| |||||||||||||||||||||||||||||||
Primary infection with BK or JC virus usually occurs in childhood and is asymptomatic. More than 80 percent of adults have serologic evidence of infection.1,2 In immunocompetent persons, both viruses persist in the epithelial cells of renal tubules without causing disease,3,4,5 but they may be reactivated in severely immunocompromised hosts. Reactivated JC virus may infect brain glial cells and cause progressive multifocal leukoencephalopathy. In renal-transplant recipients, BK virus may cause an acute tubulointerstitial nephritis and ureteral stenosis, leading to hemorrhagic cystitis and severe allograft dysfunction.6,7,8
Fatal multiorgan-system disease due to BK virus is rare. In one case, a child with the hyper-IgM syndrome died of disseminated BK virus infection.6 A BK virus–associated interstitial pneumonia developed in an eight-month-old infant after hematopoietic stem-cell transplantation.9 BK virus infection restricted to type II pneumocytes and renal tubular epithelial cells was reported in a 14-year-old patient with the acquired immunodeficiency syndrome.10 BK virus has been implicated in cases of atypical retinitis in patients with human immunodeficiency virus (HIV) infection,11,12 and in one case, a disseminated infection involved multiple cell types.13 We report a case of disseminated infection with a BK-related polyomavirus that demonstrated tropism for vascular endothelial cells. The infection resulted in a systemic vasculopathy that led to extensive capillary leakage, myocardial infarction, and death.
Case Report
A 52-year-old man with type 1 diabetes complicated by end-stage renal disease received a cadaveric renal transplant. Acute renal failure developed two weeks after transplantation. Despite clinical evaluation and biopsy, the cause of the renal failure remained unclear. Cyclosporine, which the patient had been receiving, was discontinued, and muromonab-CD3 (OKT3) was administered daily for five days. The serum creatinine level stabilized. Immunosuppressive therapy consisted of prednisone, mycophenolate mofetil, and tacrolimus.
Seven months later, the patient began to have weakness, myalgia, and fatigue in his arms and legs, which progressed until walking became difficult, with the gradual development of dyspnea on exertion. His serum creatine kinase level was 339 mIU per deciliter.
On examination, the patient was confused. He had normal vital signs. His diaphragms were high, with minimal respiratory excursion, but adventitious lung sounds were absent; the heart sounds were distant. There was symmetric edema of his arms and legs, which was more pronounced in his arms, with a moderate degree of proximal and distal weakness. The muscles were tender on palpation. Deep-tendon reflexes were absent, and cutaneous plantar responses could not be elicited.
The white-cell count was 18,200 per cubic millimeter, with 70 percent polymorphonuclear cells. The hematocrit was 35 percent, the erythrocyte sedimentation rate 41 mm per hour, the creatinine level 2.4 mg per deciliter (212.2 µmol per liter), the albumin level 2.5 mg per deciliter, and the creatine kinase level 629 mIU per deciliter. Urinalysis showed no proteinuria, hematuria, or other abnormalities. Multiple blood cultures were negative. Serologic tests for cryptococcus, cytomegalovirus, rapid plasma reagin, HIV, Epstein–Barr virus, Lyme disease, toxoplasma, mycoplasma, echovirus, adenovirus, and coxsackievirus were negative.
Over the next few days, the patient's albumin level dropped to 1.7 mg per deciliter, and anasarca developed. The creatine kinase level peaked at 1317 mIU per deciliter. The weakness progressed, and severe pain and tenderness developed in the biceps. Mycophenolate mofetil and tacrolimus were discontinued. A lumbar puncture showed normal cerebrospinal fluid; Venereal Disease Research Laboratory and cryptococcal antigen tests were negative, as were bacterial, fungal, and viral cultures.
The patient had an asystolic arrest and required resuscitation with vasopressor support. He had episodes of rapid atrial fibrillation and atrial flutter, and the anasarca worsened; hypotension developed. By the 14th hospital day, the albumin level had dropped to 0.9 mg per deciliter. Monitoring with the use of a Swan–Ganz catheter showed low values for the pulmonary-capillary wedge pressure and cardiac index, which were difficult to maintain, despite the administration of crystalloids and colloids.
