Rickettsia africae, a Tick-Borne Pathogen in Travelers to Sub-Saharan Africa
Didier Raoult, M.D., Ph.D., Pierre E. Fournier, M.D., Ph.D., Florence Fenollar, M.D., Mogens Jensenius, M.D., Tine Prioe, M.D., Jean J. de Pina, M.D., Giuseppe Caruso, M.D., Nicola Jones, M.D., Herman Laferl, M.D., D.T.M.H., John E. Rosenblatt, M.D., and Thomas J. Marrie, M.D.
Background African tick-bite fever occurs after contact withticks that carry Rickettsia africae and that parasitize cattleand game. Sporadic reports suggest that this infection has specificclinical and epidemiologic features.
Methods We studied patients who were tested for a rickettsialdisease after returning from a visit to Africa or Guadeloupe.To assess the value of the microimmunofluorescence assay, Westernblotting, and cross-adsorption assays, we compared the resultsof these tests in 39 patients in whom African tick-bite feverhad been confirmed by the polymerase-chain-reaction assay, cellculture, or both; 50 patients with documented R. conorii infection;and 50 blood donors. These diagnostic criteria were then appliedto 376 additional patients who had returned from southern Africaand 2 who had returned from Guadeloupe and whose serum was beingtested for rickettsial disease.
Results In the 39 patients with direct evidence of R. africaeinfection, the combination of microimmunofluorescence assay,Western blotting, and cross-adsorption assays showing antibodiesspecific for R. africae had a sensitivity of 0.56; however,each test had a positive predictive value and a specificityof 1.0. An additional 80 patients were found to have an R. africaeinfection on the basis of these serologic criteria. Infectionswith R. africae were acquired by visitors to 11 African countriesand Guadeloupe. The illness was generally mild and was characterizedby a rash in 46 percent of the patients; the rash was usuallymaculopapular or vesicular and rarely purpuric. Ninety-fivepercent of patients had an inoculation eschar or eschars, and54 percent of these patients had multiple eschars, a findingthat is unusual in patients with rickettsial infection.
Conclusions In this series, R. africae was the cause of nearlyall cases of tick-bite rickettsiosis in patients who becameill after a trip to sub-Saharan Africa.
Rickettsia conorii infection was once considered the only tick-transmittedrickettsial infection in Europe and Africa, causing both Mediterraneanspotted fever and African tick-bite fever. At that time, Africantick-bite fever, which occurred after contact with ticks (amblyommaspecies) found on cattle and game and was characterized by signsof mild infection, usually with no rash,1 was considered a ruralform of Mediterranean spotted fever. Mediterranean spotted feverwas transmitted by dog ticks (rhipicephalus species) and wascharacterized by fever, headache, myalgias, a maculopapularrash, and a single inoculation eschar at the site of the tickbite.2 In 1936, Pijper suggested that these two diseases werecaused by different agents,3 but it was not until 1992 thatKelly et al. demonstrated the causative role of a new rickettsiaisolated from a patient who presented with fever, an inoculationeschar, and regional lymphadenopathy but no rash.4 This isolatewas named R. africae; it was distinct from all other previouslydescribed rickettsiae but similar to a bacterium previouslyisolated from Amblyomma hebraeum ticks.4,5 Subsequently, R.africae has been implicated as the etiologic agent in severalcases of African tick-bite fever in travelers returning fromsouthern Africa6,7 and in one woman who was bitten by a tickin Guadeloupe.4,8,9 We evaluated a large series of patientswith R. africae infections in order to describe the epidemiologic,clinical, and diagnostic features of African tick-bite feverand to validate serologic methods for the diagnosis of thisdisease.
Methods
Patients
We tested serum samples, blood samples, and skin-biopsy specimensthat were obtained between January 1996 and March 2000 frompatients who had had an influenza-like syndrome that was notdue to malaria (as indicated by a negative blood smear) afterreturning from a trip to Africa or Guadeloupe. For each patient,data on epidemiologic and clinical features were obtained bythe attending physician through the use of a standardized questionnaire.Information was obtained about whether the patient had beenbitten by a tick (or had handled a tick) during the trip and,if so, the geographic area in which the bite had occurred; whetherthe patient had had any contact with animals during the trip;whether the patient had any underlying diseases; and whetherthe patient had had the following clinical symptoms: fever,headache, an inoculation eschar or eschars (and their locationsif present), regional adenopathy, a rash, and if present, thetype of rash (maculopapular, vesicular, or purpuric). Informationabout laboratory results and the outcome of the infection wasalso obtained. For each patient, a serum sample was obtainedfor serologic testing during the acute phase of the illnessand, when possible, during convalescence. Some of the patientshave been described previously.7,10 Each patient provided writteninformed consent.
