Inactivation of the DNA-Repair Gene MGMT and the Clinical Response of Gliomas to Alkylating Agents
Manel Esteller, M.D., Ph.D., Jesus Garcia-Foncillas, M.D., Ph.D., Esther Andion, B.Sc., Steven N. Goodman, M.D., Ph.D., Oscar F. Hidalgo, M.D., Vicente Vanaclocha, M.D., Stephen B. Baylin, M.D., and James G. Herman, M.D.
Background The DNA-repair enzyme O6-methylguanine-DNA methyltransferase(MGMT) inhibits the killing of tumor cells by alkylating agents.MGMT activity is controlled by a promoter; methylation of thepromoter silences the gene in cancer, and the cells no longerproduce MGMT. We examined gliomas to determine whether methylationof the MGMT promoter is related to the responsiveness of thetumor to alkylating agents.
Methods We analyzed the MGMT promoter in tumor DNA by a methylation-specificpolymerase-chain-reaction assay. The gliomas were obtained frompatients who had been treated with carmustine (1,3-bis(2-chloroethyl)-1-nitrosourea,or BCNU). The molecular data were correlated with the clinicaloutcome.
Results The MGMT promoter was methylated in gliomas from 19of 47 patients (40 percent). This finding was associated withregression of the tumor and prolonged overall and disease-freesurvival. It was an independent and stronger prognostic factorthan age, stage, tumor grade, or performance status.
Conclusions Methylation of the MGMT promoter in gliomas is auseful predictor of the responsiveness of the tumors to alkylatingagents.
Alkylating agents are highly reactive molecules that cause celldeath by binding to DNA.1,2 The most frequent site of alkylationin DNA is the O6 position of guanine. Alkylation here formscross-links between adjacent strands of DNA,1 which explainshow the nitrosoureas, tetrazines, and procarbazine kill cells.The cross-linking of double-stranded DNA by alkylating agentsis inhibited by the cellular DNA-repair protein O6-methylguanine-DNAmethyltransferase (MGMT), also known as O6-alkylguanine-DNAalkyltransferase. The MGMT protein rapidly reverses alkylationat the O6 position of guanine,3,4 thereby averting the formationof lethal cross-links. Through this mechanism, MGMT causes resistanceto alkylating drugs.3,4
The level of MGMT varies widely according to the type of tumor,and even varies among tumors of the same type. For example,approximately 30 percent of gliomas lack MGMT.5,6 This deficiencyof the enzyme may increase the sensitivity of brain tumors toalkylating agents.7,8,9 Because the MGMT gene is not commonlymutated or deleted, a lack of MGMT may be caused by changesthat do not alter the genetic information of the cell. Methylationof DNA is the main type of such epigenetic modifications inhumans,10 and it plays an important part in tumorigenesis. Inparticular, methylation of normally unmethylated sites, knownas CpG (cytidine phosphate guanosine) islands, in the promoterregions of tumor-suppressor and DNA-repair genes is correlatedwith loss of expression of these genes in cancer cell linesand primary tumors.10 Methylation of the CpG island in the MGMTgene prevents transcription of the gene, and in cell lines thatcannot repair alkylation of O6-methylguanine, the promoterof MGMT is methylated.11,12,13,14 Furthermore, in vitro treatmentwith demethylating drugs restores the expression of the MGMTgene in such cells (Figure 1).11,15
Figure 1. Mechanism of Enhanced Chemosensitivity Resulting from Epigenetic Inactivation of the DNA Repair-Gene MGMT.
Gliomas with a methylated MGMT promoter and exon 1 region (circles) have transcriptional silencing of MGMT, leading to the loss of MGMT protein. DNA adducts produced by carmustine in these tumors are not efficiently removed, leading to tumor-cell death and drug toxicity. In contrast, gliomas with an unmethylated MGMT promoter and exon 1 region express MGMT protein, which removes guanine adducts from the DNA produced by the administration of carmustine (BCNU), resulting in resistance to the tumorocidal and toxic effects drug.
We performed a study to determine whether methylation of thepromoter region of the MGMT gene could be used to identify gliomasthat were responsive to alkylating drugs.
Methods
Patients and Tumor Specimens
We studied specimens of brain tumors from 47 consecutive patientsreferred to the University Hospital of Navarre, in Pamplona,Spain, between April 1993 and November 1998. All the patientsprovided written informed consent. All had histologically verifiedtumors: 18 had an anaplastic astrocytoma, and 29 had a glioblastomamultiforme. Patients were 38 to 70 years old (median age atdiagnosis, 55 years); 30 were men, and 17 were women. Tumorspecimens were obtained by resection or biopsy performed beforethe initiation of treatment with radiation and chemotherapyand were immediately frozen and stored at 80°C. Allpatients were treated with intraarterial cisplatin (50 mg persquare meter of body-surface area), whole-brain radiotherapy,and a median of three courses of intravenous carmustine (1,3-bis(2-chloroethyl)-1-nitrosourea,or BCNU; 100 mg per square meter) given at four-week intervals.Fifteen of the patients also underwent autologous bone marrowtransplantation plus high-dose chemotherapy treatment with threedoses of intravenous carmustine (300 mg per square meter) perday and one dose of intraarterial cisplatin (100 mg).
The response to treatment was evaluated after the patients hadcompleted therapy. A complete response was defined as the absenceof any evidence of the tumor on computed tomographic (CT) andmagnetic resonance imaging (MRI) scans, with no need for steroidtreatment and an improvement in the patient's general condition.Patients with persistent CT abnormalities but with more thana 50 percent reduction in both the diameter and the volume ofthe tumor, a reduced need for steroid treatment, and a stabilizedneurologic condition were considered to have a partial response.The disease was considered to have progressed if both the diameterand volume of the tumor increased by 25 percent or more of theinitial measurements, if a new lesion was evident on CT or MRIscans, or if the patient's neurologic condition worsened andrequired an increased dose of steroids.