Biopsy of a deltoid muscle revealed apoptosis of endothelial cells and nuclear inclusions in endothelial cells, raising the possibility of viral infection (Figure 1). Ganciclovir, doxycycline, and ciprofloxacin were administered. Despite the provision of maximal physiological support, the patient died. He had gained approximately 25 kg in the 18 days since admission. The family granted permission for an autopsy, with the results available for teaching and research.
|
Tissue specimens were embedded in paraffin and stained either with hematoxylin and eosin or immunohistochemically using a standard peroxidase-conjugated streptavidin or avidin technique with a polyomavirus-specific polyclonal antiserum (a gift from Dr. D.L. Walker14,15). A tissue specimen from the deltoid-muscle biopsy was processed for electron microscopy16 and examined by two independent observers.
For the polymerase-chain-reaction (PCR) assay of BK virus, DNA was extracted from frozen kidney, muscle, and heart tissues. BK virus DNA sequences were identified as described previously.17 Standard PCR amplification was performed with early-region primers that were specific for the JC and BK viruses: PEP-1, 5'AGTCTTTAGGGTCTTCTACC3', nucleotides 4392 to 4411 (forward); and PEP-2, 5'GGTGCCAACCTATGGAACAG3', nucleotides 4567 to 4548 (reverse). Dot-blot analysis of PCR products hybridized with oligonucleotide probes that were specific for BK virus (5'GAGAATCTGCTGTTGCTTCT3') or JC virus (5'TGGGATCCTGTGTTTTCATC3') distinguished BK from JC sequences. Plasmids containing viral genomes were used as positive controls, and DNA extraction was controlled by amplifying the 
-globin gene.
For sequencing, DNA was extracted from the frozen muscle-biopsy specimen. PCR amplification was performed with the PEP-1 and PEP-2 primers described above, which generate distinct products for the conserved T gene of the BK and JC viruses.17 Direct sequencing of the amplified product was performed with an automated sequencer.
To amplify the regulatory region of the BK virus, primers BKVR1 (5'GCTCCATGGATTCTTCCCTGTTAAG3') and BKVR2 (5'CCTCAGATACACTGGCAACTAGGTC3') were used in standard PCR assays. The amplified products were used in a nested PCR reaction with inner primers BK1 (5'GGCCTCAGAAAAAGCTTCCACACCCTTACTACTTGA3', nucleotides 5095 to 5130) and BK2 (5'CTTGTCGTGACAGCTGGCGCAGAAC3', nucleotides 307 to 283).
Serum samples from the patient (obtained before transplantation) and the donor were tested for IgG antibodies specific for the BK and JC viruses with the use of the biotin–avidin enzyme immunoassay, as previously described.18 Titers of IgM antibodies to the two viruses were determined with the use of a similar procedure.
Results
The muscle-biopsy specimen contained enlarged, atypical endothelial cells, with many intranuclear inclusions, lining capillaries and small vessels (Figure 1). The coarse nuclear chromatin of these cells suggested a transformed phenotype, although the inclusions were indicative of a viral infection. These changes resembled those caused by JC virus infection of glial cells in cases of progressive multifocal leukoencephalopathy, in which oligodendroglia develop nuclear inclusions and the morphologic features of astrocytic nuclei are transformed. Scattered endothelial cells in the muscle-biopsy specimen were characterized by apoptosis, and some vessels had completely necrotic walls and neutrophils. Chronic inflammation was minimal. The morphologic changes in the endothelial cells in the muscle-biopsy specimen were not present in a specimen from a biopsy of the renal allograft performed shortly after transplantation.
Electron micrographs of the muscle-biopsy specimen showed viral particles that were morphologically consistent with papovavirus in vascular endothelial cells (Figure 2). The muscle fibers were normal. The basal lamina of small vessels was thickened, with focal calcium deposits and cellular debris. Some endothelial cells were normal, whereas others were characterized by hypertrophy, necrosis, apoptosis, and the formation of multinuclear giant cells. Small, round, electron-dense viral particles with a diameter of 40 nm, which were consistent with a human polyomavirus, were present in the nuclei of many endothelial cells (Figure 2B), and in some instances, the particles formed regular paracrystalline arrays (Figure 2C and Figure 2D). Smaller numbers of viral particles were also present in cytoplasmic organelles and outside organelles in the interstitial tissues and vessel lumens. Endothelial-cell organelles that contained viral particles included caveolae.
|
|
Dot-blot analysis of DNA extracted from heart, muscle, and renal-transplant tissues and analyzed for both BK and JC virus sequences by PCR showed hybridization of all three tissues with the BK virus–specific oligonucleotide probe but not with the JC virus–specific probe (Figure 4).
