: 348-356 [Abstract] [Full Text]  
• Schaich, M., Kestel, L., Pfirrmann, M., Robel, K., Illmer, T., Kramer, M., Dill, C., Ehninger, G., Schackert, G., Krex, D. (2009). A MDR1 (ABCB1) gene single nucleotide polymorphism predicts outcome of temozolomide treatment in glioblastoma patients. Ann Oncol 20: 175-181 [Abstract] [Full Text]  
• Hartmann, O., Spyratos, F., Harbeck, N., Dietrich, D., Fassbender, A., Schmitt, M., Eppenberger-Castori, S., Vuaroqueaux, V., Lerebours, F., Welzel, K., Maier, S., Plum, A., Niemann, S., Foekens, J. A., Lesche, R., Martens, J. W.M. (2009). DNA Methylation Markers Predict Outcome in Node-Positive, Estrogen Receptor-Positive Breast Cancer with Adjuvant Anthracycline-Based Chemotherapy. Clin. Cancer Res. 15: 315-323 [Abstract] [Full Text]  
• Brown, P. D., Krishnan, S., Sarkaria, J. N., Wu, W., Jaeckle, K. A., Uhm, J. H., Geoffroy, F. J., Arusell, R., Kitange, G., Jenkins, R. B., Kugler, J. W., Morton, R. F., Rowland, K. M. Jr, Mischel, P., Yong, W. H., Scheithauer, B. W., Schiff, D., Giannini, C., Buckner, J. C. (2008). Phase I/II Trial of Erlotinib and Temozolomide With Radiation Therapy in the Treatment of Newly Diagnosed Glioblastoma Multiforme: North Central Cancer Treatment Group Study N0177. JCO 26: 5603-5609 [Abstract] [Full Text]  
• Duffy, M. J., Crown, J. (2008). A Personalized Approach to Cancer Treatment: How Biomarkers Can Help. Clin. Chem. 54: 1770-1779 [Abstract] [Full Text]  
• Hegi, M. E., Liu, L., Herman, J. G., Stupp, R., Wick, W., Weller, M., Mehta, M. P., Gilbert, M. R. (2008). Correlation of O6-Methylguanine Methyltransferase (MGMT) Promoter Methylation With Clinical Outcomes in Glioblastoma and Clinical Strategies to Modulate MGMT Activity. JCO 26: 4189-4199 [Abstract] [Full Text]  
• Mason, W. P., Cairncross, J. G. (2008). Invited Article: The expanding impact of molecular biology on the diagnosis and treatment of gliomas. Neurology 71: 365-373 [Abstract] [Full Text]  
• Yamauchi, T., Ogawa, M., Ueda, T. (2008). Carmustine-Resistant Cancer Cells Are Sensitized to Temozolomide As A Result of Enhanced Mismatch Repair during the Development of Carmustine Resistance. Mol. Pharmacol. 74: 82-91 [Abstract] [Full Text]  
• Vlassenbroeck, I., Califice, S., Diserens, A.-C., Migliavacca, E., Straub, J., Di Stefano, I., Moreau, F., Hamou, M.-F., Renard, I., Delorenzi, M., Flamion, B., DiGuiseppi, J., Bierau, K., Hegi, M. E. (2008). Validation of Real-Time Methylation-Specific PCR to Determine O6-Methylguanine-DNA Methyltransferase Gene Promoter Methylation in Glioma. J. Mol. Diagn. 10: 332-337 [Abstract] [Full Text]  
• Sarkaria, J. N., Kitange, G. J., James, C. D., Plummer, R., Calvert, H., Weller, M., Wick, W. (2008). Mechanisms of Chemoresistance to Alkylating Agents in Malignant Glioma. Clin. Cancer Res. 14: 2900-2908 [Abstract] [Full Text]  
• Hadnagy, A., Beaulieu, R., Balicki, D. (2008). Histone tail modifications and noncanonical functions of histones: perspectives in cancer epigenetics. Molecular Cancer Therapeutics 7: 740-748 [Abstract] [Full Text]  