Laboratory Diagnosis
A microimmunofluorescence assay was used as the reference methodand was carried out as described previously with the use ofboth R. conorii strain Seven (Malish, American Type CultureCollection VR-613T) and R. africae strain ESF-5 (provided byDr. G. Dasch) as antigens.9 Titers of 1:64 in the case of IgGantibody or of 1:32 in the case of IgM antibody (or both) wereconsidered evidence of recent infection by a rickettsia species.11,12Western blotting, cross-adsorption assays, cell or tissue culture,polymerase-chain-reaction (PCR) assays, and "suicide" PCR assays(this is a nested PCR whose name comes from the fact that theprimers are used only once)13 were performed if adequate bloodsamples or tissue specimens were available. Western blottingprocedures were performed as previously described14; 20 µgof R. africae antigen or R. conorii antigen was used per lane.Cross-adsorption assays15 for serologic testing were performedas previously described.16 We estimated the positive predictivevalue, specificity, and sensitivity of the microimmunofluorescenceassay, Western blotting, and the cross-adsorption assay in 39patients who had confirmed R. africae infection on the basisof cell-culture results, PCR assay, or both, by comparing theirresults with those of 50 patients with direct evidence of R.conorii infection contracted in France and 50 randomly chosenblood donors from Marseilles. We considered any of the followingto be definite serologic evidence of an R. africae infection:titers of IgG antibody and IgM antibody against R. africae antigenthat were at least two serial dilutions higher than titers ofIgG and IgM antibody against R. conorii (e.g., 1:64 vs. 1:16),a Western blot profile that showed only R. africaespecificantibodies, or cross-adsorption studies demonstrating that thehomologous antibodies were directed against R. africae.17 Wethen applied these serologic diagnostic criteria to serum samplesfrom 376 additional patients who had returned from southernAfrica and 2 who had returned from Guadeloupe and who had providedserum samples for the diagnosis of rickettsiosis.
The microorganism was isolated from skin-biopsy specimens andheparin-treated blood samples that were inoculated into shellvials, and the cultures were then cultivated as previously reported.9For the molecular detection and identification of R. africae,DNA was extracted from ground eschar-biopsy specimens, fromthe leukocyte layer in the sediment of EDTA-treated blood samples,or from 200 µl of shell-vial supernatant with the QIAmpTissue kit (Qiagen, Hilden, Germany) according to the manufacturer'srecommendations. The standard PCR assay of the DNA extractswas conducted as described previously.18 In an effort to increasethe sensitivity of DNA detection and to avoid false positiveamplifications, we used a suicide PCR assay to test, when enoughof the specimen or sample remained, all skin-biopsy specimensthat were negative on the standard PCR assay and the serum sampleobtained from each patient during the acute phase of the illness.13Three series of samples were tested successively with the useof three sets of two pairs of single-use primers that amplifiednonoverlapping fragments of the gene encoding outer-membraneprotein A (ompA), a gene present in all spotted-fever-grouprickettsia. The first suicide PCR assay used the primers AF1F(5'CACTCGGTGTTGCTGCA3') and AF1R (ATTAGTGCAGCATTCGCTC3') andAF2F (GCTGCAGGAGCATTTAGTG3') and AF2R (5'TATCGGCAGGAGCATCAA3')for the nested amplification. The second used the primers AF3F(5'GGTGGTGGTAACGTAATC3') and AF3R (5'CGTCAGTTATTGTAACGGC3')and AF4F (5'GGAACAGTTGCAGAAATCAA3') and AF4R (5'CTGCTACATTACTCCCAATA3')for the nested amplification. The third used the primers AF5F(5'GTATAACATTACACGCTGG3') and AF5R (5'GCAAGTGTTCCTATAGTTG3')and AF6F (5'TATAGATTTTGGAGCCAAGGA3') and AF6R (5'CCGTAAGTAACTTTGTATTAA3')for the nested amplification. DNA extracted from skin-biopsyspecimens from a patient who had died of cancer and from serumspecimens from blood donors were used as negative controls forPCR amplification from skin-biopsy specimens and serum samplesfrom the study patients, respectively. One negative controlwas used for every seven samples. Testing was done in a blindedfashion. All positive PCR products were sequenced as previouslydescribed for the identification of the pathogenic rickettsialspecies.17,19
Statistical Analysis
We used Fisher's exact test with Epi Info version 6.020 to comparethe sensitivity of the suicide PCR assay and blood or escharculture. Observed differences were considered to be significantwhen the resulting two-tailed P value was less than 0.05.