Analysis of Methylation
DNA was extracted according to standard protocols. Methylationpatterns in the CpG island of MGMT were determined by chemicalmodification of unmethylated, but not methylated, cytosinesto uracil. Methylation-specific polymerase chain reaction (PCR)was performed with primers specific for either methylated orthe modified unmethylated DNA, as previously described.13,16DNA (1 µg) was denatured with sodium hydroxide and modifiedwith sodium bisulfite. DNA samples were then purified with theWizard DNA purification resin (Promega, Madison, Wis.), againtreated with sodium hydroxide, precipitated with ethanol, andresuspended in water. Primer sequences for the unmethylatedreaction were 5'TTTGTGTTTTGATGTTTGTAGGTTTTTGT3' (forward primer)and 5'AACTCCACACTCTTCCAAAAACAAAACA3' (reverse primer), and forthe methylated reaction they were 5'TTTCGACGTTCGTAGGTTTTCGC3'(forward primer) and 5'GCACTCTTCCGAAAACGAAACG3' (reverse primer).The annealing temperature was 59°C. Placental DNA treatedin vitro with Sss I methyltransferase (New England Biolabs,Beverly, Mass.) was used as a positive control for methylatedalleles of MGMT, and DNA from normal lymphocytes was used asa negative control. Controls without DNA were used for eachset of methylation-specific PCR assays. Ten microliters of each50-µl methylation-specific PCR product was loaded directlyonto nondenaturing 6 percent polyacrylamide gels, stained withethidium bromide, and examined under ultraviolet illumination.
Statistical Analysis
Continuous variables were compared with the use of Student'st-test. Contingency tables were analyzed by Fisher's exact test.Disease-free and overall survival curves were estimated by theKaplanMeier method and were compared with the use ofthe log-rank test. Multivariate survival analyses were performedwith the Cox proportional-hazards model, and proportional-hazardsassumptions were checked with the use of Schoenfeld residualsand graphic methods. Descriptive or stratified analyses alwayspreceded parametric modeling in order to confirm that the assumptionsunderlying the models were met. The results are reported astwo-sided P values with 95 percent confidence intervals. Analyseswere performed with the use of JMP software (version 3.1, SASInstitute, Cary, N.C.) and Stata software (version 6.0, Stata,College Station, Tex.).
Results
We analyzed 47 newly diagnosed grade III or IV gliomas (classifiedas anaplastic astrocytoma in 18 patients and as glioblastomamultiforme in 29). The characteristics of the patients are shownin Table 1. Methylation of the MGMT promoter was found in 19of the 47 tumors (40 percent) (Figure 2), a frequency similarto that found in our previous study13 and consistent with thatin other reports.5,6 Methylation was not associated with thepatient's age, the Karnofsky score for performance status, orthe grade of the tumor (P>0.3 for each comparison).
Figure 2. Methylation Status of the MGMT Promoter in Six Glioma Samples.
A methylation-specific PCR assay was used, with the SW48 cancer cell line as a positive control for methylation, normal lymphocytes (NL) as a negative control for methylation, and water as a negative PCR control. PBR322/Msp digest was used as the molecular-weight marker. U denotes the presence of unmethylated genes, and M the presence of methylated genes. Three glioma samples (2, 4, and 6) show methylation, and three samples (1, 3, and 5) are unmethylated.
In univariate analyses, methylation of the promoter was positivelycorrelated with the clinical response and with overall and disease-freesurvival. Twelve of the 19 patients with methylated tumors (63percent) had a partial or complete response to carmustine, ascompared with 1 of the 28 patients with unmethylated tumors(4 percent, P<0.001) (Table 2). The lack of methylation wasassociated with a much higher risk of death (hazard ratio, 9.5;95 percent confidence interval, 3.0 to 42.7; P<0.001) (Figure 3A).In univariate analysis, no other factor had a statisticallysignificant relation with survival. The median time to the progressionof disease was 21 months for methylated gliomas and 8 monthsfor unmethylated gliomas (P<0.001), and the hazard ratioassociated with nonmethylation was 10.8 (95 percent confidenceinterval, 4.4 to 30.8) (Figure 3B). The small number of deathsamong patients with gliomas containing a methylated promoter(four deaths) made multivariate analyses unreliable. The hazardratio associated with a nonmethylated glioma was either unchangedor increased when other predictors were added individually tothe model.
Figure 3. Overall Survival (Panel A) and Time to the Progression of Disease (Panel B) among Patients with Gliomas Treated with Carmustine, According to the Methylation Status of the MGMT Promoter.
Both overall survival and the time to the progression of disease were significantly greater in the group of patients with methylation of the MGMT promoter than in the group without methylation. The association was independent of the type of tumor, the patient's age, and the Karnofsky score for performance status.
Discussion
The DNA-repair enzyme MGMT is a key factor in resistance toalkylating agents, because the transfer of alkyl groups to MGMTprevents the formation of lethal cross-links in DNA.3,4 It hasbeen reported that lack of MGMT in gliomas from patients whowere treated with chloroethylnitrosoureas had only a moderateeffect on overall survival, and the time to progression of diseasewas affected minimally or not at all.7,8,9 Using a differentmethod to evaluate the status of the MGMT gene, we found a muchstronger influence of the presence or absence of the enzyme.The accumulation of normal cells in the tumor, including infiltratinglymphocytes, may complicate accurate assessment of MGMT. Themixture of normal cells may explain, in part, the differencebetween the biochemical activity measured in tumor homogenates9and the results of direct immunohistochemical examination ofMGMT in tumor cells.7,8 The use of methylation-specific PCRpermits an assessment of methylation of the MGMT promoter. Methylationstatus is an indicator of the transcriptional activity of thegene in glioma cells, and thus the presence or absence of theDNA-repair enzyme.
In our study, methylation of the MGMT promoter was associatedwith responsiveness to carmustine and an increase in overallsurvival and the time to progression of disease. Moreover, themethylation status of the promoter was more predictive of theoutcome of carmustine treatment than the grade of the tumor,the Karnofsky performance status, or the patient's age. If furtherstudy confirms that methylation of the MGMT promoter predictsresponsiveness to carmustine, the use of this alkylating agentmight be reserved for patients with gliomas in which the promoteris methylated. Moreover, it might be possible to increase thesensitivity of resistant tumors (those without methylation)with the use of agents that inhibit the MGMT enzyme. One suchinhibitor, O6-benzylguanine,17,18 is being investigated forthis purpose. It is a substrate for MGMT that inactivates theenzyme. O6-benzylguanine has been shown to enhance the responseto alkyl nitrosoureas in vitro and in vivo.17,19 The use ofsuch an agent to increase the sensitivity of gliomas to carmustineonly in cases of resistant tumors might prevent the toxic effectsof the combination of these drugs on normal tissues in patientswho are already sensitive to carmustine.
Dr. Esteller is the recipient of an award from the Spanish Ministryof Education and Culture.
Source Information
From the Divisions of Cancer Biology (M.E., S.B.B., J.G.H.) and Biostatistics (S.N.G.), Johns Hopkins Oncology Center, Baltimore; and the Biotechnology Laboratory, Cell Therapy Area, Department of Oncology, Clinica Universitaria, Pamplona, Spain (J.G.-F., E.A., O.F.H., V.V.).