• Brock, M. V., Hooker, C. M., Ota-Machida, E., Han, Y., Guo, M., Ames, S., Glockner, S., Piantadosi, S., Gabrielson, E., Pridham, G., Pelosky, K., Belinsky, S. A., Yang, S. C., Baylin, S. B., Herman, J. G. (2008). DNA Methylation Markers and Early Recurrence in Stage I Lung Cancer. NEJM 358: 1118-1128 [Abstract] [Full Text]  
• Esteller, M. (2008). Epigenetics in Cancer. NEJM 358: 1148-1159 [Full Text]  
• de Bont, J. M., Packer, R. J., Michiels, E. M., Boer, M. L. d., Pieters, R. (2008). Biological background of pediatric medulloblastoma and ependymoma: A review from a translational research perspective. Neuro Oncol Duke 10: 1040-1060 [Abstract] [Full Text]  
• Nagane, M., Kobayashi, K., Ohnishi, A., Shimizu, S., Shiokawa, Y. (2007). Prognostic Significance of O6-Methylguanine-DNA Methyltransferase Protein Expression in Patients with Recurrent Glioblastoma Treated with Temozolomide. Jpn J Clin Oncol 0: hym132v1-10 [Abstract] [Full Text]  
• Shen, L., Kondo, Y., Ahmed, S., Boumber, Y., Konishi, K., Guo, Y., Chen, X., Vilaythong, J. N., Issa, J.-P. J. (2007). Drug Sensitivity Prediction by CpG Island Methylation Profile in the NCI-60 Cancer Cell Line Panel. Cancer Res. 67: 11335-11343 [Abstract] [Full Text]  
• Horton, T. M., Thompson, P. A., Berg, S. L., Adamson, P. C., Ingle, A. M., Dolan, M. E., Delaney, S. M., Hedge, M., Weiss, H. L., Wu, M.-F., Blaney, S. M. (2007). Phase I Pharmacokinetic and Pharmacodynamic Study of Temozolomide in Pediatric Patients With Refractory or Recurrent Leukemia: A Children's Oncology Group Study. JCO 25: 4922-4928 [Abstract] [Full Text]  
• Kholod, N., Boniver, J., Delvenne, P. (2007). A New Dimethyl Sulfoxide-Based Method for Gene Promoter Methylation Detection. J. Mol. Diagn. 9: 574-581 [Abstract] [Full Text]  
• Fontijn, D., Adema, A. D., Bhakat, K. K., Pinedo, H. M., Peters, G. J., Boven, E. (2007). O6-Methylguanine-DNA-methyltransferase promoter demethylation is involved in basic fibroblast growth factor induced resistance against temozolomide in human melanoma cells. Molecular Cancer Therapeutics 6: 2807-2815 [Abstract] [Full Text]  
• Krex, D., Klink, B., Hartmann, C., von Deimling, A., Pietsch, T., Simon, M., Sabel, M., Steinbach, J. P., Heese, O., Reifenberger, G., Weller, M., Schackert, G., for the German Glioma Network, (2007). Long-term survival with glioblastoma multiforme. Brain 130: 2596-2606 [Abstract] [Full Text]  
• Lavon, I., Fuchs, D., Zrihan, D., Efroni, G., Zelikovitch, B., Fellig, Y., Siegal, T. (2007). Novel Mechanism whereby Nuclear Factor {kappa}B Mediates DNA Damage Repair through Regulation of O6-Methylguanine-DNA-Methyltransferase. Cancer Res. 67: 8952-8959 [Abstract] [Full Text]  
• Stupp, R., Hegi, M. E., Gilbert, M. R., Chakravarti, A. (2007). Chemoradiotherapy in Malignant Glioma: Standard of Care and Future Directions. JCO 25: 4127-4136 [Abstract] [Full Text]  
• Lonning, P., Knappskog, S, Staalesen, V, Chrisanthar, R, Lillehaug, J. (2007). Breast cancer prognostication and prediction in the postgenomic era. Ann Oncol 18: 1293-1306 [Abstract] [Full Text]  