Results
Laboratory Results
A total of 417 patients were tested for R. africae infection,and the diagnosis was established in 133, including 39 withdirect evidence of R. africae on PCR assay, cell culture, orboth and 94 with only a specific serologic response to R. africaeon microimmunofluorescence assay. However, among the 417, 14patients for whom epidemiologic and clinical information wasmissing were excluded from the study. On cell or tissue culture,R. africae was isolated from the blood of 2 of 18 patients whowere tested and from the skin-biopsy specimens of 8 of 18 patientswho were tested. A PCR assay carried out according to standardmethods was positive in 1 of 8 blood samples that were testedand in 11 of 23 skin-biopsy specimens. All 15 skin-biopsy specimensthat were evaluated with the suicide PCR assay were positive(including 7 that were negative on the standard PCR assay).Fragments of 330, 240, and 170 bp were obtained with use ofthe primer pairs AF2F and AF2R, AF4F and AF4R, and AF6F andAF6R, respectively. Of the 109 serum specimens tested with theuse of this technique, 16 were positive. None of the negativecontrols were positive.
Amplification of DNA from skin-biopsy specimens with the useof the suicide PCR assay was significantly more sensitive thanculture of skin-biopsy specimens (15 of 15 positive samplesidentified correctly, as compared with 7 of 17; P<0.01).However, suicide PCR assay of serum was not more sensitive thanblood culture (16 of 109 positive samples identified correctly,as compared with 2 of 18; P=0.50). In every patient with positiveresults on either or both of the PCR assays, the sequence ofthe amplicon was 100 percent homologous to and specific forthat of R. africae.
When we compared the 39 patients with confirmed R. africae infectionwith 50 patients with confirmed R. conorii infection and 50blood donors, 10 of our patients with R. africae infection butnone of the controls had levels of IgG antibody and IgM antibodyagainst R. africae antigen that were higher than the IgG andIgM antibody levels against R. conorii by at least two dilutions(positive predictive value, 1.0; specificity, 1.0; and sensitivity,0.26). Five of six patients with R. africae infection but noneof the controls had an antibody response specific for R. africaeinfection on cross-adsorption testing (positive predictive value,1.0; specificity, 1.0; and sensitivity, 0.83). Eighteen of 34patients but none of the controls had antibodies specific forR. africae by Western blotting (positive predictive value, 1.0;specificity, 1.0; and sensitivity, 0.53) (Figure 1). The remaining16 patients had antibodies against both R. africae and R. conorii.
Figure 1. Results of Western Blot Assay of Serum from Three Patients.
A Western blot assay of the serum of a patient with epidemiologic and clinical features consistent with African tick-bite fever showed specific reactivity with the outer membrane proteins of Rickettsia africae (lane 2) but not with R. conorii antigen (lane 1). A microimmunofluorescence assay for antibodies against R. africae antigen was negative in this serum sample. A Western blot assay of the serum of a patient with culture-proved R. africae infection showed nonspecific reactivity with the outer membrane proteins and lipopolysaccharide of R. conorii (lane 3) and R. africae (lane 4). A Western blot assay of the serum of a patient with culture-proved R. conorii infection showed specific reactivity with the outer membrane proteins of R. conorii (lane 5) but not with R. africae antigen (lane 6).
When we combined the results of the microimmunofluorescenceassay, Western blotting, and cross-adsorption tests, the resultsof at least one of these three tests were positive in 22 ofthe 39 patients with confirmed infection (56 percent). Whenwe applied these serologic tests to 378 other patients withpotential R. africae infection, 81 patients for whom clinicalinformation was available had positive results (Table 1). Serumsamples obtained during the acute phase of the illness wereavailable for 77 patients, whereas samples obtained during convalescencewere available for 47. The microimmunofluorescence assay indicatedthat 68 patients were seropositive; titers of IgG antibody againstR. africae antigen ranged from 0 to 1:32 and 0 to 1:2048 insamples obtained during the acute phase and convalescence, respectively,whereas titers of IgM antibody ranged from 0 to 1:256 in samplesobtained during the acute phase and from 0 to 1:1024 in samplesobtained during convalescence. In 33 patients the levels ofIgG and IgM antibody against R. africae antigen were higherthan the levels of these antibodies against R. conorii antigen,and 46 had a specific antibody response against R. africae antigenon Western blotting. In an additional 33 patients, the presenceof antibodies against both R. africae and R. conorii antigenprevented us from determining the causative pathogen.
Table 1. Results from 80 Patients with a Serologic Diagnosis of African Tick-Bite Fever and 1 Patient with a Serologic Diagnosis of Mediterranean Spotted Fever.
By combining the results of the microimmunofluorescence assayand Western blotting, we obtained a specific diagnosis in 66patients. In 14 patients for whom the levels of IgG and IgMcould not be used to identify the infecting organism and forwhom the results of Western blotting were negative but who hadpositive results on the microimmunofluorescence assay, the cross-adsorptionassay confirmed the presence of an R. africae infection. Ofthe 46 patients with positive results on Western blotting, 13had no detectable antibodies on the microimmunofluorescenceassay. One additional patient who had returned from South Africahad R. conorii infection on the basis of serologic analysisafter cross-adsorption assay (Table 1).
