A correction has been published: N Engl J Med 2002;346(22):1748.
| |||||||||||||||||||||||||||||||||||||||||||||||||||
We describe an adult man who had hypophosphatemic osteomalacia for several years before an octreotide scan revealed a mesenchymal tumor in his left thigh. Moreover, subcutaneous administration of octreotide, a synthetic somatostatin analogue, abolished renal tubular phosphate wasting before subsequent surgical removal of the tumor.
Case Report
A 50-year-old man presented with chronic pain of the spine, ribs, femurs, and tibias. The clinical examination was otherwise normal. There was no family history of metabolic bone disease.
The initial evaluation in July 1997 revealed elevated urinary phosphorus excretion, low serum phosphorus levels, and elevated serum alkaline phosphatase and osteocalcin levels. The serum values for calcium, parathyroid hormone, 25-hydroxyvitamin D3, and calcitonin were normal; the serum value for 1,25-dihydroxyvitamin D3 was inappropriately low (6.9 pg per milliliter; normal range, 35 to 80). The diagnostic evaluation at this time provided no evidence of tumor. Multiple rib fractures were identified. A bone scan with technetium-99m–labeled 2,3-dicarboxypropane-1,1-diphosphonate showed a pattern of focal, late-phase enhancement in the spine and ribs; this was suggestive of metabolic bone disease. The patient was given the diagnosis of idiopathic hypophosphatemic osteomalacia with renal phosphate wasting. Continuous oral supplementation with phosphate and 1,25-dihydroxyvitamin D3 (1.25 µg per day) was initiated. Three years after the initial diagnosis, progressive metabolic bone disease prompted another extensive evaluation.
Methods
Assays
Serum, plasma, and urinary constituents were measured by standard techniques. Hormone measurements were performed with the use of commercial immunoassay kits. Assays of serum parathyroid hormone, 25-hydroxyvitamin D3, 1,25-dihydroxyvitamin D3, and calcitonin were performed with commercial kits (DPC Biermann, Bad Nauheim, Germany), as were those for osteocalcin (Diagnostic Systems Laboratories, Sinsheim, Germany) and urinary type I collagen C-telopeptides (Beckmann Coulter, Krefeld, Germany). For calculation of renal clearance of phosphate, serum and urinary concentrations of phosphorus were determined together with the excreted urinary volume during two one-hour collection periods (Table 1).
|
Imaging Studies and Octreotide Therapy
We performed nuclear magnetic resonance, angiographic, and scintigraphic studies using octreotide labeled with indium-111 as a tracer according to standard techniques. Before surgery, unlabeled octreotide (Sandostatin, Novartis Pharma, Nuremburg, Germany) was administered subcutaneously at a dose of 50 µg three times a day for five days and then at a dose of 100 µg three times a day for eight days.
Expression of Somatostatin-Receptor Subtypes
Expression of messenger RNA (mRNA) for somatostatin-receptor subtypes in tumor samples was analyzed by the reverse-transcriptase–polymerase chain reaction (RT-PCR). Total RNA was extracted from tumor tissue by a modified single-step technique (Trizol, GIBCO, Life Technologies, Gaithersburg, Md.). RNA was reverse transcribed with use of oligo-dT12-18 primers with reverse transcriptase (Superscript, GIBCO, Life Technologies). For PCR reactions, the following oligonucleotides specific for human somatostatin receptor subtypes 1, 2, 3, 4, and 5 were used: somatostatin receptor subtype 1 (318-bp PCR product), sense primer, 5'ATGGTGGCCCTCAAGGCCGG3', antisense primer, 5'CGCGGTGGCGTAATAGTCAA3'; somatostatin receptor subtype 2 (318-bp PCR product), sense primer, 5'TCCTCTGGAATCCGAGTGGG3', antisense primer, 5'TTGTCCTGCTTACTGTCACT3'; somatostatin receptor subtype 3 (332-bp PCR product), sense primer, 5'TGCCACCCTGGGCAACGTGT3', antisense primer, 5'CAGGCAGAATATGCTGGTGA3'; somatostatin receptor subtype 4 (323-bp PCR product), sense primer, 5'GCGCGCGGCGACCTACCGGC3', antisense primer, 5'GCCTGGTGATTTTCTTCTCC3'; and somatostatin receptor subtype 5 (259-bp PCR product), sense primer, 5'CTGGTGGGGCCGGCGCCCTC3', antisense primer, 5'CCAGGCGGCACAGGACGGGG3'. The cycling conditions for the PCR reactions were 1 cycle at 94°C for 2 minutes and 28 cycles at 94°C for 30 seconds, 62°C for 30 seconds, and 72°C for 45 seconds. The identity of the PCR products was confirmed by sequencing (data not shown).