• Mikeska, T., Bock, C., El-Maarri, O., Hubner, A., Ehrentraut, D., Schramm, J., Felsberg, J., Kahl, P., Buttner, R., Pietsch, T., Waha, A. (2007). Optimization of Quantitative MGMT Promoter Methylation Analysis Using Pyrosequencing and Combined Bisulfite Restriction Analysis. J. Mol. Diagn. 9: 368-381 [Abstract] [Full Text]  
• Ranson, M., Hersey, P., Thompson, D., Beith, J., McArthur, G. A., Haydon, A., Davis, I. D., Kefford, R. F., Mortimer, P., Harris, P. A., Baka, S., Seebaran, A., Sabharwal, A., Watson, A. J., Margison, G. P., Middleton, M. R. (2007). Randomized Trial of the Combination of Lomeguatrib and Temozolomide Compared With Temozolomide Alone in Chemotherapy Naive Patients With Metastatic Cutaneous Melanoma. JCO 25: 2540-2545 [Abstract] [Full Text]  
• Martinez, R., Setien, F., Voelter, C., Casado, S., Quesada, M. P., Schackert, G., Esteller, M. (2007). CpG island promoter hypermethylation of the pro-apoptotic gene caspase-8 is a common hallmark of relapsed glioblastoma multiforme. Carcinogenesis 28: 1264-1268 [Abstract] [Full Text]  
• Eoli, M., Menghi, F., Bruzzone, M. G., De Simone, T., Valletta, L., Pollo, B., Bissola, L., Silvani, A., Bianchessi, D., D'Incerti, L., Filippini, G., Broggi, G., Boiardi, A., Finocchiaro, G. (2007). Methylation of O6-Methylguanine DNA Methyltransferase and Loss of Heterozygosity on 19q and/or 17p Are Overlapping Features of Secondary Glioblastomas with Prolonged Survival. Clin. Cancer Res. 13: 2606-2613 [Abstract] [Full Text]  
• Stupp, R., Hegi, M. E. (2007). Methylguanine Methyltransferase Testing in Glioblastoma: When and How?. JCO 25: 1459-1460 [Full Text]  
• Chinot, O. L., Barrie, M., Fuentes, S., Eudes, N., Lancelot, S., Metellus, P., Muracciole, X., Braguer, D., Ouafik, L., Martin, P.-M., Dufour, H., Figarella-Branger, D. (2007). Correlation Between O6-Methylguanine-DNA Methyltransferase and Survival in Inoperable Newly Diagnosed Glioblastoma Patients Treated With Neoadjuvant Temozolomide. JCO 25: 1470-1475 [Abstract] [Full Text]  
• Brena, R. M., Costello, J. F. (2007). Genome-epigenome interactions in cancer. Hum Mol Genet 16: R96-R105 [Abstract] [Full Text]  
• Wojdacz, T. K., Dobrovic, A. (2007). Methylation-sensitive high resolution melting (MS-HRM): a new approach for sensitive and high-throughput assessment of methylation. Nucleic Acids Res 35: e41-e41 [Abstract] [Full Text]  
• Reinhold, W. C., Reimers, M. A., Maunakea, A. K., Kim, S., Lababidi, S., Scherf, U., Shankavaram, U. T., Ziegler, M. S., Stewart, C., Kouros-Mehr, H., Cui, H., Dolginow, D., Scudiero, D. A., Pommier, Y. G., Munroe, D. J., Feinberg, A. P., Weinstein, J. N. (2007). Detailed DNA methylation profiles of the E-cadherin promoter in the NCI-60 cancer cells. Molecular Cancer Therapeutics 6: 391-403 [Abstract] [Full Text]  
• Samuels, M. A. (2007). Update in Neurology. ANN INTERN MED 146: 128-132 [Full Text]  