Epidemiologic and Clinical Findings
Of the 119 patients with R. africae infection, 106 (89 percent)were members of 21 tourist groups. In 88 cases (74 percent)the infections occurred in clusters. One hundred sixteen patients(97 percent) had traveled to 1 of 11 African countries (Table 2).Three patients acquired the disease outside Africa: twowere infected in Guadeloupe, and the other was a young postdoctoralstudent in Great Britain who was bitten by an imported SouthAfrican amblyomma tick that he was studying (Table 2). Seventy-fourpatients were male (62 percent), and 45 were female (38 percent).Their mean (±SD) age was 44.6±15.7 years (range,15 to 77). Tick bites or handling of ticks was reported by 52patients (44 percent) (Table 3), and we used this informationto determine the mean incubation time of 6.6±3.0 days.
Table 3. Signs and Symptoms of Patients with African Tick-Bite Fever, Patients with Mediterranean Spotted Fever, and Patients with Rocky Mountain Spotted Fever.
Symptoms at onset included fever in 105 patients (88 percent)and an influenza-like syndrome in 75 (63 percent). One hundredthirteen patients (95 percent) presented with inoculation eschars;52 patients had a single eschar (46 percent), and 61 had multipleeschars (54 percent) (Figure 2). Eschars were located on thearms in 12 patients (11 percent); the legs in 70 (62 percent);the chest, abdomen, or groin in 20 (18 percent); the back orthe buttocks in 5 (4 percent), and the face, scalp, or neckin 6 (5 percent). Fifty-one of the 119 patients (43 percent)presented with regional lymphadenopathy. Fifty-five patients(46 percent) had a rash; among these 55 patients the rash wasmaculopapular in 28 (51 percent), vesicular in 25 (45 percent),and purpuric in 2 (4 percent).
Figure 2. Four Inoculation Eschars (Arrows) on the Legs of a Patient Who Presented with African Tick-Bite Fever after Returning from a Safari in South Africa.
Information about treatment was available for 88 patients; 74percent received doxycycline for a mean of 6.3±3.1 days(range, 7 to 15), 1 percent received minocycline, 6 percentreceived erythromycin, 3 percent received ciprofloxacin, and16 percent received no antibiotic therapy. All patients recoveredwithout any sequelae.
Discussion
African tick-bite fever is highly prevalent in Africa (seroprevalence,30 to 56 percent),12 and it is also an important disease amongvisitors to this region.23 Most of the reported cases of Africantick-bite fever have been part of outbreaks.4,7,24 The rateof suspected R. africae infections among U.S. Army troops deployedto Botswana was 14 percent.25 During an outbreak of R. africaeinfections among participants in an adventure race in SouthAfrica, the estimated rate of infection was 3.9 to 7.6 percent.26In our series of 120 patients, 117 of whom had returned froma trip to Africa, who had been given a diagnosis of tick-biterelateddisease and for whom the infecting rickettsia could be identified,119 were infected with R. africae and 1 with R. conorii.
Mediterranean spotted fever and Rocky mountain spotted feverare generally sporadic, and the vectors of these diseases arevery host-specific.27 In contrast, amblyomma ticks, which areparasites of cattle and wild ungulates and have been found tocarry R. africae in all tested areas,12,28 are not host-specific.They readily feed on humans, which may explain why cases ofR. africae infection often occur as clusters and why patientsoften present with multiple inoculation eschars. On the basisof our data, African tick-bite fever appears to be acquiredafter travel in the countryside and through contact with ticksthat parasitize cattle or wild animals, especially amblyommaticks.
African tick-bite fever is characterized by an incubation periodof six to seven days. Specific features include its tendencyto occur in clusters, multiple inoculation eschars, regionallymphadenopathy, the frequent absence of a rash or the presenceof a pale vesicular eruption, and the absence of complications.Such features are uncommon in patients with Mediterranean spottedfever and those with Rocky mountain spotted fever (Table 3).21These potentially severe diseases most often occur as singlecases after a bite by a dog tick, in particular rhipicephalusspecies or dermacentor species, or a wood tick.29 Although clustersof cases of other tick-borne rickettsioses have been described,22clustering appears to be characteristic of cases of Africantick-bite fever.
