| |||||||||||||||||||||||||||||||
We describe two sisters, one the donor and the other the recipient of a bone marrow transplant, in whom subcutaneous panniculitic T-cell lymphoma5,6 developed three years after the procedure. The finding of identical T-cell clones in the tumors of both sisters implicated the transfer of neoplastic T cells during bone marrow transplantation as the cause of the recipient's subcutaneous lymphoma.
Case Reports
A 19-year-old woman presented in 1993 with stage IVB, anaplastic large-cell lymphoma of T-cell lineage (Ki-1 lymphoma). She had a complete remission after treatment with cyclophosphamide, doxorubicin, vincristine, and prednisone (CHOP) followed by etoposide, vincristine, doxorubicin, cyclophosphamide, and prednisone, but lymphomatous meningitis later developed. After conditioning therapy, she received a T-cell–depleted bone marrow transplant from her HLA-identical sister, who was 25 years old, and again entered a remission. She died of an independent lymphoma eight years after the initial diagnosis and seven and a half years after the transplant.
Three and a half years after the transplantation, the marrow donor presented with eczematous dermatitis on her legs, a nodule on her left arm, and fever. Biopsy of the nodule revealed lobular lymphocytic panniculitis with perivascular lymphocytes. Biopsy of a persistent nodule on her leg revealed an ulcerated epidermis overlying a dense lobular subcutaneous infiltrate composed of pleomorphic, atypical lymphocytes that surrounded adipocytes (Figure 1). The atypical cells were positive for CD3, CD8, granzyme B, and TIA-1 (a granular protein of cytotoxic T cells) and negative for CD56 and CD20. The infiltrate contained a monoclonal population of T cells with rearranged T-cell receptor 
(TCR) genes and was negative for Epstein–Barr virus on in situ hybridization.
|
One month before her sister's death the recipient was seen for a one-year history of skin lesions on her legs. Physical examination showed eczematous plaques and nodules on the lower part of both legs. Histologic examination of a nodule revealed many similarities to the subcutaneous panniculitic T-cell lymphoma identified in her sister, including atypical T cells infiltrating the dermis and subcutis, with rimming of adipocytes. The subcutaneous tumor cells were positive for CD3, CD8, TIA-1, and granzyme B and negative for CD30 (Ki-1) and CD56. Polymerase-chain-reaction (PCR) assessment of this tumor revealed a monoclonal rearrangement of the TCR gene. In situ hybridization was negative for Epstein–Barr virus. The findings in the subcutaneous nodule were consistent with a diagnosis of subcutaneous panniculitic T-cell lymphoma rather than a recurrence of the original lymphoma.
The similarities of the sisters' tumors raised the suspicion that the lymphoma had been transmitted from the donor to the recipient during bone marrow transplantation. Therefore, further tests were conducted.
Methods
Specimen Collection, Histochemical Analysis, and Isolation of DNA
Peripheral-blood specimens were obtained from the donor and the recipient before transplantation and from the recipient periodically after transplantation. Tumor-biopsy specimens from the two sisters were prepared for histologic examination according to standard techniques. The specimens were stained with the following immunohistochemical stains: CD3 (dilution, 1:300) (Dako, Carpinteria, Calif.), CD4 (dilution, 1:10) (Vector, Burlingame, Calif.), CD8 (dilution, 1:20) (Dako), CD20 (dilution, 1:1000) (Dako), CD30 (dilution, 1:180) (Dako), and TIA-1 (dilution, 1:500) (Coulter, Miami, Fla.). DNA was isolated according to standard methods.7
PCR for TCR Gene Rearrangements
After informed consent was obtained from the patient and her mother, a two-step PCR assay was used to identify rearrangements of the TCR subunit gene.8,9,10,11 The sizes of the PCR products were determined with the use of capillary electrophoresis (model 310, Applied Biosystems, Foster City, Calif.).
Microsatellite Analysis
Peripheral-blood samples obtained from the donor and recipient before transplantation and specimens of subcutaneous panniculitic T-cell lymphoma from the two sisters were assessed for nine microsatellite loci by PCR with use of a forensics identity-testing kit (ABI Profiler, Applied Biosystems).
Tumor-Specific PCR Analysis
Cycle sequencing of the TCR PCR products was performed directly or after cloning into a TA cloning vector (One-Shot INV-
, Invitrogen, Carlsbad, Calif.) with use of a dye-terminator method (Big Dye, Terminator Cycle Sequencing Ready Reaction Kit, Applied Biosystems). Initial linear amplification of TCR was performed as previously described.9 The second, tumor-specific PCR was performed with the use of TV-, a standard forward primer, and TJ-N(R) (5'GAGTTTCTTATGGAGGCGGG3'), a tumor-specific reverse primer, for 45 cycles. The TJ-N(R) primer is specific for the unique N-region and joining-region sequences identified in the lymphomas from the donor and recipient; N regions are sites of insertion or deletion of bases during the rearrangement of T-cell receptor genes.