• Brandes, A. A., Tosoni, A., Cavallo, G., Reni, M., Franceschi, E., Bonaldi, L., Bertorelle, R., Gardiman, M., Ghimenton, C., Iuzzolino, P., Pession, A., Blatt, V., Ermani, M. (2006). Correlations Between O6-Methylguanine DNA Methyltransferase Promoter Methylation Status, 1p and 19q Deletions, and Response to Temozolomide in Anaplastic and Recurrent Oligodendroglioma: A Prospective GICNO Study. JCO 24: 4746-4753 [Abstract] [Full Text]  
• Maxwell, J. A., Johnson, S. P., Quinn, J. A., McLendon, R. E., Ali-Osman, F., Friedman, A. H., Herndon, J. E. II, Bierau, K., Bigley, J., Bigner, D. D., Friedman, H. S. (2006). Quantitative analysis of O6-alkylguanine-DNA alkyltransferase in malignant glioma.. Molecular Cancer Therapeutics 5: 2531-2539 [Abstract] [Full Text]  
• Herrlinger, U., Rieger, J., Koch, D., Loeser, S., Blaschke, B., Kortmann, R.-D., Steinbach, J. P., Hundsberger, T., Wick, W., Meyermann, R., Tan, T.-C., Sommer, C., Bamberg, M., Reifenberger, G., Weller, M. (2006). Phase II Trial of Lomustine Plus Temozolomide Chemotherapy in Addition to Radiotherapy in Newly Diagnosed Glioblastoma: UKT-03. JCO 24: 4412-4417 [Abstract] [Full Text]  
• Fruehauf, J. P., Brem, H., Brem, S., Sloan, A., Barger, G., Huang, W., Parker, R. (2006). In vitro Drug Response and Molecular Markers Associated with Drug Resistance in Malignant Gliomas. Clin. Cancer Res. 12: 4523-4532 [Abstract] [Full Text]  
• Pollack, I. F., Hamilton, R. L., Sobol, R. W., Burnham, J., Yates, A. J., Holmes, E. J., Zhou, T., Finlay, J. L. (2006). O6-Methylguanine-DNA Methyltransferase Expression Strongly Correlates With Outcome in Childhood Malignant Gliomas: Results From the CCG-945 Cohort. JCO 24: 3431-3437 [Abstract] [Full Text]  
• Foltz, G., Ryu, G.-Y., Yoon, J.-G., Nelson, T., Fahey, J., Frakes, A., Lee, H., Field, L., Zander, K., Sibenaller, Z., Ryken, T. C., Vibhakar, R., Hood, L., Madan, A. (2006). Genome-Wide Analysis of Epigenetic Silencing Identifies BEX1 and BEX2 as Candidate Tumor Suppressor Genes in Malignant Glioma.. Cancer Res. 66: 6665-6674 [Abstract] [Full Text]  
• Berger, Y., Bernasconi, C. C., Juillerat-Jeanneret, L. (2006). Targeting the endothelin axis in human melanoma: combination of endothelin receptor antagonism and alkylating agents.. Exp. Biol. Med. 231: 1111-1119 [Abstract] [Full Text]  
• Esteller, M. (2006). The necessity of a human epigenome project. Carcinogenesis 27: 1121-1125 [Abstract] [Full Text]  
• Gagnon, J.-F., Bernard, O., Villeneuve, L., Tetu, B., Guillemette, C. (2006). Irinotecan Inactivation Is Modulated by Epigenetic Silencing of UGT1A1 in Colon Cancer. Clin. Cancer Res. 12: 1850-1858 [Abstract] [Full Text]  
• Reardon, D. A., Rich, J. N., Friedman, H. S., Bigner, D. D. (2006). Recent Advances in the Treatment of Malignant Astrocytoma. JCO 24: 1253-1265 [Abstract] [Full Text]  
• Neff, T., Beard, B. C., Kiem, H.-P. (2006). Survival of the fittest: in vivo selection and stem cell gene therapy. Blood 107: 1751-1760 [Abstract] [Full Text]  
• Fox, E. J., Leahy, D. T., Geraghty, R., Mulcahy, H. E., Fennelly, D., Hyland, J. M., O'Donoghue, D. P., Sheahan, K. (2006). Mutually Exclusive Promoter Hypermethylation Patterns of hMLH1 and O6-Methylguanine DNA Methyltransferase in Colorectal Cancer. J. Mol. Diagn. 8: 68-75 [Abstract] [Full Text]  