Expression of mRNA for Matrix Extracellular Phosphoglycoprotein and Fibroblast Growth Factor 23
Expression of mRNA for matrix extracellular phosphoglycoprotein and fibroblast growth factor 23 in tumor samples was analyzed by RT-PCR. The PCR conditions for matrix extracellular phosphoglycoprotein were as previously described.9
The following oligonucleotides were used for fibroblast growth factor 23: sense primer, 5'GGCGCACCCCATCAGACCATC3', and antisense primer, 5'GCCCGTTCCCCCAGCGTGCGTGTT3'. The cycling conditions for the PCR reactions were 1 cycle at 94°C for 2 minutes and 28 cycles at 94°C for 30 seconds, 60°C for 30 seconds, and 72°C for 45 seconds. The identity of the PCR products was confirmed by sequencing (data not shown).
Results
Excessive osteomalacia with osteoidosis (an excess of nonmineralized organic bone matrix) was found in a bone-biopsy specimen derived from the iliac crest. Laboratory findings are summarized in Table 1. Findings consistent with the diagnosis of renal phosphate wasting included elevated renal phosphate clearance and low serum phosphorus levels despite ongoing oral phosphate therapy. The serum level of 1,25-dihydroxyvitamin D3 was at the lower end of the normal range despite oral supplementation. The threshold for renal tubular reabsorption of phosphate, which is largely independent of oral phosphate therapy, was significantly reduced. The serum levels of alkaline phosphatase, osteocalcin, and urinary type I collagen C-telopeptides were elevated.
Since we were unable to locate a tumor, an octreotide scan was performed that showed circumscript pooling of radioactive octreotide tracer in the left thigh (Figure 1A). Magnetic resonance imaging and angiography revealed a well-vascularized mass of 5.5 by 4.5 by 3.0 cm within the laterodorsal section of the vastus lateralis muscle (Figure 1B).
|
|
-actin, desmin, keratin markers, CD34, CD31, S100 protein, and HMB-45. The proportion of cells with a proliferative phenotype was less than 10 percent. Mitotic figures, necrotic areas of the tumor, invasion of blood vessels, and cytologic atypia could not be found (data not shown). Since removal of the tumor, phosphate metabolism has remained normal without further oral phosphate therapy (Figure 2).
RT-PCR analysis of tumor-derived RNA samples showed predominant expression of somatostatin receptor subtype 2 mRNA and a faint positive reaction for somatostatin receptor subtype 5 mRNA, whereas subtypes 1, 3, and 4 were absent (Figure 3). The mRNA for matrix extracellular phosphoglycoprotein8 and fibroblast growth factor 23 was abundantly expressed (Figure 4).
|
|
Discussion
Tumor-induced osteomalacia with tumors that are predominantly derived from the mesenchyme is a paraneoplastic syndrome of renal phosphate wasting due to secretion of phosphaturic factors, termed phosphatonins.1 Because the tumor caused no symptoms in our patient, diagnosis of the tumor was delayed for several years. We hypothesized that tumors secreting phosphatonins may express somatostatin receptors that regulate secretory activity, as has been shown in other endocrine tumors.10,11 We were able to detect a previously unrecognized tumor by scintigraphy using octreotide labeled with indium-111, as has been done in similar cases.10,11 In addition, we were able to achieve complete preoperative remission of renal phosphate wasting in our patient by octreotide therapy through a mechanism that most likely involved suppression of phosphatonin secretion.