Address reprint requests to Dr. Herman at the Johns Hopkins Oncology Center, 1650 Orleans, Baltimore, MD 21231, or at hermanji{at}jhmi.edu.
References
Teicher BA. Antitumor alkylating agents. In: DeVita VT Jr, Hellman S, Rosenberg SA, eds. Cancer: principles and practice of oncology. 5th ed. Vol. 1. Philadelphia: Lippincott-Raven, 1997:405-18.
Colvin M, Hilton J. Pharmacology of cyclophosphamide and metabolites. Cancer Treat Rep 1981;65:Suppl 3:89-95.
Ludlum DB. DNA alkylation by the haloethylnitrosoureas: nature of modifications produced and their enzymatic repair or removal. Mutat Res 1990;233:117-126. [CrossRef][Medline]
Pegg AE, Dolan ME, Moschel RC. Structure, function, and inhibition of O6-alkylguanine-DNA alkyltransferase. Prog Nucleic Acid Res Mol Biol 1995;51:167-223. [Medline]
Silber JR, Mueller BA, Ewers TG, Berger MS. Comparison of O6-methylguanine-DNA methyltransferase activity in brain tumors and adjacent normal brain. Cancer Res 1993;53:3416-3420. [Free Full Text]
Silber JR, Bobola MS, Ghatan S, Blank A, Kolstoe DD, Berger MS. O6-methylguanine-DNA methyltransferase activity in adult gliomas: relation to patient and tumor characteristics. Cancer Res 1998;58:1068-1073. [Free Full Text]
Belanich M, Pastor M, Randall T, et al. Retrospective study of the correlation between the DNA repair protein alkyltransferase and survival of brain tumor patients treated with carmustine. Cancer Res 1996;56:783-788. [Free Full Text]
Jaeckle KA, Eyre HJ, Townsend JJ, et al. Correlation of tumor O6 methylguanine-DNA methyltransferase levels with survival of malignant astrocytoma patients treated with bis-chloroethylnitrosourea: a Southwest Oncology Group study. J Clin Oncol 1998;16:3310-3315. [Abstract]
Silber JR, Blank A, Bobola MS, Ghatan S, Kolstoe DD, Berger MS. O6-methylguanine-DNA methyltransferase-deficient phenotype in human gliomas: frequency and time to tumor progression after alkylating agent-based chemotherapy. Clin Cancer Res 1999;5:807-814. [Free Full Text]
Baylin SB, Herman JG. DNA hypermethylation in tumorigenesis: epigenetics joins genetics. Trends Genet 2000;16:168-174. [CrossRef][Medline]
Qian XC, Brent TP. Methylation hot spots in the 5' flanking region denote silencing of the O6-methylguanine-DNA methyltransferase gene. Cancer Res 1997;57:3672-3677. [Free Full Text]
Watts GS, Pieper RO, Costello JF, Peng YM, Dalton WS, Futscher BW. Methylation of discrete regions of the O6-methylguanine DNA methyltransferase (MGMT) CpG island is associated with heterochromatinization of the MGMT transcription start site and silencing of the gene. Mol Cell Biol 1997;17:5612-5619. [Free Full Text]
Esteller M, Hamilton SR, Burger PC, Baylin SB, Herman JG. Inactivation of the DNA repair gene O6-methylguanine-DNA methyltransferase by promoter hypermethylation is a common event in primary human neoplasia. Cancer Res 1999;59:793-797. [Free Full Text]
Danam RP, Qian XC, Howell SR, Brent TP. Methylation of selected CpGs in the human O6-methylguanine-DNA methyltransferase promoter region as a marker of gene silencing. Mol Carcinog 1999;24:85-89. [CrossRef][Medline]
Esteller M, Toyota M, Sanchez-Cespedes M, et al. Inactivation of the DNA repair gene O6-methylguanine-DNA methyltransferase by promoter hypermethylation is associated with G to A mutations in K-ras in colorectal tumorigenesis. Cancer Res 2000;60:2368-2371. [Free Full Text]
Herman JG, Graff JR, Myohanen S, Nelkin BD, Baylin SB. Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands. Proc Natl Acad Sci U S A 1996;93:9821-9826. [Free Full Text]
Dolan ME, Pegg AE. O6-benzylguanine and its role in chemotherapy. Clin Cancer Res 1997;3:837-847. [Abstract]
Friedman HS, Kokkinakis DM, Pluda J, et al. Phase I trial of O6-benzylguanine for patients undergoing surgery for malignant glioma. J Clin Oncol 1998;16:3570-3575. [Abstract]
Dolan ME, Moschel RC, Pegg AE. Depletion of mammalian O6-alkylguanine-DNA alkyltransferase activity by O6-benzylguanine provides a means to evaluate the role of this protein in protection against carcinogenic and therapeutic alkylating agents. Proc Natl Acad Sci U S A 1990;87:5368-5372. [Free Full Text]
Rivera, A. L., Pelloski, C. E., Gilbert, M. R., Colman, H., De La Cruz, C., Sulman, E. P., Bekele, B. N., Aldape, K. D.
(2010). MGMT promoter methylation is predictive of response to radiotherapy and prognostic in the absence of adjuvant alkylating chemotherapy for glioblastoma. Neuro Oncology
12: 116-121
[Abstract][Full Text]
Lavon, I., Refael, M., Zelikovitch, B., Shalom, E., Siegal, T.
(2010). Serum DNA can define tumor-specific genetic and epigenetic markers in gliomas of various grades. Neuro Oncology
12: 173-180
[Abstract][Full Text]
Costa, B. M., Smith, J. S., Chen, Y., Chen, J., Phillips, H. S., Aldape, K. D., Zardo, G., Nigro, J., James, C. D., Fridlyand, J., Reis, R. M., Costello, J. F.
(2010). Reversing HOXA9 Oncogene Activation by PI3K Inhibition: Epigenetic Mechanism and Prognostic Significance in Human Glioblastoma. Cancer Res.
70: 453-462
[Abstract][Full Text]
Hashizume, R., Gupta, N., Berger, M. S., Banerjee, A., Prados, M. D., Ayers-Ringler, J., James, C. D., VandenBerg, S. R.
(2010). Morphologic and molecular characterization of ATRT xenografts adapted for orthotopic therapeutic testing. Neuro Oncology
0: nop033v1-nop033
[Abstract][Full Text]
Spiegl-Kreinecker, S., Pirker, C., Filipits, M., Lotsch, D., Buchroithner, J., Pichler, J., Silye, R., Weis, S., Micksche, M., Fischer, J., Berger, W.