The usual method of diagnosing rickettsiosis is a microimmunofluorescenceassay of a serum sample. However, serologic cross-reactionsare common among rickettsiae in the spotted-fever group. Thethree serologic tests that we used were highly specific forand predictive of R. africae infection in patients with directevidence of R. africae infection and allowed us to identify80 patients as being infected with R. africae and 1 as beinginfected with R. conorii. A difference in specific IgG or IgMantibody titers has been reported to be useful for distinguishingR. prowazekii from R. typhi infections.30 Such a differencewas evident in 33 patients with African tick-bite fever, including18 for whom the Western blot assay was not specific. We havepreviously demonstrated that the Western blot assay is positiveearlier in the course of illness than is the microimmunofluorescenceassay in patients with Mediterranean spotted fever.31 Antibodiesagainst high-molecular-weight proteins were detected by Westernblotting in 13 patients with a negative microimmunofluorescenceassay and were the only proof of infection in these patients.The cross-adsorption assay was informative in 47 percent ofthe serum samples that were tested. Overall, the combinationof these three serologic criteria confirmed the diagnosis inonly 56 percent of the 39 with confirmed infection on the basisof a PCR assay, cell culture, or both. Therefore, some of the284 patients for whom all serologic tests were negative mayhave been infected by R. africae, and the frequency of the diseasemay have been underestimated.
Since rickettsiae multiply at the site of inoculation, the escharshould be the preferred source of a biopsy specimen for isolationprocedures or genomic detection. In our study, PCR-based methods,using ompA-derived primers,19 were very sensitive and specificfor both the detection and the identification of R. africaefrom skin-biopsy specimens. The suicide PCR assay appeared tobe very efficient, since it allowed us to confirm the diagnosisin all 15 skin-biopsy specimens and in 16 of 109 serum samplesthat were tested, some of which were negative on the standardPCR assay. Most patients in our series were treated with 200mg of doxycycline per day for 7 to 15 days. Given the benignnature of African tick-bite fever, this regimen could probablybe shortened to a single day, as has been proposed for the treatmentof Mediterranean spotted fever.32 We found that the majorityof cases of rickettsiosis among patients returning from sub-SaharanAfrica are caused by R. africae and not by R. conorii.33 Therefore,physicians need to recognize that African tick-bite fever isa disease of international importance.
Source Information
From the Unité des Rickettsies, Faculté de Médecine, Université de la Méditerranée, Marseilles, France (D.R., P.E.F., F.F.); the Department of Internal Medicine, Aker University Hospital, Oslo, Norway (M.J.); the Department of Infectious Diseases, Rigshospitalet, University of Copenhagen, Copenhagen, Denmark (T.P.); the Laboratoire de Biologie, Hôpital d'Instruction des Armées Laveran, Marseille Armées, France (J.J.D.); the Divisione Malattie Infettive, Ospedale di Belluno, Belluno, Italy (G.C.); the Department of Microbiology and Infectious Diseases, John Radcliffe Hospital, Oxford, United Kingdom (N.J.); the Medical Department, Kaiser Franz Josef Hospital, Vienna, Austria (H.L.); the Division of Clinical Microbiology, Mayo Clinic, Rochester, Minn. (J.E.R.); and the Department of Medicine, University of Alberta, Edmonton, Alta., Canada (T.J.M.).
Address reprint requests to Dr. Raoult at the Unité des Rickettsies, CNRS:UPRESA 6020, Faculté de Medicine, Université de la Méditerranée, 27 Blvd. Jean Moulin, 13385 Marseilles CEDEX 05, France, or at didier. raoult{at}medecine.univ.mrs.fr.
References
Troup JM, Pijper A. Tick-bite fever in Southern Africa. Lancet 1931;2:1183-1186. [CrossRef]
Raoult D, Weiller PJ, Chagnon A, Chaudet H, Gallais H, Casanova P. Mediterranean spotted fever: clinical, laboratory and epidemiological features of 199 cases. Am J Trop Med Hyg 1986;35:845-850.
Pijper A. Étude expérimentale comparée de la fièvre boutonneuse et de la tick-bite-fever. Arch Inst Pasteur Tunis 1936;25:388-401.
Kelly PJ, Matthewman LA, Beati L, et al. African tick-bite fever --a new spotted fever group rickettsiosis under an old name. Lancet 1992;340:982-983.
Kelly PJ, Beati L, Mason PR, Matthewman LA, Roux V, Raoult D. Rickettsia africae sp.nov., the etiological agent of African tick bite fever. Int J Syst Bacteriol 1996;46:611-614. [Free Full Text]
Brouqui P, Harle JR, Delmont J, Frances C, Weiller PJ, Raoult D. African tick-bite fever: an imported spotless rickettsiosis. Arch Intern Med 1997;157:119-124. [Free Full Text]
Jensenius M, Hasle G, Henriksen AZ, et al. African tick-bite fever imported into Norway: presentation of 8 cases. Scand J Infect Dis 1999;31:131-133. [CrossRef][Web of Science][Medline]
Parola P, Jourdan J, Raoult D. Tick-borne infection caused by Rickettsia africae in the West Indies. N Engl J Med 1998;338:1391-1391. [Free Full Text]
Fournier PE, Roux V, Caumes E, Donzel M, Raoult D. Outbreak of Rickettsia africae infections in participants of an adventure race from South Africa. Clin Infect Dis 1998;27:316-323. [Web of Science][Medline]
Fournier PE, Beytout J, Raoult D. Tick-transmitted infections in Transvaal: consider Rickettsia africae. Emerg Infect Dis 1999;5:178-181. [Medline]
Babalis T, Dupont HT, Tselentis Y, Chatzichristodoulou C, Raoult D. Rickettsia conorii in Greece: comparison of a microimmunofluorescence assay and Western blotting for seroepidemiology. Am J Trop Med Hyg 1993;48:784-792.