• Stupp, R., Hegi, M. E., van den Bent, M. J., Mason, W. P., Weller, M., Mirimanoff, R. O., Cairncross, J. G., on behalf of the European Organisation for Researc, (2006). Changing paradigms--an update on the multidisciplinary management of malignant glioma.. The Oncologist 11: 165-180 [Abstract] [Full Text]  
• Bredel, M., Bredel, C., Juric, D., Duran, G. E., Yu, R. X., Harsh, G. R., Vogel, H., Recht, L. D., Scheck, A. C., Sikic, B. I. (2006). Tumor Necrosis Factor-{alpha}-Induced Protein 3 As a Putative Regulator of Nuclear Factor-{kappa}B-Mediated Resistance to O6-Alkylating Agents in Human Glioblastomas. JCO 24: 274-287 [Abstract] [Full Text]  
• Aghi, M., Rabkin, S., Martuza, R. L. (2006). Effect of Chemotherapy-Induced DNA Repair on Oncolytic Herpes Simplex Viral Replication. JNCI J Natl Cancer Inst 98: 38-50 [Abstract] [Full Text]  
• Mori, T., O'Day, S. J., Umetani, N., Martinez, S. R., Kitago, M., Koyanagi, K., Kuo, C., Takeshima, T.-L., Milford, R., Wang, H.-J., Vu, V. D., Nguyen, S. L., Hoon, D. S.B. (2005). Predictive Utility of Circulating Methylated DNA in Serum of Melanoma Patients Receiving Biochemotherapy. JCO 23: 9351-9358 [Abstract] [Full Text]  
• Hansen, R. J., Nagasubramanian, R., Delaney, S. M., Cherian, M. M., Lin, S., Kogan, S. C., Dolan, M. E. (2005). Role of O6-Alkylguanine-DNA Alkyltransferase in Protecting against 1,3-Bis(2-chloroethyl)-1-nitrosourea (BCNU)-Induced Long-Term Toxicities. J. Pharmacol. Exp. Ther. 315: 1247-1255 [Abstract] [Full Text]  
• Sadee, W., Dai, Z. (2005). Pharmacogenetics/genomics and personalized medicine. Hum Mol Genet 14: R207-R214 [Abstract] [Full Text]  
• Chan, M. W.Y., Wei, S. H., Wen, P., Wang, Z., Matei, D. E., Liu, J. C., Liyanarachchi, S., Brown, R., Nephew, K. P., Yan, P. S., Huang, T. H-M. (2005). Hypermethylation of 18S and 28S Ribosomal DNAs Predicts Progression-Free Survival in Patients with Ovarian Cancer. Clin. Cancer Res. 11: 7376-7383 [Abstract] [Full Text]  
• Quinn, J. A., Desjardins, A., Weingart, J., Brem, H., Dolan, M. E., Delaney, S. M., Vredenburgh, J., Rich, J., Friedman, A. H., Reardon, D. A., Sampson, J. H., Pegg, A. E., Moschel, R. C., Birch, R., McLendon, R. E., Provenzale, J. M., Gururangan, S., Dancey, J. E., Maxwell, J., Tourt-Uhlig, S., Herndon, J. E. II, Bigner, D. D., Friedman, H. S. (2005). Phase I Trial of Temozolomide Plus O6-Benzylguanine for Patients With Recurrent or Progressive Malignant Glioma. JCO 23: 7178-7187 [Abstract] [Full Text]  
• Natsume, A., Ishii, D., Wakabayashi, T., Tsuno, T., Hatano, H., Mizuno, M., Yoshida, J. (2005). IFN-{beta} Down-Regulates the Expression of DNA Repair Gene MGMT and Sensitizes Resistant Glioma Cells to Temozolomide. Cancer Res. 65: 7573-7579 [Abstract] [Full Text]  
• Brell, M., Tortosa, A., Verger, E., Gil, J. M., Vinolas, N., Villa, S., Acebes, J. J., Caral, L., Pujol, T., Ferrer, I., Ribalta, T., Graus, F. (2005). Prognostic Significance of O6-Methylguanine-DNA Methyltransferase Determined by Promoter Hypermethylation and Immunohistochemical Expression in Anaplastic Gliomas. Clin. Cancer Res. 11: 5167-5174 [Abstract] [Full Text]  