(2010). O6-Methylguanine DNA methyltransferase protein expression in tumor cells predicts outcome of temozolomide therapy in glioblastoma patients. Neuro Oncology
12: 28-36
[Abstract][Full Text]
Stachelek, G. C., Dalal, S., Donigan, K. A., Campisi Hegan, D., Sweasy, J. B., Glazer, P. M.
(2010). Potentiation of Temozolomide Cytotoxicity by Inhibition of DNA Polymerase {beta} Is Accentuated by BRCA2 Mutation. Cancer Res.
70: 409-417
[Abstract][Full Text]
van den Bent, M. J., Dubbink, H. J., Sanson, M., van der Lee-Haarloo, C. R., Hegi, M., Jeuken, J. W.M., Ibdaih, A., Brandes, A. A., Taphoorn, M. J.B., Frenay, M., Lacombe, D., Gorlia, T., Dinjens, W. N.M., Kros, J. M.
(2009). MGMT Promoter Methylation Is Prognostic but Not Predictive for Outcome to Adjuvant PCV Chemotherapy in Anaplastic Oligodendroglial Tumors: A Report From EORTC Brain Tumor Group Study 26951. JCO
27: 5881-5886
[Abstract][Full Text]
Weller, M., Felsberg, J., Hartmann, C., Berger, H., Steinbach, J. P., Schramm, J., Westphal, M., Schackert, G., Simon, M., Tonn, J. C., Heese, O., Krex, D., Nikkhah, G., Pietsch, T., Wiestler, O., Reifenberger, G., von Deimling, A., Loeffler, M.
(2009). Molecular Predictors of Progression-Free and Overall Survival in Patients With Newly Diagnosed Glioblastoma: A Prospective Translational Study of the German Glioma Network. JCO
27: 5743-5750
[Abstract][Full Text]
FUKUSHIMA, T., TAKESHIMA, H., KATAOKA, H.
(2009). Anti-glioma Therapy with Temozolomide and Status of the DNA-Repair Gene MGMT. Anticancer Res
29: 4845-4854
[Abstract][Full Text]
Candiloro, I. L.M., Dobrovic, A.
(2009). Detection of MGMT Promoter Methylation in Normal Individuals Is Strongly Associated with the T Allele of the rs16906252 MGMT Promoter Single Nucleotide Polymorphism. Cancer Prevention Research
2: 862-867
[Abstract][Full Text]
Sanson, M., Marie, Y., Paris, S., Idbaih, A., Laffaire, J., Ducray, F., El Hallani, S., Boisselier, B., Mokhtari, K., Hoang-Xuan, K., Delattre, J.-Y.
(2009). Isocitrate Dehydrogenase 1 Codon 132 Mutation Is an Important Prognostic Biomarker in Gliomas. JCO
27: 4150-4154
[Abstract][Full Text]
Elias, A., Siegelin, M. D., Steinmuller, A., von Deimling, A., Lass, U., Korn, B., Mueller, W.
(2009). Epigenetic Silencing of Death Receptor 4 Mediates Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand Resistance in Gliomas. Clin. Cancer Res.
15: 5457-5465
[Abstract][Full Text]
Hegi, M. E., Sciuscio, D., Murat, A., Levivier, M., Stupp, R.
(2009). Epigenetic Deregulation of DNA Repair and Its Potential for Therapy. Clin. Cancer Res.
15: 5026-5031
[Abstract][Full Text]
Everhard, S., Tost, J., El Abdalaoui, H., Criniere, E., Busato, F., Marie, Y., Gut, I. G., Sanson, M., Mokhtari, K., Laigle-Donadey, F., Hoang-Xuan, K., Delattre, J.-Y., Thillet, J.
(2009). Identification of regions correlating MGMT promoter methylation and gene expression in glioblastomas. Neuro Oncology
11: 348-356
[Abstract][Full Text]
Bailey, V. J., Easwaran, H., Zhang, Y., Griffiths, E., Belinsky, S. A., Herman, J. G., Baylin, S. B., Carraway, H. E., Wang, T.-H.
(2009). MS-qFRET: A quantum dot-based method for analysis of DNA methylation. Genome Res
19: 1455-1461
[Abstract][Full Text]
Yip, S., Miao, J., Cahill, D. P., Iafrate, A. J., Aldape, K., Nutt, C. L., Louis, D. N.
(2009). MSH6 Mutations Arise in Glioblastomas during Temozolomide Therapy and Mediate Temozolomide Resistance. Clin. Cancer Res.
15: 4622-4629
[Abstract][Full Text]
MELLAI, M., CALDERA, V., ANNOVAZZI, L., CHIO, A., LANOTTE, M., CASSONI, P., FINOCCHIARO, G., SCHIFFER, D.
(2009). MGMT Promoter Hypermethylation in a Series of 104 Glioblastomas. Cancer Genomics Proteomics
6: 219-227
[Abstract][Full Text]
McCabe, M. T., Brandes, J. C., Vertino, P. M.
(2009). Cancer DNA Methylation: Molecular Mechanisms and Clinical Implications. Clin. Cancer Res.
15: 3927-3937
[Abstract][Full Text]
Kitange, G. J., Carlson, B. L., Schroeder, M. A., Grogan, P. T., Lamont, J. D., Decker, P. A., Wu, W., James, C. D., Sarkaria, J. N.
(2009). Induction of MGMT expression is associated with temozolomide resistance in glioblastoma xenografts. Neuro Oncology
11: 281-291
[Abstract][Full Text]
Cui, B., Johnson, S. P., Bullock, N., Ali-Osman, F., Bigner, D. D., Friedman, H. S.
(2009). Bifunctional DNA Alkylator 1,3-Bis(2-chloroethyl)-1-nitrosourea Activates the ATR-Chk1 Pathway Independently of the Mismatch Repair Pathway. Mol. Pharmacol.
75: 1356-1363
[Abstract][Full Text]
Hervouet, E., Debien, E., Campion, L., Charbord, J., Menanteau, J., Vallette, F. M., Cartron, P.-F.
(2009). Folate Supplementation Limits the Aggressiveness of Glioma via the Remethylation of DNA Repeats Element and Genes Governing Apoptosis and Proliferation. Clin. Cancer Res.
15: 3519-3529
[Abstract][Full Text]
Seligson, D. B., Horvath, S., McBrian, M. A., Mah, V., Yu, H., Tze, S., Wang, Q., Chia, D., Goodglick, L., Kurdistani, S. K.
