FREE NEJM E-TOC    HOME   |   SUBSCRIBE   |   CURRENT ISSUE   |   PAST ISSUES   |   COLLECTIONS   |   Search Term  Advanced Search

Sign in | Get NEJM's E-Mail Table of Contents — Free | Subscribe

Previous Volume 346:243-249 January 24, 2002 Number 4 Next

Abstract PDF PDA Full Text PowerPoint Slide Set Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited PubMed Citation

ABSTRACT

Background Inherited hearing impairment affects about 1 in 2000 newborns. Up to 50 percent of all patients with autosomal recessive nonsyndromic prelingual deafness in different populations have mutations in the gene encoding the gap-junction protein connexin 26 (GJB2) at locus DFNB1 on chromosome 13q12. However, a large fraction (10 to 42 percent) of patients with GJB2 mutations have only one mutant allele; the accompanying mutation has not been identified. DFNB1-linked familial cases with no mutation in GJB2 have also been reported.

Methods We evaluated 33 unrelated probands with nonsyndromic prelingual deafness who had only one GJB2 mutant allele. Nine subjects had evidence of linkage to DFNB1. We used haplotype analysis for markers on 13q12 to search for mutations other than the one involving GJB2.

Results We identified a 342-kb deletion in the gene encoding connexin 30 (GJB6), a protein that is reported to be expressed with connexin 26 in the inner ear. The deletion extended distally to GJB2, which remained intact. The break-point junction of the deletion was isolated and sequenced, and a specific diagnostic test was developed for this common mutation. Twenty-two of the 33 subjects were heterozygous for both the GJB6 and GJB2 mutations, including all 9 with evidence of linkage to DFNB1. Two subjects were homozygous for the GJB6 mutation.

Conclusions A 342-kb deletion in GJB6 is the second most frequent mutation causing prelingual deafness in the Spanish population. Our data suggest that mutations in the complex locus DFNB1, which contains two genes (GJB2 and GJB6), can result in a monogenic or a digenic pattern of inheritance of prelingual deafness.

Anywhere from 10 to 42 percent of patients with GJB2 mutations have only one mutant GJB2 allele,^{2,3,4,5,6,7,8,9,10,11,12,13,18} and some familial cases have evidence of linkage to the DFNB1 locus but have no mutation in GJB2.^2,5 It was therefore postulated that another gene close to GJB2 might be responsible for these cases.^2,4,6,12,19 The gene encoding connexin 30 (GJB6) was an obvious candidate, since connexin 30 is expressed in the same inner-ear structures as connexin 26 and both connexins are functionally related.^20,21 However, previous molecular studies did not reveal any mutation in GJB6 that was associated with autosomal recessive hearing impairment.^12,19,22 We sought to identify a mutation in this gene.

Methods

Subjects

We enrolled 422 unrelated families (364 from Spain and 58 from Cuba) that had members with prelingual, sensorineural, nonsyndromic hearing impairment. A total of 167 Spanish and 26 Cuban families had at least two affected members and an autosomal recessive pattern of inheritance (familial cases), and 197 Spanish and 32 Cuban families had only one affected member (sporadic cases). Familial cases included 52 Spanish and 5 Cuban sibships and 115 Spanish and 21 Cuban families with affected members in more than one generation.

Written informed consent was obtained from all the subjects included in the study or their parents. Family members with features of syndromic hearing impairment, as well as those with putative environmental causes, were excluded on the basis of their history and findings on clinical examination. Otoscopic examination, tympanometry with acoustic reflex testing, and tuning-fork tests were carried out systematically to rule out a conductive hearing loss. Pure-tone audiometry was performed to evaluate air conduction (frequencies, 250 to 8000 Hz) and bone conduction (frequencies, 250 to 4000 Hz).

Genetic Techniques

DNA was extracted from peripheral blood according to standard procedures. The primers and conditions for polymerase-chain-reaction (PCR) amplification of the microsatellite markers have been described previously.^23,24,25 Other primers and PCR conditions are described in Supplementary Appendix 1, available with the full text of this article at http://www.nejm.org. Fluorescently labeled alleles were analyzed with an ABI Prism 310 Genetic Analyzer (Applied Biosystems). Mutation detection was performed by heteroduplex analysis on Mutation Detection Enhancement gels (MDE, FMC Bioproducts) as described previously.^26,27 DNA sequencing was performed in an ABI Prism 310 Genetic Analyzer.