• Dimopoulos, M. A., Souliotis, V. L., Anagnostopoulos, A., Papadimitriou, C., Sfikakis, P. P. (2005). Extent of Damage and Repair in the p53 Tumor-Suppressor Gene After Treatment of Myeloma Patients With High-Dose Melphalan and Autologous Blood Stem-Cell Transplantation Is Individualized and May Predict Clinical Outcome. JCO 23: 4381-4389 [Abstract] [Full Text]  
• van Doorn, R., Zoutman, W. H., Dijkman, R., de Menezes, R. X., Commandeur, S., Mulder, A. A., van der Velden, P. A., Vermeer, M. H., Willemze, R., Yan, P. S., Huang, T. H., Tensen, C. P. (2005). Epigenetic Profiling of Cutaneous T-Cell Lymphoma: Promoter Hypermethylation of Multiple Tumor Suppressor Genes Including BCL7a, PTPRG, and p73. JCO 23: 3886-3896 [Abstract] [Full Text]  
• Miyamoto, K., Ushijima, T. (2005). Diagnostic and Therapeutic Applications of Epigenetics. Jpn J Clin Oncol 35: 293-301 [Abstract] [Full Text]  
• Laird, P. W. (2005). Cancer epigenetics. Hum Mol Genet 14: R65-R76 [Abstract] [Full Text]  
• Kohonen-Corish, M. R.J., Daniel, J. J., Chan, C., Lin, B. P.C., Kwun, S. Y., Dent, O. F., Dhillon, V. S., Trent, R. J.A., Chapuis, P. H., Bokey, E. L. (2005). Low Microsatellite Instability Is Associated With Poor Prognosis in Stage C Colon Cancer. JCO 23: 2318-2324 [Abstract] [Full Text]  
• Alaminos, M., Davalos, V., Ropero, S., Setien, F., Paz, M. F., Herranz, M., Fraga, M. F., Mora, J., Cheung, N.-K. V., Gerald, W. L., Esteller, M. (2005). EMP3, a Myelin-Related Gene Located in the Critical 19q13.3 Region, Is Epigenetically Silenced and Exhibits Features of a Candidate Tumor Suppressor in Glioma and Neuroblastoma. Cancer Res. 65: 2565-2571 [Abstract] [Full Text]  
• Stupp, R., Mason, W. P., van den Bent, M. J., Weller, M., Fisher, B., Taphoorn, M. J.B., Belanger, K., Brandes, A. A., Marosi, C., Bogdahn, U., Curschmann, J., Janzer, R. C., Ludwin, S. K., Gorlia, T., Allgeier, A., Lacombe, D., Cairncross, J. G., Eisenhauer, E., Mirimanoff, R. O., the European Organisation for Research and Treatme, (2005). Radiotherapy plus Concomitant and Adjuvant Temozolomide for Glioblastoma. NEJM 352: 987-996 [Abstract] [Full Text]  
• Hegi, M. E., Diserens, A.-C., Gorlia, T., Hamou, M.-F., de Tribolet, N., Weller, M., Kros, J. M., Hainfellner, J. A., Mason, W., Mariani, L., Bromberg, J. E.C., Hau, P., Mirimanoff, R. O., Cairncross, J. G., Janzer, R. C., Stupp, R. (2005). MGMT Gene Silencing and Benefit from Temozolomide in Glioblastoma. NEJM 352: 997-1003 [Abstract] [Full Text]  
• Osanai, T., Takagi, Y., Toriya, Y., Nakagawa, T., Aruga, T., Iida, S., Uetake, H., Sugihara, K. (2005). Inverse Correlation Between the Expression of O6-Methylguanine-DNA Methyl Transferase (MGMT) and p53 in Breast Cancer. Jpn J Clin Oncol 35: 121-125 [Abstract] [Full Text]  
• Fukushima, T., Katayama, Y., Watanabe, T., Yoshino, A., Ogino, A., Ohta, T., Komine, C. (2005). Promoter Hypermethylation of Mismatch Repair Gene hMLH1 Predicts the Clinical Response of Malignant Astrocytomas to Nitrosourea. Clin. Cancer Res. 11: 1539-1544 [Abstract] [Full Text]  