|
Retrospective examination of a specimen from the renal-allograft biopsy performed shortly after transplantation showed immunoreactivity to polyomavirus in capillary endothelial cells and in tubular lumen but not in tubular epithelial cells (Figure 5). In addition, high titers of IgG antibodies to BK virus were present in the patient's serum both before and after transplantation. The titer of IgM antibodies was low before transplantation but became high during his illness. Titers of IgG and IgM antibodies in the serum specimen from the donor were low (Table 1). All the serum specimens had low titers of IgG and IgM antibodies to JC virus, with the use of the same method of measurement (data not shown). These findings suggest that the patient had a reactivation of a latent viral infection rather than a new infection from transplantation.
|
|
We describe a patient who had received a renal allograft and seven months later had progressive muscle weakness, rapid development of anasarca, and myocardial infarction, which led to his death. A muscle biopsy and autopsy showed a widespread endothelial disorder characterized by a transformed nuclear phenotype, nuclear inclusions containing viral particles, and apoptosis. Further analysis revealed widespread endothelial infection by a BK-related virus. We speculate that the endothelial-cell injury led to capillary leakage and massive edema, as well as microthrombotic events that caused tissue ischemia. The small vessels of the myocardium and skeletal muscle were the chief targets of the viral infection. Other organs, such as the lungs and brain, were minimally affected. Retrospective analysis of a specimen from the renal-allograft biopsy performed shortly after transplantation showed viral proteins in endothelial cells, along with endothelial injury. This case demonstrates a necrotizing endothelial infection by a virus related to the ubiquitous BK virus. Since the BK and JC polyomaviruses do not infect or damage these cells, the infection represents an extension of their usual tissue tropism.
For polyomaviruses to infect cells, the virions must enter the cell, be transported to the nucleus, and replicate. Electron microscopy in this case revealed BK viral particles localized to caveolar organelles; some of the particles were attached to the abluminal surface, and others to the nuclear membrane. These findings suggest that the virions entered the cell and were transported to the nucleus through caveolae. SV40 has a similar mechanism of cellular infection,19 whereas the JC virus enters glial cells through clathrin-dependent endocytosis.19,20
Nuclear replication of polyomavirus requires regulatory and early regions of its genome. The noncoding regulatory regions resemble mammalian promoters and enhancers, suggesting that they act as transcription-factor–binding sites to promote efficient transcription of the viral early region.1 Nonmutated viruses are most commonly found in urine specimens. Rearranged regulatory sequences and coding-region mutations are associated with altered specificity with respect to target cells, increased pathogenicity, or both.21,22,23,24,25 In the present case, the fragment of the T gene that was sequenced was 96 percent homologous with the known BKDUN strain, with a change of two amino acids in composition. Although we do not think that these mutations alone are responsible for the altered tissue tropism,25 we have not been able to amplify the regulatory region, suggesting that the virus has additional mutations in this area. Thus, the molecular basis for the tropism of this viral variant is unknown.
Supported by grants from the Department of Pathology, Beth Israel Deaconess Medical Center, and from the National Institutes of Health (AI/HL 44066, to Dr. Dvorak, and NS01919, to Dr. Koralnik).
We are indebted to Martha Pavlakis, William Quist, Azita Djalilvand, Michael S. Forman, Mary Albrecht, David Shaffer, and Isaac Stillman for their assistance and to Maneth Gravell (National Institutes of Health) for valuable discussions regarding serologic studies of the BK and JC viruses.
Source Information
From the Department of Pathology (T.P.-H., J.K., A.M.D., R.M.-E., P.C.D., M.U., J.T.J.), the Division of Infectious Diseases, Department of Internal Medicine (G.S.), the Division of Viral Pathogenesis (I.J.K., L.-A.P.), and the Department of Neurology (I.J.K., J.T.J.), Beth Israel Deaconess Medical Center and Harvard Medical School, Boston; the Division of Neuropathology, Department of Pathology, Brigham and Women's Hospital and Harvard Medical School, Boston (U.D.); and the Laboratory of Molecular Medicine and Neuroscience, National Institute of Neurological Disorders and Stroke, Bethesda, Md. (E.O.M.).
Address reprint requests to Dr. Joseph at the Department of Neurology, KS418, Beth Israel Deaconess Medical Center, 330 Brookline Ave., Boston, MA 02115, or at jjoseph{at}caregroup.harvard.edu.
References
| |||||||||||||||||||||||||||||||
This article has been cited by other articles:
HOME | SUBSCRIBE | SEARCH | CURRENT ISSUE | PAST ISSUES | COLLECTIONS | PRIVACY | TERMS OF USE | HELP | beta.nejm.org Comments and questions? Please contact us. The New England Journal of Medicine is owned, published, and copyrighted © 2009 Massachusetts Medical Society. All rights reserved. |
Previous