Southern Blotting

Total digests of genomic DNA (15 µg) were blotted onto Zeta-Probe GT membranes (Bio-Rad). Probes were labeled by random priming with [³²P]deoxycytidine triphosphate with the use of the High Prime kit (Roche). Hybridization was performed with a moderate level of stringency in Church buffer (0.5 M sodium phosphate buffer at a pH of 7.2, 7 percent sodium dodecyl sulfate, and 1 mM EDTA at a pH of 8.0) at 65°C overnight. Membranes were washed three times in 2x standard sodium citrate buffer (300 mM sodium chloride and 30 mM sodium citrate) with 0.1 percent sodium dodecyl sulfate at 65°C and exposed to Kodak X-OMAT AR film for 10 days at –30°C.

Results

A total of 422 unrelated subjects from Spain and Cuba who had prelingual nonsyndromic hearing impairment with a mode of inheritance that was compatible with an autosomal recessive pattern were assessed for mutations in GJB2. Of these 422 subjects, 129 had mutations in both alleles of GJB2, 249 had no identifiable mutation in GJB2, and 44 had a mutation in one allele of the gene but no mutations in either the coding region or the splice sites of the other allele. The 44 heterozygous subjects and their relatives underwent genotyping for four microsatellite markers (D13S141, D13S175, D13S1275, and D13S292) that are close to GJB2 on 13q12.^23,24 Haplotype analysis for these markers ruled out linkage to DFNB1 in 11 subjects, suggesting that they were coincidental carriers of the mutation; this result was expected, given the high carrier frequency of GJB2 mutations in the Spanish population (2.5 percent for the most frequent mutation, the deletion of guanine at position 35 [35delG])²⁸ (and unpublished data). In 24 subjects, haplotype analysis was not informative. Finally, nine subjects (eight Spanish and one Cuban) had findings indicative of linkage to DFNB1, suggesting that another mutation on 13q12 accompanied the GJB2 mutation.

Haplotype analysis also yielded two unexpected results. First, the lack of consistency in the segregation of the alleles of marker D13S175 in nine families suggested the presence of an unamplifiable allele. Second, the two affected daughters (Subjects II-1 and II-2 in Figure 1) of parents who had severe deafness and who were heterozygous for the 35delG mutation in GJB2 had inherited the wild-type GJB2 allele from each parent, as shown by direct testing and haplotype analysis. It was not possible to amplify marker D13S175 from Subjects II-1 and II-2, with the use of either a pair of primers described in the literature²³ or an alternative primer pair designed on the basis of the sequences flanking the (CA)_n repeat. These results were consistent with the occurrence of a deletion involving at least the D13S175 marker.

View larger version (33K): [in this window] [in a new window]   Figure 1. Map of the Region of GJB6 on Chromosome 13q12 Affected by the 342-kb Deletion, Referred to as the (GJB6-D13S1830) Deletion (Panel A); Map of Exon 3 of GJB6 (Panel B); and Pedigree and Results of Southern Blot Analysis of One Spanish Family (Panels C and D). Panel A shows a 600-kb DNA segment that includes the segment affected by the (GJB6-D13S1830) deletion and flanking sequences (National Center for Biotechnology Information accession number, NT_009917.3). The positions of the seven markers and four sequence-tagged sites (STS) are indicated. The location of two other genes in the region is shown: the gene encoding -crystallin (LOC51084) and the gene that encodes probe hTg737 (TG737 ), which has been implicated in polycystic kidney disease. The two break points of the deletion are marked by vertical arrows, and the extent of the deletion is indicated by the dashed line. Panel B shows the 4-kb segment of DNA that contains the third exon of the GJB6 gene and flanking sequences. UTR denotes untranslated region, and CDS coding sequence. Restriction sites, either PstI or SspI, are indicated. The positions of the probes used in the Southern blot analysis are indicated below exon 3. The arrowhead indicates the deletion break point within GJB6. Panel C shows the results of Southern blot analysis in a Spanish family with severe deafness. Probe 2R was used on SspI digests of genomic DNA. A 2.2-kb wild-type (WT) band is present in the control subject and the parents. This band is absent in both children. Panel D shows the results of Southern blot analysis in the same family with probe 1R on SspI digests of genomic DNA. In addition to the 2.2-kb band, a novel 2.9-kb band, created by the deletion (del), appears faintly in the parents (both of whom are heterozygous) and more clearly in the children (both of whom are homozygous) and is absent in the control subject. Circles indicate female family members, and squares male family members.