(2009). Global Levels of Histone Modifications Predict Prognosis in Different Cancers. Am. J. Pathol.
174: 1619-1628
[Abstract][Full Text]
Quinn, J. A., Jiang, S. X., Reardon, D. A., Desjardins, A., Vredenburgh, J. J., Rich, J. N., Gururangan, S., Friedman, A. H., Bigner, D. D., Sampson, J. H., McLendon, R. E., Herndon, J. E. II, Walker, A., Friedman, H. S.
(2009). Phase II Trial of Temozolomide Plus O6-Benzylguanine in Adults With Recurrent, Temozolomide-Resistant Malignant Glioma. JCO
27: 1262-1267
[Abstract][Full Text]
Wick, W., Platten, M., Weller, M.
(2009). New (alternative) temozolomide regimens for the treatment of glioma. Neuro Oncology
11: 69-79
[Abstract][Full Text]
Vredenburgh, J. J., Desjardins, A., Reardon, D. A., Friedman, H. S.
(2009). Experience with irinotecan for the treatment of malignant glioma. Neuro Oncology
11: 80-91
[Abstract][Full Text]
Quinn, J. A., Jiang, S. X., Carter, J., Reardon, D. A., Desjardins, A., Vredenburgh, J. J., Rich, J. N., Gururangan, S., Friedman, A. H., Bigner, D. D., Sampson, J. H., McLendon, R. E., Herndon, J. E. II, Threatt, S., Friedman, H. S.
(2009). Phase II Trial of Gliadel plus O6-Benzylguanine in Adults with Recurrent Glioblastoma Multiforme. Clin. Cancer Res.
15: 1064-1068
[Abstract][Full Text]
Schaich, M., Kestel, L., Pfirrmann, M., Robel, K., Illmer, T., Kramer, M., Dill, C., Ehninger, G., Schackert, G., Krex, D.
(2009). A MDR1 (ABCB1) gene single nucleotide polymorphism predicts outcome of temozolomide treatment in glioblastoma patients. Ann Oncol
20: 175-181
[Abstract][Full Text]
Hartmann, O., Spyratos, F., Harbeck, N., Dietrich, D., Fassbender, A., Schmitt, M., Eppenberger-Castori, S., Vuaroqueaux, V., Lerebours, F., Welzel, K., Maier, S., Plum, A., Niemann, S., Foekens, J. A., Lesche, R., Martens, J. W.M.
(2009). DNA Methylation Markers Predict Outcome in Node-Positive, Estrogen Receptor-Positive Breast Cancer with Adjuvant Anthracycline-Based Chemotherapy. Clin. Cancer Res.
15: 315-323
[Abstract][Full Text]
Brown, P. D., Krishnan, S., Sarkaria, J. N., Wu, W., Jaeckle, K. A., Uhm, J. H., Geoffroy, F. J., Arusell, R., Kitange, G., Jenkins, R. B., Kugler, J. W., Morton, R. F., Rowland, K. M. Jr, Mischel, P., Yong, W. H., Scheithauer, B. W., Schiff, D., Giannini, C., Buckner, J. C.
(2008). Phase I/II Trial of Erlotinib and Temozolomide With Radiation Therapy in the Treatment of Newly Diagnosed Glioblastoma Multiforme: North Central Cancer Treatment Group Study N0177. JCO
26: 5603-5609
[Abstract][Full Text]
de Bont, J. M., Packer, R. J., Michiels, E. M., Boer, M. L. d., Pieters, R.
(2008). Biological background of pediatric medulloblastoma and ependymoma: A review from a translational research perspective. Neuro Oncology
10: 1040-1060
[Abstract][Full Text]
Duffy, M. J., Crown, J.
(2008). A Personalized Approach to Cancer Treatment: How Biomarkers Can Help. Clin. Chem.
54: 1770-1779
[Abstract][Full Text]
Hegi, M. E., Liu, L., Herman, J. G., Stupp, R., Wick, W., Weller, M., Mehta, M. P., Gilbert, M. R.
(2008). Correlation of O6-Methylguanine Methyltransferase (MGMT) Promoter Methylation With Clinical Outcomes in Glioblastoma and Clinical Strategies to Modulate MGMT Activity. JCO
26: 4189-4199
[Abstract][Full Text]
Mason, W. P., Cairncross, J. G.
(2008). Invited Article: The expanding impact of molecular biology on the diagnosis and treatment of gliomas. Neurology
71: 365-373
[Abstract][Full Text]
Yamauchi, T., Ogawa, M., Ueda, T.
(2008). Carmustine-Resistant Cancer Cells Are Sensitized to Temozolomide As A Result of Enhanced Mismatch Repair during the Development of Carmustine Resistance. Mol. Pharmacol.
74: 82-91
[Abstract][Full Text]
Vlassenbroeck, I., Califice, S., Diserens, A.-C., Migliavacca, E., Straub, J., Di Stefano, I., Moreau, F., Hamou, M.-F., Renard, I., Delorenzi, M., Flamion, B., DiGuiseppi, J., Bierau, K., Hegi, M. E.
(2008). Validation of Real-Time Methylation-Specific PCR to Determine O6-Methylguanine-DNA Methyltransferase Gene Promoter Methylation in Glioma. J. Mol. Diagn.
10: 332-337
[Abstract][Full Text]
Sarkaria, J. N., Kitange, G. J., James, C. D., Plummer, R., Calvert, H., Weller, M., Wick, W.
(2008). Mechanisms of Chemoresistance to Alkylating Agents in Malignant Glioma. Clin. Cancer Res.
14: 2900-2908
[Abstract][Full Text]
Hadnagy, A., Beaulieu, R., Balicki, D.
(2008). Histone tail modifications and noncanonical functions of histones: perspectives in cancer epigenetics. Molecular Cancer Therapeutics
7: 740-748
[Abstract][Full Text]
Brock, M. V., Hooker, C. M., Ota-Machida, E., Han, Y., Guo, M., Ames, S., Glockner, S., Piantadosi, S., Gabrielson, E., Pridham, G., Pelosky, K., Belinsky, S. A., Yang, S. C., Baylin, S. B., Herman, J. G.
(2008). DNA Methylation Markers and Early Recurrence in Stage I Lung Cancer. NEJM
358: 1118-1128
[Abstract][Full Text]
Esteller, M.
(2008). Epigenetics in Cancer. NEJM
358: 1148-1159
[Full Text]
Nagane, M., Kobayashi, K., Ohnishi, A., Shimizu, S., Shiokawa, Y.