Dupont HT, Brouqui P, Faugere B, Raoult D. Prevalence of antibodies to Coxiella burnetii, Rickettsia conorii, and Rickettsia typhi in seven African countries. Clin Infect Dis 1995;21:1126-1133. [Web of Science][Medline]
Raoult D, Aboudharam G, Crubezy E, Larrouy G, Ludes B, Drancourt M. Molecular identification by "suicide PCR" of Yersinia pestis as the agent of medieval Black Death. Proc Natl Acad Sci U S A 2000;97:12800-12803. [Free Full Text]
Raoult D, Dasch GA. Line blot and Western blot immunoassays for diagnosis of Mediterranean spotted fever. J Clin Microbiol 1989;27:2073-2079. [Free Full Text]
Goldwasser RA, Shepard CC. Fluorescent antibody methods in the differentiation of murine and epidemic typhus sera: specificity changes resulting from previous immunization. J Immunol 1959;82:373-380.
Hechemy KE, Anacker RL, Carlo NL, Fox JA, Gaafar HA. Absorption of Rickettsia rickettsii antibodies by Rickettsia rickettsii antigens in four diagnostic tests. J Clin Microbiol 1983;17:445-449. [Free Full Text]
Kelly PJ, Beati L, Matthewman LA, Mason PR, Dasch GA, Raoult D. A new pathogenic spotted fever group rickettsia from Africa. J Trop Med Hyg 1994;97:129-137. [Medline]
Fournier PE, Roux V, Raoult D. Phylogenetic analysis of spotted fever group rickettsiae by study of outer surface protein rOmpA. Int J Syst Bacteriol 1998;48:839-849. [Free Full Text]
Roux V, Fournier PE, Raoult D. Differentiation of spotted fever group rickettsiae by sequencing and analysis of restriction fragment length polymorphism of PCR-amplified DNA of the gene encoding the protein rOmpA. J Clin Microbiol 1996;34:2058-2065. [Abstract]
Dean AG, Dean JA, Burton AH, Dicker RC. Epi Info, version 5: a word processing program, database, and statistics program for epidemiology on microcomputers. Atlanta: Centers for Disease Control, 1991.
Helmick CG, Bernard KW, D'Angelo LJ. Rocky Mountain spotted fever: clinical, laboratory, and epidemiological features of 262 cases. J Infect Dis 1984;150:480-488. [Web of Science][Medline]
Rotz L, Callejas L, McKechine D, et al. An epidemiologic and entomologic investigation of a cluster of Rocky Mountain spotted fever cases in Delaware. Del Med J 1998;70:285-291. [Medline]
Kelly PJ, Mason PR, Matthewman LA, Raoult D. Seroepidemiology of spotted fever group rickettsial infections in humans in Zimbabwe. J Trop Med Hyg 1991;94:304-309. [Web of Science][Medline]
Norval RAI. The ticks of Zimbabwe. VII. The genus Amblyomma. Zimbabwe Vet J 1983;13:3-18.
Smoak BL, McClain JB, Brundage JF, et al. An outbreak of spotted fever rickettsiosis in U.S. Army troops deployed to Botswana. Emerg Infect Dis 1996;2:217-221. [Web of Science][Medline]
Pece S, Giuliani G, Fumarola D, Antonaci S, Jirillo E. Mechanisms of immunoresponsiveness against emerging intracellular bacteria. Med Sci Res 1996;24:435-8.
Ecology of non-nidicolous ticks. In: Soneshine DE. Biology of ticks. Vol. 2. New York: Oxford University Press, 1993:3-65.
Dupont HT, La Scola B, Williams R, Raoult D. A focus of tick-borne relapsing fever in southern Zaïre. Clin Infect Dis 1997;25:139-144. [Web of Science][Medline]
Walker D, Raoult D, Brouqui P, Marrie T. Rickettsial diseases. In: Fauci AS, Braunwald E, Isselbacher KJ, et al., eds. Harrison's principles of internal medicine. 14th ed. Vol. 1. New York: McGraw-Hill, 1998:1045-52.