• Neff, T., Beard, B. C., Peterson, L. J., Anandakumar, P., Thompson, J., Kiem, H.-P. (2005). Polyclonal chemoprotection against temozolomide in a large-animal model of drug resistance gene therapy. Blood 105: 997-1002 [Abstract] [Full Text]  
• Danam, R. P., Howell, S. R., Brent, T. P., Harris, L. C. (2005). Epigenetic regulation of O6-methylguanine-DNA methyltransferase gene expression by histone acetylation and methyl-CpG binding proteins. Molecular Cancer Therapeutics 4: 61-69 [Abstract] [Full Text]  
• Liu, T. F., Hall, P. D., Cohen, K. A., Willingham, M. C., Cai, J., Thorburn, A., Frankel, A. E. (2005). Interstitial Diphtheria Toxin-Epidermal Growth Factor Fusion Protein Therapy Produces Regressions of Subcutaneous Human Glioblastoma Multiforme Tumors in Athymic Nude Mice. Clin. Cancer Res. 11: 329-334 [Abstract] [Full Text]  
• Bobola, M. S., Emond, M. J., Blank, A., Meade, E. H., Kolstoe, D. D., Berger, M. S., Rostomily, R. C., Silbergeld, D. L., Spence, A. M., Silber, J. R. (2004). Apurinic Endonuclease Activity in Adult Gliomas and Time to Tumor Progression after Alkylating Agent-Based Chemotherapy and after Radiotherapy. Clin. Cancer Res. 10: 7875-7883 [Abstract] [Full Text]  
• Das, P. M., Singal, R. (2004). DNA Methylation and Cancer. JCO 22: 4632-4642 [Abstract] [Full Text]  
• Stone, A. R., Bobo, W., Brat, D. J., Devi, N. S., Van Meir, E. G., Vertino, P. M. (2004). Aberrant Methylation and Down-Regulation of TMS1/ASC in Human Glioblastoma. Am. J. Pathol. 165: 1151-1161 [Abstract] [Full Text]  
• Paz, M. F., Yaya-Tur, R., Rojas-Marcos, I., Reynes, G., Pollan, M., Aguirre-Cruz, L., Garcia-Lopez, J. L., Piquer, J., Safont, M.-J., Balana, C., Sanchez-Cespedes, M., Garcia-Villanueva, M., Arribas, L., Esteller, M. (2004). CpG Island Hypermethylation of the DNA Repair Enzyme Methyltransferase Predicts Response to Temozolomide in Primary Gliomas. Clin. Cancer Res. 10: 4933-4938 [Abstract] [Full Text]  
• Rood, B. R., Zhang, H., Cogen, P. H. (2004). Intercellular heterogeneity of expression of the MGMT DNA repair gene in pediatric medulloblastoma. Neuro Oncol Duke 6: 200-207 [Abstract]  
• Zuo, C., Ai, L., Ratliff, P., Suen, J. Y., Hanna, E., Brent, T. P., Fan, C.-Y. (2004). O6-Methylguanine-DNA Methyltransferase Gene: Epigenetic Silencing and Prognostic Value in Head and Neck Squamous Cell Carcinoma. Cancer Epidemiol. Biomarkers Prev. 13: 967-975 [Abstract] [Full Text]  
• Pakneshan, P., Tetu, B., Rabbani, S. A. (2004). Demethylation of Urokinase Promoter as a Prognostic Marker in Patients with Breast Carcinoma. Clin. Cancer Res. 10: 3035-3041 [Abstract] [Full Text]  
• Mori, Y., Yin, J., Sato, F., Sterian, A., Simms, L. A., Selaru, F. M., Schulmann, K., Xu, Y., Olaru, A., Wang, S., Deacu, E., Abraham, J. M., Young, J., Leggett, B. A., Meltzer, S. J. (2004). Identification of Genes Uniquely Involved in Frequent Microsatellite Instability Colon Carcinogenesis by Expression Profiling Combined with Epigenetic Scanning. Cancer Res. 64: 2434-2438 [Abstract] [Full Text]