(2007). Prognostic Significance of O6-Methylguanine-DNA Methyltransferase Protein Expression in Patients with Recurrent Glioblastoma Treated with Temozolomide. Jpn J Clin Oncol
0: hym132v1-10
[Abstract][Full Text]
Shen, L., Kondo, Y., Ahmed, S., Boumber, Y., Konishi, K., Guo, Y., Chen, X., Vilaythong, J. N., Issa, J.-P. J.
(2007). Drug Sensitivity Prediction by CpG Island Methylation Profile in the NCI-60 Cancer Cell Line Panel. Cancer Res.
67: 11335-11343
[Abstract][Full Text]
Horton, T. M., Thompson, P. A., Berg, S. L., Adamson, P. C., Ingle, A. M., Dolan, M. E., Delaney, S. M., Hedge, M., Weiss, H. L., Wu, M.-F., Blaney, S. M.
(2007). Phase I Pharmacokinetic and Pharmacodynamic Study of Temozolomide in Pediatric Patients With Refractory or Recurrent Leukemia: A Children's Oncology Group Study. JCO
25: 4922-4928
[Abstract][Full Text]
Kholod, N., Boniver, J., Delvenne, P.
(2007). A New Dimethyl Sulfoxide-Based Method for Gene Promoter Methylation Detection. J. Mol. Diagn.
9: 574-581
[Abstract][Full Text]
Fontijn, D., Adema, A. D., Bhakat, K. K., Pinedo, H. M., Peters, G. J., Boven, E.
(2007). O6-Methylguanine-DNA-methyltransferase promoter demethylation is involved in basic fibroblast growth factor induced resistance against temozolomide in human melanoma cells. Molecular Cancer Therapeutics
6: 2807-2815
[Abstract][Full Text]
Krex, D., Klink, B., Hartmann, C., von Deimling, A., Pietsch, T., Simon, M., Sabel, M., Steinbach, J. P., Heese, O., Reifenberger, G., Weller, M., Schackert, G., for the German Glioma Network,
(2007). Long-term survival with glioblastoma multiforme. Brain
130: 2596-2606
[Abstract][Full Text]
Lavon, I., Fuchs, D., Zrihan, D., Efroni, G., Zelikovitch, B., Fellig, Y., Siegal, T.
(2007). Novel Mechanism whereby Nuclear Factor {kappa}B Mediates DNA Damage Repair through Regulation of O6-Methylguanine-DNA-Methyltransferase. Cancer Res.
67: 8952-8959
[Abstract][Full Text]
Stupp, R., Hegi, M. E., Gilbert, M. R., Chakravarti, A.
(2007). Chemoradiotherapy in Malignant Glioma: Standard of Care and Future Directions. JCO
25: 4127-4136
[Abstract][Full Text]
Lonning, P., Knappskog, S, Staalesen, V, Chrisanthar, R, Lillehaug, J.
(2007). Breast cancer prognostication and prediction in the postgenomic era. Ann Oncol
18: 1293-1306
[Abstract][Full Text]
Mikeska, T., Bock, C., El-Maarri, O., Hubner, A., Ehrentraut, D., Schramm, J., Felsberg, J., Kahl, P., Buttner, R., Pietsch, T., Waha, A.
(2007). Optimization of Quantitative MGMT Promoter Methylation Analysis Using Pyrosequencing and Combined Bisulfite Restriction Analysis. J. Mol. Diagn.
9: 368-381
[Abstract][Full Text]
Ranson, M., Hersey, P., Thompson, D., Beith, J., McArthur, G. A., Haydon, A., Davis, I. D., Kefford, R. F., Mortimer, P., Harris, P. A., Baka, S., Seebaran, A., Sabharwal, A., Watson, A. J., Margison, G. P., Middleton, M. R.
(2007). Randomized Trial of the Combination of Lomeguatrib and Temozolomide Compared With Temozolomide Alone in Chemotherapy Naive Patients With Metastatic Cutaneous Melanoma. JCO
25: 2540-2545
[Abstract][Full Text]
Martinez, R., Setien, F., Voelter, C., Casado, S., Quesada, M. P., Schackert, G., Esteller, M.
(2007). CpG island promoter hypermethylation of the pro-apoptotic gene caspase-8 is a common hallmark of relapsed glioblastoma multiforme. Carcinogenesis
28: 1264-1268
[Abstract][Full Text]
Eoli, M., Menghi, F., Bruzzone, M. G., De Simone, T., Valletta, L., Pollo, B., Bissola, L., Silvani, A., Bianchessi, D., D'Incerti, L., Filippini, G., Broggi, G., Boiardi, A., Finocchiaro, G.
(2007). Methylation of O6-Methylguanine DNA Methyltransferase and Loss of Heterozygosity on 19q and/or 17p Are Overlapping Features of Secondary Glioblastomas with Prolonged Survival. Clin. Cancer Res.
13: 2606-2613
[Abstract][Full Text]
Stupp, R., Hegi, M. E.
(2007). Methylguanine Methyltransferase Testing in Glioblastoma: When and How?. JCO
25: 1459-1460
[Full Text]
Chinot, O. L., Barrie, M., Fuentes, S., Eudes, N., Lancelot, S., Metellus, P., Muracciole, X., Braguer, D., Ouafik, L., Martin, P.-M., Dufour, H., Figarella-Branger, D.
(2007). Correlation Between O6-Methylguanine-DNA Methyltransferase and Survival in Inoperable Newly Diagnosed Glioblastoma Patients Treated With Neoadjuvant Temozolomide. JCO
25: 1470-1475
[Abstract][Full Text]
Brena, R. M., Costello, J. F.
(2007). Genome-epigenome interactions in cancer. Hum Mol Genet
16: R96-R105
[Abstract][Full Text]
Wojdacz, T. K., Dobrovic, A.
(2007). Methylation-sensitive high resolution melting (MS-HRM): a new approach for sensitive and high-throughput assessment of methylation. Nucleic Acids Res
35: e41-e41
[Abstract][Full Text]
Reinhold, W. C., Reimers, M. A., Maunakea, A. K., Kim, S., Lababidi, S., Scherf, U., Shankavaram, U. T., Ziegler, M. S., Stewart, C., Kouros-Mehr, H., Cui, H., Dolginow, D., Scudiero, D. A., Pommier, Y. G., Munroe, D. J., Feinberg, A. P., Weinstein, J. N.
(2007). Detailed DNA methylation profiles of the E-cadherin promoter in the NCI-60 cancer cells. Molecular Cancer Therapeutics
6: 391-403
[Abstract][Full Text]
Samuels, M. A.