Results
The Size of the Rearranged TCR Genes
The DNA products (amplicons) generated by PCR analysis of randomly rearranged TCR alleles vary in size and base sequence (Figure 2A). PCR analysis of subcutaneous panniculitic T-cell lymphomas from the donor (Figure 2B) and the recipient (Figure 2C) produced amplicons of the same size (181 bases), findings consistent with the presence of identical T-cell clones in the two tumors. Similar analysis of the recipient's original Ki-1 lymphoma did not reveal this T-cell clone (data not shown).
|
We assessed whether the recipient's post-transplantation lymphoma was derived from donor or recipient cells using an identity-testing PCR kit that amplifies nine microsatellite loci. Figure 3 illustrates the result at one locus. The germ-line patterns of the donor's cells (Figure 3A) and recipient's cells (Figure 3B) differ. The patterns in the donor's lymphoma (Figure 3C) and the recipient's lymphoma (Figure 3D) were identical; both matched the donor's germ-line pattern. At other loci tested (data not shown), donor alleles were also the dominant pattern in the recipient's subcutaneous panniculitic T-cell lymphoma.
|
Genes
We sequenced the TCR gene PCR products from the subcutaneous-lymphoma specimens from the donor and recipient to identify the TCR gene rearrangements. To do so, PCR amplicons were cloned, and the resulting sequences of the cloned products were identical in both tumors (Figure 4). Particularly relevant were the identical N regions in the two tumors (Figure 4). N regions are unique clonal markers because they are sites of random insertions and deletions of bases during the rearrangement of T-cell receptor genes.
|
On the basis of the above sequencing data, we designed a tumor-specific assay using a PCR primer complementary to the unique joining-region and N-region sequences of the neoplastic clone (Figure 4). We validated the results of the assay using a tumor sample from the recipient (Figure 5A). Controls, consisting of three polyclonal and five unrelated monoclonal samples, were not amplified by the tumor-specific primer (data not shown).
|
clone identical in size to that in her tumor (Figure 5C), demonstrating that her blood contained clonal T cells when her marrow cells were harvested. The tumor-specific PCR analysis of bone marrow obtained from the recipient before transplantation showed no evidence of the malignant clone, but multiple samples of bone marrow and peripheral blood obtained after transplantation (from 1994 to 1999) were positive for the donor's clonal TCR rearrangement. These data show that the donor's neoplastic T-cell clone persisted in the recipient for five years before clinically evident disease appeared. Discussion
We describe the transmission of subcutaneous panniculitic T-cell lymphoma by bone marrow transplantation. This rare lymphoma, a proliferation of neoplastic T cells, is initially characterized by multiple subcutaneous nodules, especially on the arms and legs. Its behavior ranges from indolent to aggressive, and an adverse outcome is commonly associated with the hemophagocytic syndrome.5,12,13,14,15
The molecular fingerprint of this tumor, the rearrangement of its TCR gene, permitted us to document not only that the subcutaneous tumor in the recipient originated in the donor but also that there was a long period of latency (three years) before the neoplasm became clinically evident.
Patients who undergo bone marrow transplantation are at risk for the transmission of a variety of conditions.16,17 Although the risk of a secondary hematologic cancer is increased by a factor of four to seven,3,18,19 reflecting the mutagenicity of the preparative regimens for transplantation, the transmission of neoplastic tissue by bone marrow and solid-organ transplantation is uncommon. Acute promyelocytic leukemia has been transferred by the transplantation of a cadaveric liver allograft,20 metastatic glioblastoma multiforme has been transferred in kidney and liver transplants,21,22 and acute myeloid leukemia has been transmitted by the transplantation of donor bone marrow.4
Using molecular techniques, we have identified a case of transmission of subcutaneous T-cell lymphoma by a bone marrow transplantation. One important aspect of this case is that two independent T-cell lymphomas (the recipient's original anaplastic large-cell lymphoma and the donor's subcutaneous panniculitic T-cell lymphoma) arose in two sisters at young ages. Although it is tempting to postulate that there was a common genetic or infectious cause, these lymphomas appear to be clinically and histologically distinct from the familial lymphoma syndromes that arise in patients with Epstein–Barr virus or human T-cell lymphotropic virus type I infections.23,24,25 Moreover, tests of the bone marrow recipient were negative for both these infectious agents. It is also interesting to consider the possibility that with increasing age and a corresponding increase in the frequency of occult neoplasms in older donors, the likelihood of the transfer of a tumor during transplantation will increase. Methods for preventing such transfers may require the transplantation of highly purified stem cells or the development of more sensitive screening assays for neoplastic cells.
We are indebted to Drs. William Baldwin, Steven Desidario, Frederick Racke, Noel Rose, and Johnathan Schneck for helpful discussions; to Dr. Terry Barrett for critical review of the manuscript; to Cynthia Glaser, M.T., Karen Miller, M.T., Michael Hafez, M.T., and Lisa Cooper, M.T., for technical assistance; and to Anita Hawkins for cytogenetic analysis.
Source Information
From the Departments of Pathology (K.D.B., K.M.H., M.G.G., K.M.M., C.A.G., L.S.R.-V., M.J.B., J.R.E.), Dermatology (N.K.B., K.M.H., H.C.N.), Medicine (M.G.G.), and Oncology (K.D.B., M.G.G., R.J.J., C.A.G., L.S.R.-V., J.R.E.), Johns Hopkins School of Medicine, Baltimore; and the Department of Hematology and Oncology, Geisinger Medical Center, Danville, Pa. (A.M.).
Address reprint requests to Dr. Eshleman at the Department of Pathology, 632 Ross Bldg., 720 Rutland Ave., Baltimore, MD 21205, or at jeshlema{at}jhmi.edu.
References
| |||||||||||||||||||||||||||||||
This article has been cited by other articles:
HOME | SUBSCRIBE | SEARCH | CURRENT ISSUE | PAST ISSUES | COLLECTIONS | PRIVACY | TERMS OF USE | HELP | beta.nejm.org Comments and questions? Please contact us. The New England Journal of Medicine is owned, published, and copyrighted © 2009 Massachusetts Medical Society. All rights reserved. |
Previous