 
To confirm and determine the extent of the deletion in this Spanish family, we tested Subjects II-1 and II-2 for sequence variance in GJB6, a gene very close to D13S175 (Figure 1A). A DNA fragment corresponding to the entire coding region of GJB6 could not be amplified by PCR in these two subjects. To determine whether the deletion of GJB6 was total or partial, we evaluated four overlapping DNA fragments (labeled A, B, C, and D in Figure 1B) spanning the entire coding region using PCR amplification. Fragment D was amplified, but fragments A, B, and C were not. We concluded that the deletion truncated the GJB6 open reading frame between nucleotides 367 and 574 (the proximal break point). The partial deletion of GJB6 was confirmed by Southern blotting (Figure 1C and Figure 1D).

To determine the distal break point of the deletion, we used PCR to amplify a set of sequence-tagged sites, which have been described or were developed by us during this work, from Subjects II-1 and II-2 (Figure 1A). Combining the results obtained for each sequence-tagged site with the data provided by the Southern blotting, we identified an interval that should contain the distal break point. We developed a specific PCR assay to amplify the break-point junction of the deletion. As expected, no PCR product was obtained from control subjects with normal hearing, but a 460-bp DNA fragment was obtained from both of the children and their parents. Sequencing of the PCR product from each parent yielded the same break-point junction (Figure 2A), indicating that both children were homozygous for the deletion. The deletion spanned 342 kb, and an examination of the break-point junction showed that the deletion involved moderately similar sequences along a very short stretch (Figure 2B), suggesting a molecular mechanism based on illegitimate recombination. We named this deletion (GJB6-D13S1830).

View larger version (27K): [in this window] [in a new window]   Figure 2. Break-Point Junction of the (GJB6-D13S1830) Deletion. Panel A shows the DNA sequences flanking the break-point junction. A DNA segment containing the break-point junction was amplified by PCR and sequenced. The plot shown corresponds to the junction of the proximal and distal break points and flanking sequences. Each peak in the plot corresponds to a nucleotide in the sequence; each base is denoted by a color: green indicates adenine (A), black indicates guanine (G), blue indicates cytosine (C), and red indicates thymine (T). The directions of the centromere and telomere of the long arm of chromosome 13 are indicated to show the orientation of the sequenced DNA fragment. The mutant GJB6 gene lacks its promoter and its first two exons, and its open reading frame is truncated between nucleotides 443 and 444; the remaining 3' part of the gene is fused to a sequence approximately 342 kb distal to GJB6. No fusion protein is formed between the truncated GJB6 coding region and the sequences sent upstream by the deletion, because an in-frame TGA stop codon precedes the break-point junction. Panel B shows the alignment of the sequences flanking the proximal and distal break points. The sequences fused by the deletion are shown in boldface type. The alignment was performed with the use of the PCGENE software package (version 6.50) and showed homology of 50 percent along 58 nucleotides.

 
We used the PCR assay specific for the (GJB6-D13S1830) deletion to evaluate 282 subjects with genetically uncharacterized cases of prelingual nonsyndromic hearing impairment and 200 control subjects with normal hearing (Table 1). We sequenced all the break-point junctions identified by screening and confirmed the presence of the (GJB6-D13S1830) deletion. The deletion was found in all nine of the subjects with evidence of linkage to DFNB1 (Table 1). The deletion was not found in the 200 unrelated control subjects. To determine the evolutionary origin of this frequent mutation, we performed a haplotype analysis for markers D13S141 and D13S1831, which flank the deletion break point and which are normally separated by about 660 kb (but only by 320 kb once the deletion has taken place). In our subjects, the deletion was associated with two different haplotypes, both of which had the same allele for D13S141.

View this table: [in this window] [in a new window]   Table 1. Results of Screening for the 342-kb Deletion in GJB6.

 
Discussion

Nonsyndromic prelingual hearing impairment is difficult to diagnose by molecular means, because many genes are involved and there is insufficient knowledge of the individual contribution of each gene and its mutations. Therefore, most genetic analyses include routine molecular diagnosis for mutations in the GJB2 gene, since such mutations are the cause of up to 50 percent of the cases. However, the diagnostic techniques reveal only one mutant GJB2 allele in a substantial proportion of patients. Although unexplained cases may be attributable in part to intrinsic drawbacks in the techniques for the detection of mutations or to the high frequency of carriers in the population, it has long been suspected that other mutations are present in a gene or genes in the same chromosomal region. We identified a novel mutation — a deletion that truncates the GJB6 gene but does not affect the GJB2 gene — that frequently accompanied a mutation in a single GJB2 allele (i.e., a double heterozygous state) in our group of subjects with unexplained cases of nonsyndromic prelingual hearing impairment.