(2007). Update in Neurology. ANN INTERN MED
146: 128-132
[Full Text]
Brandes, A. A., Tosoni, A., Cavallo, G., Reni, M., Franceschi, E., Bonaldi, L., Bertorelle, R., Gardiman, M., Ghimenton, C., Iuzzolino, P., Pession, A., Blatt, V., Ermani, M.
(2006). Correlations Between O6-Methylguanine DNA Methyltransferase Promoter Methylation Status, 1p and 19q Deletions, and Response to Temozolomide in Anaplastic and Recurrent Oligodendroglioma: A Prospective GICNO Study. JCO
24: 4746-4753
[Abstract][Full Text]
Maxwell, J. A., Johnson, S. P., Quinn, J. A., McLendon, R. E., Ali-Osman, F., Friedman, A. H., Herndon, J. E. II, Bierau, K., Bigley, J., Bigner, D. D., Friedman, H. S.
(2006). Quantitative analysis of O6-alkylguanine-DNA alkyltransferase in malignant glioma.. Molecular Cancer Therapeutics
5: 2531-2539
[Abstract][Full Text]
Herrlinger, U., Rieger, J., Koch, D., Loeser, S., Blaschke, B., Kortmann, R.-D., Steinbach, J. P., Hundsberger, T., Wick, W., Meyermann, R., Tan, T.-C., Sommer, C., Bamberg, M., Reifenberger, G., Weller, M.
(2006). Phase II Trial of Lomustine Plus Temozolomide Chemotherapy in Addition to Radiotherapy in Newly Diagnosed Glioblastoma: UKT-03. JCO
24: 4412-4417
[Abstract][Full Text]
Fruehauf, J. P., Brem, H., Brem, S., Sloan, A., Barger, G., Huang, W., Parker, R.
(2006). In vitro Drug Response and Molecular Markers Associated with Drug Resistance in Malignant Gliomas. Clin. Cancer Res.
12: 4523-4532
[Abstract][Full Text]
Pollack, I. F., Hamilton, R. L., Sobol, R. W., Burnham, J., Yates, A. J., Holmes, E. J., Zhou, T., Finlay, J. L.
(2006). O6-Methylguanine-DNA Methyltransferase Expression Strongly Correlates With Outcome in Childhood Malignant Gliomas: Results From the CCG-945 Cohort. JCO
24: 3431-3437
[Abstract][Full Text]
Foltz, G., Ryu, G.-Y., Yoon, J.-G., Nelson, T., Fahey, J., Frakes, A., Lee, H., Field, L., Zander, K., Sibenaller, Z., Ryken, T. C., Vibhakar, R., Hood, L., Madan, A.
(2006). Genome-Wide Analysis of Epigenetic Silencing Identifies BEX1 and BEX2 as Candidate Tumor Suppressor Genes in Malignant Glioma.. Cancer Res.
66: 6665-6674
[Abstract][Full Text]
Berger, Y., Bernasconi, C. C., Juillerat-Jeanneret, L.
(2006). Targeting the Endothelin Axis in Human Melanoma: Combination of Endothelin Receptor Antagonism and Alkylating Agents. Exp Biol Med
231: 1111-1119
[Abstract][Full Text]
Esteller, M.
(2006). The necessity of a human epigenome project. Carcinogenesis
27: 1121-1125
[Abstract][Full Text]
Gagnon, J.-F., Bernard, O., Villeneuve, L., Tetu, B., Guillemette, C.
(2006). Irinotecan Inactivation Is Modulated by Epigenetic Silencing of UGT1A1 in Colon Cancer. Clin. Cancer Res.
12: 1850-1858
[Abstract][Full Text]
Reardon, D. A., Rich, J. N., Friedman, H. S., Bigner, D. D.
(2006). Recent Advances in the Treatment of Malignant Astrocytoma. JCO
24: 1253-1265
[Abstract][Full Text]
Neff, T., Beard, B. C., Kiem, H.-P.
(2006). Survival of the fittest: in vivo selection and stem cell gene therapy. Blood
107: 1751-1760
[Abstract][Full Text]
Fox, E. J., Leahy, D. T., Geraghty, R., Mulcahy, H. E., Fennelly, D., Hyland, J. M., O'Donoghue, D. P., Sheahan, K.
(2006). Mutually Exclusive Promoter Hypermethylation Patterns of hMLH1 and O6-Methylguanine DNA Methyltransferase in Colorectal Cancer. J. Mol. Diagn.
8: 68-75
[Abstract][Full Text]
Stupp, R., Hegi, M. E., van den Bent, M. J., Mason, W. P., Weller, M., Mirimanoff, R. O., Cairncross, J. G., on behalf of the European Organisation for Researc,
(2006). Changing paradigms--an update on the multidisciplinary management of malignant glioma.. The Oncologist
11: 165-180
[Abstract][Full Text]
Bredel, M., Bredel, C., Juric, D., Duran, G. E., Yu, R. X., Harsh, G. R., Vogel, H., Recht, L. D., Scheck, A. C., Sikic, B. I.
(2006). Tumor Necrosis Factor-{alpha}-Induced Protein 3 As a Putative Regulator of Nuclear Factor-{kappa}B-Mediated Resistance to O6-Alkylating Agents in Human Glioblastomas. JCO
24: 274-287
[Abstract][Full Text]
Aghi, M., Rabkin, S., Martuza, R. L.
(2006). Effect of Chemotherapy-Induced DNA Repair on Oncolytic Herpes Simplex Viral Replication. JNCI J Natl Cancer Inst
98: 38-50
[Abstract][Full Text]
Mori, T., O'Day, S. J., Umetani, N., Martinez, S. R., Kitago, M., Koyanagi, K., Kuo, C., Takeshima, T.-L., Milford, R., Wang, H.-J., Vu, V. D., Nguyen, S. L., Hoon, D. S.B.
(2005). Predictive Utility of Circulating Methylated DNA in Serum of Melanoma Patients Receiving Biochemotherapy. JCO
23: 9351-9358
[Abstract][Full Text]
Hansen, R. J., Nagasubramanian, R., Delaney, S. M., Cherian, M. M., Lin, S., Kogan, S. C., Dolan, M. E.
(2005). Role of O6-Alkylguanine-DNA Alkyltransferase in Protecting against 1,3-Bis(2-chloroethyl)-1-nitrosourea (BCNU)-Induced Long-Term Toxicities. J. Pharmacol. Exp. Ther.
315: 1247-1255
[Abstract][Full Text]
Sadee, W., Dai, Z.