La Scola B, Rydkina L, Ndihokubwayo JB, Vene S, Raoult D. Serological differentiation of murine typhus and epidemic typhus using cross-adsorption and Western blotting. Clin Diagn Lab Immunol 2000;7:612-616. [Free Full Text]
Teysseire N, Raoult D. Comparison of Western immunoblotting and microimmunofluorescence for diagnosis of Mediterranean spotted fever. J Clin Microbiol 1992;30:455-460. [Free Full Text]
Raoult D, Roux V. Rickettsioses as paradigms of new or emerging infectious diseases. Clin Microbiol Rev 1997;10:694-719. [Abstract]
Herrero-Herrero JI, Ruiz-Beltran R, Walker DH. Antigens of Rickettsia conorii recognized by seropositive healthy people from Salamanca (central-west Spain). Eur J Epidemiol 1993;9:59-63. [CrossRef][Medline]
Tsai, K.-H., Lu, H.-Y., Huang, J.-H., Fournier, P.-E., Mediannikov, O., Raoult, D., Shu, P.-Y.
(2009). African Tick Bite Fever in a Taiwanese Traveler Returning from South Africa: Molecular and Serologic Studies. Am J Trop Med Hyg
81: 735-739
[Abstract][Full Text]
Hochedez, P., Canestri, A., Guihot, A., Brichler, S., Bricaire, F., Caumes, E.
(2008). Management of Travelers with Fever and Exanthema, Notably Dengue and Chikungunya Infections. Am J Trop Med Hyg
78: 710-713
[Abstract][Full Text]
Daneman, N. MD, Slinger, R. MD
(2008). Tache noire. CMAJ
178: 841-841
[Full Text]
Portillo, A., Perez-Martinez, L., Santibanez, S., Blanco, J. R., Ibarra, V., Oteo, J. A.
(2007). Detection of Rickettsia africae in Rhipicephalus (Boophilus) decoloratus Ticks from the Republic of Botswana, South Africa. Am J Trop Med Hyg
77: 376-377
[Abstract][Full Text]
Jado, I., Escudero, R., Gil, H., Jimenez-Alonso, M. I., Sousa, R., Garcia-Perez, A. L., Rodriguez-Vargas, M., Lobo, B., Anda, P.
(2006). Molecular Method for Identification of Rickettsia Species in Clinical and Environmental Samples. J. Clin. Microbiol.
44: 4572-4576
[Abstract][Full Text]
PADDOCK, C. D., KOSS, T., EREMEEVA, M. E., DASCH, G. A., ZAKI, S. R., SUMNER, J. W.
(2006). ISOLATION OF RICKETTSIA AKARI FROM ESCHARS OF PATIENTS WITH RICKETTSIALPOX.. Am J Trop Med Hyg
75: 732-738
[Abstract][Full Text]
Owen, C. E., Bahrami, S., Malone, J. C., Callen, J. P., Kulp-Shorten, C. L.
(2006). African tick bite Fever: a not-so-uncommon illness in international travelers.. Arch Dermatol
142: 1312-1314
[Abstract][Full Text]
Damas, J. K., Jensenius, M., Ueland, T., Otterdal, K., Yndestad, A., Froland, S. S., Rolain, J.-M., Myrvang, B., Raoult, D., Aukrust, P.
(2006). Increased Levels of Soluble CD40L in African Tick Bite Fever: Possible Involvement of TLRs in the Pathogenic Interaction between Rickettsia africae, Endothelial Cells, and Platelets. J. Immunol.
177: 2699-2706
[Abstract][Full Text]
Freedman, D. O., Weld, L. H., Kozarsky, P. E., Fisk, T., Robins, R., von Sonnenburg, F., Keystone, J. S., Pandey, P., Cetron, M. S., the GeoSentinel Surveillance Network,
(2006). Spectrum of Disease and Relation to Place of Exposure among Ill Returned Travelers. NEJM
354: 119-130
[Abstract][Full Text]
PSAROULAKI, A., ANTONIOU, M., PAPAEUSTATHIOU, A., TOUMAZOS, P., LOUKAIDES, F., TSELENTIS, Y.
(2006). FIRST DETECTION OF RICKETTSIA FELIS IN CTENOCEPHALIDES FELIS FLEAS PARASITIZING RATS IN CYPRUS. Am J Trop Med Hyg
74: 120-122
[Abstract][Full Text]
Giammanco, G. M., Vitale, G., Mansueto, S., Capra, G., Caleca, M. P., Ammatuna, P.
(2005). Presence of Rickettsia conorii subsp. israelensis, the Causative Agent of Israeli Spotted Fever, in Sicily, Italy, Ascertained in a Retrospective Study. J. Clin. Microbiol.
43: 6027-6031
[Abstract][Full Text]
YOSHIKAWA, H., KIMURA, M., OGAWA, M., ROLAIN, J.-M., RAOULT, D.
(2005). LABORATORY-CONFIRMED MEDITERRANEAN SPOTTED FEVER IN A JAPANESE TRAVELER TO KENYA. Am J Trop Med Hyg
73: 1086-1089
[Abstract][Full Text]
Parola, P., Paddock, C. D., Raoult, D.