The frequent occurrence of subjects who were heterozygous for both the (GJB6-D13S1830) deletion and point mutations in GJB2 could be explained on the basis of either a monogenic or a digenic pattern of inheritance. In the case of a monogenic mode of inheritance, there must be a regulatory element that is essential for the expression of the GJB2 gene in the inner ear. This hypothetical element would be located far upstream of GJB2 and GJB6, and the deletion of this element would suppress the level of expression of GJB2 enough to produce a phenotype of hearing impairment. However, the existence of the GJB2 regulatory element remains merely hypothetical. An alternative interpretation would be that the deletion inactivates a second gene whose protein product is functionally related to connexin 26. Substantial experimental evidence supports the hypothesis that GJB6 is this postulated second gene. First, connexin 26 and connexin 30 are both expressed in the spiral limbus, the spiral ligament, and the stria vascularis and among the supporting cells of the organ of Corti in rat cochlea.^20,21 Both connexins were also detected in the lateral wall of the inner ear in a 22-week-old human fetus.²¹ Second, connexin 26 and connexin 30 monomers can bind each other to form heterotypic, or mixed, gap-junction channels.²⁹ Third, a mutation in GJB6 was reported in a family with autosomal dominant hearing impairment.²² Finally, in the current study, we identified three deaf patients (two patients in the family whose pedigree is shown in Figure 1 and one additional patient) who lacked a functional GJB6 gene but who had two intact GJB2 alleles.

Altogether, these data support the concept that DFNB1 is a complex locus containing two genes (GJB2 and GJB6) and that the loss of any two of the four alleles from these genes results in hearing impairment. In other words, patients with a prelingual hearing impairment could be homozygous for point mutations that inactivate GJB6 alleles or heterozygous for both the (GJB6-D13S1830) deletion and mutant GJB2 alleles. This type of complex pattern of inheritance has already been reported in other recessive disorders, notably retinitis pigmentosa.³⁰ However, these hypothetical mutations in GJB6 have not yet been identified.^12,19,22 Although the presence of the (GJB6-D13S1830) deletion may have hampered the detection of point mutations in some screening studies, the high frequency of negative results suggests that if these mutations exist, they must be rare. Screening for GJB6 mutations in other populations should help clarify this point.

Currently, only two genes in the region affected by the deletion have been sequenced: GJB6 and the gene encoding -crystallin (LOC51084), a component of the lens of the eye (the sequence is available at http://www.ncbi.nlm.nih.gov/LocusLink). Different missense mutations in GJB6 are responsible for autosomal dominant hearing loss²² or autosomal dominant hidrotic ectodermal dysplasia,³¹ probably because they encode dysfunctional proteins or cause dominant negative effects. However, to our knowledge, no pathogenic mutation in LOC51084 has been reported. Although we found no signs of skin or eye disorders in the three subjects who were homozygous for the (GJB6-D13S1830) deletion, all of them are still children. Thus, careful follow-up of their clinical status will be needed to settle this point.

Our findings indicate that the (GJB6-D13S1830) deletion is the second most frequent (after the 35delG mutation in GJB2) genetic cause of nonsyndromic prelingual hearing impairment in the Spanish population. The frequency of this deletion in other populations remains to be determined, but the deletion of marker D13S175 has been demonstrated in at least one familial case of prelingual deafness in New Zealand.³² When the current report was in press, Lerer et al.³³ reported a deletion involving the GJB6 gene in seven patients with nonsyndromic hearing loss from four unrelated Ashkenazi Jewish families. Since they did not isolate the break-point junction of the deletion, we do not know whether the mutation is the same as the one we report in the current article. All these reports, taken together, should provide new insight into the role of connexins in the auditory system. The relatively large percentages worldwide of patients with unexplained cases of prelingual deafness who are heterozygous for the GJB2 mutation suggest that the (GJB6-D13S1830) deletion or other, similar mutations are also widespread. Our results also indicate that the deletion of large portions of a chromosome can easily be missed with the use of the usual mutation-detection assays, even though they may have a high prevalence in human disease.