(2005). Pharmacogenetics/genomics and personalized medicine. Hum Mol Genet
14: R207-R214
[Abstract][Full Text]
Chan, M. W.Y., Wei, S. H., Wen, P., Wang, Z., Matei, D. E., Liu, J. C., Liyanarachchi, S., Brown, R., Nephew, K. P., Yan, P. S., Huang, T. H-M.
(2005). Hypermethylation of 18S and 28S Ribosomal DNAs Predicts Progression-Free Survival in Patients with Ovarian Cancer. Clin. Cancer Res.
11: 7376-7383
[Abstract][Full Text]
Quinn, J. A., Desjardins, A., Weingart, J., Brem, H., Dolan, M. E., Delaney, S. M., Vredenburgh, J., Rich, J., Friedman, A. H., Reardon, D. A., Sampson, J. H., Pegg, A. E., Moschel, R. C., Birch, R., McLendon, R. E., Provenzale, J. M., Gururangan, S., Dancey, J. E., Maxwell, J., Tourt-Uhlig, S., Herndon, J. E. II, Bigner, D. D., Friedman, H. S.
(2005). Phase I Trial of Temozolomide Plus O6-Benzylguanine for Patients With Recurrent or Progressive Malignant Glioma. JCO
23: 7178-7187
[Abstract][Full Text]
Natsume, A., Ishii, D., Wakabayashi, T., Tsuno, T., Hatano, H., Mizuno, M., Yoshida, J.
(2005). IFN-{beta} Down-Regulates the Expression of DNA Repair Gene MGMT and Sensitizes Resistant Glioma Cells to Temozolomide. Cancer Res.
65: 7573-7579
[Abstract][Full Text]
Brell, M., Tortosa, A., Verger, E., Gil, J. M., Vinolas, N., Villa, S., Acebes, J. J., Caral, L., Pujol, T., Ferrer, I., Ribalta, T., Graus, F.
(2005). Prognostic Significance of O6-Methylguanine-DNA Methyltransferase Determined by Promoter Hypermethylation and Immunohistochemical Expression in Anaplastic Gliomas. Clin. Cancer Res.
11: 5167-5174
[Abstract][Full Text]
Dimopoulos, M. A., Souliotis, V. L., Anagnostopoulos, A., Papadimitriou, C., Sfikakis, P. P.
(2005). Extent of Damage and Repair in the p53 Tumor-Suppressor Gene After Treatment of Myeloma Patients With High-Dose Melphalan and Autologous Blood Stem-Cell Transplantation Is Individualized and May Predict Clinical Outcome. JCO
23: 4381-4389
[Abstract][Full Text]
van Doorn, R., Zoutman, W. H., Dijkman, R., de Menezes, R. X., Commandeur, S., Mulder, A. A., van der Velden, P. A., Vermeer, M. H., Willemze, R., Yan, P. S., Huang, T. H., Tensen, C. P.
(2005). Epigenetic Profiling of Cutaneous T-Cell Lymphoma: Promoter Hypermethylation of Multiple Tumor Suppressor Genes Including BCL7a, PTPRG, and p73. JCO
23: 3886-3896
[Abstract][Full Text]
Miyamoto, K., Ushijima, T.
(2005). Diagnostic and Therapeutic Applications of Epigenetics. Jpn J Clin Oncol
35: 293-301
[Abstract][Full Text]
Laird, P. W.
(2005). Cancer epigenetics. Hum Mol Genet
14: R65-R76
[Abstract][Full Text]
Kohonen-Corish, M. R.J., Daniel, J. J., Chan, C., Lin, B. P.C., Kwun, S. Y., Dent, O. F., Dhillon, V. S., Trent, R. J.A., Chapuis, P. H., Bokey, E. L.
(2005). Low Microsatellite Instability Is Associated With Poor Prognosis in Stage C Colon Cancer. JCO
23: 2318-2324
[Abstract][Full Text]
Alaminos, M., Davalos, V., Ropero, S., Setien, F., Paz, M. F., Herranz, M., Fraga, M. F., Mora, J., Cheung, N.-K. V., Gerald, W. L., Esteller, M.
(2005). EMP3, a Myelin-Related Gene Located in the Critical 19q13.3 Region, Is Epigenetically Silenced and Exhibits Features of a Candidate Tumor Suppressor in Glioma and Neuroblastoma. Cancer Res.
65: 2565-2571
[Abstract][Full Text]
Stupp, R., Mason, W. P., van den Bent, M. J., Weller, M., Fisher, B., Taphoorn, M. J.B., Belanger, K., Brandes, A. A., Marosi, C., Bogdahn, U., Curschmann, J., Janzer, R. C., Ludwin, S. K., Gorlia, T., Allgeier, A., Lacombe, D., Cairncross, J. G., Eisenhauer, E., Mirimanoff, R. O., the European Organisation for Research and Treatme,
(2005). Radiotherapy plus Concomitant and Adjuvant Temozolomide for Glioblastoma. NEJM
352: 987-996
[Abstract][Full Text]
Hegi, M. E., Diserens, A.-C., Gorlia, T., Hamou, M.-F., de Tribolet, N., Weller, M., Kros, J. M., Hainfellner, J. A., Mason, W., Mariani, L., Bromberg, J. E.C., Hau, P., Mirimanoff, R. O., Cairncross, J. G., Janzer, R. C., Stupp, R.
(2005). MGMT Gene Silencing and Benefit from Temozolomide in Glioblastoma. NEJM
352: 997-1003
[Abstract][Full Text]
Osanai, T., Takagi, Y., Toriya, Y., Nakagawa, T., Aruga, T., Iida, S., Uetake, H., Sugihara, K.
(2005). Inverse Correlation Between the Expression of O6-Methylguanine-DNA Methyl Transferase (MGMT) and p53 in Breast Cancer. Jpn J Clin Oncol
35: 121-125
[Abstract][Full Text]
Fukushima, T., Katayama, Y., Watanabe, T., Yoshino, A., Ogino, A., Ohta, T., Komine, C.
(2005). Promoter Hypermethylation of Mismatch Repair Gene hMLH1 Predicts the Clinical Response of Malignant Astrocytomas to Nitrosourea. Clin. Cancer Res.
11: 1539-1544
[Abstract][Full Text]
Neff, T., Beard, B. C., Peterson, L. J., Anandakumar, P., Thompson, J., Kiem, H.-P.
(2005). Polyclonal chemoprotection against temozolomide in a large-animal model of drug resistance gene therapy. Blood
105: 997-1002
[Abstract][Full Text]