The finding of somatostatin receptor subtype 2 expression in the tumor provides the molecular basis for the positive octreotide scan and the clinical response to octreotide therapy (Table 1 and Figure 2), because subtype 2 displays the highest affinity for octreotide of all five somatostatin-receptor isoforms.12
Phosphate metabolism in humans is regulated by hormonally modified intestinal uptake and renal excretion, through interaction with the vitamin D–parathyroid hormone–calcium endocrine system.13 1,25-Dihydroxyvitamin D3 stimulates intestinal uptake of phosphate and inhibits renal excretion,14 whereas parathyroid hormone is phosphaturic.15 Renal phosphate excretion is regulated mainly through the activity of the renal tubular type IIa sodium–inorganic phosphate cotransporter.16 Studies of hereditary and tumor-associated phosphate-wasting disorders suggest that several other factors must be involved in the regulation of phosphate metabolism. The present view holds that the product of the PHEX gene (phosphate-regulating gene with homologies to endopeptidases on the X chromosome) is an endopeptidase that cleaves secreted phosphaturic hormone–like substances — the phosphatonins.1,17 Thus, hypophosphatemic rickets may be caused by disorders of the sodium–inorganic phosphate cotransporter itself, of the phosphatonins as modifiers of renal phosphate transport, or of the endopeptidase PHEX, which cleaves phosphatonins. In support of this concept, inactivating mutations of the PHEX gene are associated with the clinical phenotype of X-linked hypophosphatemic rickets.2
The tumor-induced form of hypophosphatemic rickets (oncogenic osteomalacia) has recently been shown to be associated with overexpression of fibroblast growth factor type 23 in tumor cells, which indicates that fibroblast growth factor type 23 is one of the causative phosphatonins for this disease.18 We found ample expression of the phosphatonin fibroblast growth factor type 23 in our patient's tumor. Thus, the clinical response to octreotide therapy in this patient may suggest that secretion of fibroblast growth factor type 23 by the tumor can be modulated through the somatostatin-receptor signaling pathway. This protein has further been demonstrated to act as both a substrate for the endopeptidase PHEX and an inhibitor of phosphate transport in kidney cells.19 Moreover, in the autosomal dominant form of hypophosphatemic rickets, mutations in fibroblast growth factor type 23 have been identified that render the molecule resistant to cleavage by PHEX.3
The patient's laboratory values provided no evidence of major effects of octreotide therapy on glomerular filtration or renal perfusion through the growth hormone–insulin-like growth factor I axis (Table 1). In patients with acromegaly who were treated with octreotide, minor increases in serum parathyroid hormone levels within the normal range have previously been reported.20 We believe, however, that the main reason for the transient overt hyperparathyroidism in our patient was the normalization of serum phosphorus levels that led to a disinhibition of secretion of parathyroid hormone (Table 1 and Figure 2), despite unchanged serum calcium levels.
We conclude that octreotide imaging is a valuable diagnostic tool in patients with phosphate wasting but with no family history and with no clinically apparent tumor. Moreover, we propose that in patients in whom surgery cannot be performed for technical reasons or because of coexisting conditions, phosphate wasting may be relieved by treatment with somatostatin analogues, given that the tumor expresses somatostatin receptors, which can easily be evaluated by octreotide scanning.
This case suggests that regulation of phosphate metabolism involves secretory mechanisms that may be modulated by somatostatin receptors. Whether this holds true only under pathologic conditions or is relevant to phosphate metabolism in normal states remains to be elucidated.
We are indebted to the patient for his collaboration in this study; to the staff of the endocrine laboratory for the hormone assays; to Sandra Royer for expert technical assistance in the expression studies; and to Günter Delling, M.D., for histopathologic evaluation of bone-biopsy specimens.
Source Information
From the Division of Endocrinology, Metabolism, and Molecular Medicine, Medizinische Poliklinik (J.S., K.E., F.J.); and the Departments of Pathology (J.M.), Orthopedic Surgery (J.E., C.H., N.S.), Nuclear Medicine (E.W.), and Radiology (G.S., W.K.), University of Würzburg — both in Würzburg; the Division of Endocrinology of the Department of Internal Medicine I, University of Regensburg, Regensburg (K.-D.P.); and Tirschenreuth (H.R.) — all in Germany.
Address reprint requests to Dr. Jakob at the Division of Endocrinology, Metabolism, and Molecular Medicine, Medizinische Poliklinik, University of Würzburg, Klinikstr. 6-8, 97070 Würzburg, Germany, or at jakob.medpoli{at}mail.uni-wuerzburg.de.
References
| |||||||||||||||||||||||||||||||||||||||||||||||||||
Related Letters:
Octreotide for Tumor-Induced Osteomalacia
Paglia F., Dionisi S., Minisola S., Seufert J., Jakob F.
Extract |
Full Text |
PDF
N Engl J Med 2002;
346:1748-1749, May 30, 2002.
Correspondence
This article has been cited by other articles:
HOME | SUBSCRIBE | SEARCH | CURRENT ISSUE | PAST ISSUES | COLLECTIONS | PRIVACY | TERMS OF USE | HELP | beta.nejm.org Comments and questions? Please contact us. The New England Journal of Medicine is owned, published, and copyrighted © 2009 Massachusetts Medical Society. All rights reserved. |
Previous