(2005). Tick-Borne Rickettsioses around the World: Emerging Diseases Challenging Old Concepts. Clin. Microbiol. Rev.
18: 719-756
[Abstract][Full Text]
Raoult, D., Paddock, C. D.
(2005). Rickettsia parkeri Infection and Other Spotted Fevers in the United States. NEJM
353: 626-627
[Full Text]
Ding, T, Lloyd, G, Tolley, H, Bradlow, A
(2004). Tick bite fever and arthritis associated with travel to Africa. Ann Rheum Dis
63: 1703-1704
[Full Text]
Fenollar, F., Fournier, P. E., Raoult, D.
(2004). Molecular Detection of Coxiella burnetii in the Sera of Patients with Q Fever Endocarditis or Vascular Infection. J. Clin. Microbiol.
42: 4919-4924
[Abstract][Full Text]
Fournier, P.-E., Raoult, D.
(2004). Suicide PCR on Skin Biopsy Specimens for Diagnosis of Rickettsioses. J. Clin. Microbiol.
42: 3428-3434
[Abstract][Full Text]
Mokrani, K., Fournier, P. E., Dalichaouche, M., Tebbal, S., Aouati, A., Raoult, D.
(2004). Reemerging Threat of Epidemic Typhus in Algeria. J. Clin. Microbiol.
42: 3898-3900
[Abstract][Full Text]
Jensenius, M., Fournier, P.-E., Vene, S., Ringertz, S. H., Myrvang, B., Raoult, D.
(2004). Comparison of Immunofluorescence, Western Blotting, and Cross-Adsorption Assays for Diagnosis of African Tick Bite Fever. CVI
11: 786-788
[Abstract][Full Text]
Fournier, P.-E., Allombert, C., Supputamongkol, Y., Caruso, G., Brouqui, P., Raoult, D.
(2004). Aneruptive Fever Associated with Antibodies to Rickettsia helvetica in Europe and Thailand. J. Clin. Microbiol.
42: 816-818
[Abstract][Full Text]
MCQUISTON, J. H., PADDOCK, C. D., SINGLETON, J. JR., WHEELING, J. T., ZAKI, S. R., CHILDS, J. E.
(2004). IMPORTED SPOTTED FEVER RICKETTSIOSES IN UNITED STATES TRAVELERS RETURNING FROM AFRICA: A SUMMARY OF CASES CONFIRMED BY LABORATORY TESTING AT THE CENTERS FOR DISEASE CONTROL AND PREVENTION, 1999-2002. Am J Trop Med Hyg
70: 98-101
[Abstract][Full Text]
Fournier, P.-E., Raoult, D.
(2003). Comparison of PCR and Serology Assays for Early Diagnosis of Acute Q Fever. J. Clin. Microbiol.
41: 5094-5098
[Abstract][Full Text]
Aho, K., Kajander, E. O., Raoult, D.
(2003). Pitfalls in Detection of Novel Nanoorganisms. J. Clin. Microbiol.
41: 3460-3461
[Full Text]
KELLY, P. J., FOURNIER, P.-E., PAROLA, P., RAOULT, D.
(2003). A SURVEY FOR SPOTTED FEVER GROUP RICKETTSIAE AND EHRLICHIAE IN AMBLYOMMA VARIEGATUM FROM ST. KITTS AND NEVIS. Am J Trop Med Hyg
69: 58-59
[Abstract][Full Text]
MACALUSO, K. R., DAVIS, J., ALAM, U., KORMAN, A., RUTHERFORD, J. S., ROSENBERG, R., AZAD, A. F.
(2003). SPOTTED FEVER GROUP RICKETTSIAE IN TICKS FROM THE MASAI MARA REGION OF KENYA. Am J Trop Med Hyg
68: 551-553
[Abstract][Full Text]
Zeaiter, Z., Fournier, P.-E., Greub, G., Raoult, D.
(2003). Diagnosis of Bartonella Endocarditis by a Real-Time Nested PCR Assay Using Serum. J. Clin. Microbiol.
41: 919-925
[Abstract][Full Text]
Lorber, B.
(2002). Update in Infectious Diseases. ANN INTERN MED
137: 974-980
[Full Text]
Ryan, E. T., Wilson, M. E., Kain, K. C.
(2002). Illness after International Travel. NEJM
347: 505-516
[Full Text]
Fournier, P.-E., Jensenius, M., Laferl, H., Vene, S., Raoult, D.
(2002). Kinetics of Antibody Responses in Rickettsia africae and Rickettsia conorii Infections. CVI
9: 324-328
[Abstract][Full Text]
(2001). Rickettsia africae: The Cause of African Tick-Bite Fever. JWatch Infect. Diseases
2001: 6-6
[Full Text]