Supported by grants from the European Community (QLG2-CT-1999-00988), the Comision Asesora Interministerial de Ciencia y Tecnologia of the Spanish Ministerio de la Ciencia (SAF99-0025), and the Spanish Fondo de Investigaciones Sanitarias (FIS 00/0244). Dr. Villamar, Dr. Francisco del Castillo, and Ms. Álvarez were recipients of fellowships from the Comunidad de Madrid, Fundación Organizacion Nacional de Ciegos Españoles, and the Spanish Ministerio de Sanidad, respectively.

We are indebted to the families and the clinicians who participated in this study, to the Federacion Española de Asociaciones de Padres y Amigos de los Sordos for their enthusiastic support of this research, and to Luis C. Barrio for useful discussion.

Source Information

From the Unidad de Genética Molecular, Hospital Ramón y Cajal, Madrid (I.C., M.V., M.A.M.-P., F.J.C., A.A., D.T., F.M.); and the Departamento de Genética, Hospital Pediátrico William Soler, Havana, Cuba (I.M.).

Address reprint requests to Dr. Moreno at the Unidad de Genética Molecular, Hospital Ramón y Cajal, Carretera de Colmenar km. 9, 28034, Madrid, Spain, or at fmoreno{at}hrc.insalud.es.

References

1. Cohen MM Jr, Gorlin RJ. Epidemiology, etiology, and genetic patterns. In: Gorlin RJ, Toriello HV, Cohen MM Jr, eds. Hereditary hearing loss and its syndromes. Oxford monographs on medical genetics. No. 28. New York: Oxford University Press, 1995:9-21. 
2. Estivill X, Fortina P, Surrey S, et al. Connexin-26 mutations in sporadic and inherited sensorineural deafness. Lancet 1998;351:394-398. [CrossRef][Web of Science][Medline]
3. Kelley PM, Harris DJ, Comer BC, et al. Novel mutations in the connexin 26 gene (GJB2) that cause autosomal recessive (DFNB1) hearing loss. Am J Hum Genet 1998;62:792-799. [CrossRef][Web of Science][Medline]
4. Lench N, Houseman M, Newton V, Van Camp G, Mueller R. Connexin-26 mutations in sporadic non-syndromal sensorineural deafness. Lancet 1998;351:415-415. [Web of Science][Medline]
5. Scott DA, Kraft ML, Carmi R, et al. Identification of mutations in the connexin 26 gene that cause autosomal recessive nonsyndromic hearing loss. Hum Mutat 1998;11:387-394. [CrossRef][Web of Science][Medline]
6. Denoyelle F, Marlin S, Weil D, et al. Clinical features of the prevalent form of childhood deafness, DFNB1, due to a connexin-26 gene defect: implications for genetic counselling. Lancet 1999;353:1298-1303. [CrossRef][Web of Science][Medline]
7. Murgia A, Orzan E, Polli R, et al. Cx26 deafness: mutation analysis and clinical variability. J Med Genet 1999;36:829-832. [Free Full Text]
8. Abe S, Usami S, Shinkawa H, Kelley PM, Kimberling WJ. Prevalent connexin 26 gene (GJB2) mutations in Japanese. J Med Genet 2000;37:41-43. [Free Full Text]
9. Rabionet R, Zelante L, López-Bigas N, et al. Molecular basis of childhood deafness resulting from mutations in the GJB2 (connexin 26) gene. Hum Genet 2000;106:40-44. [CrossRef][Web of Science][Medline]
10. Sobe T, Vreugde S, Shahin H, et al. The prevalence and expression of inherited connexin 26 mutations associated with nonsyndromic hearing loss in the Israeli population. Hum Genet 2000;106:50-57. [CrossRef][Web of Science][Medline]
11. Wilcox SA, Saunders K, Osborn AH, et al. High frequency hearing loss correlated with mutations in the GJB2 gene. Hum Genet 2000;106:399-405. [CrossRef][Web of Science][Medline]
12. Gabriel H, Kupsch P, Sudendey J, Winterhager E, Jahnke K, Lautermann J. Mutations in the connexin26/GJB2 gene are the most common event in non-syndromic hearing loss among the German population. Hum Mutat 2001;17:521-522. [Medline]
13. Löffler J, Nekahm D, Hirst-Stadlmann A, et al. Sensorineural hearing loss and the incidence of Cx26 mutations in Austria. Eur J Hum Genet 2001;9:226-230. [CrossRef][Web of Science][Medline]
14. Goodenough DA, Goliger JA, Paul DL. Connexins, connexons, and intercellular communication. Annu Rev Biochem 1996;65:475-502. [CrossRef][Web of Science][Medline]
15. Kumar NM, Gilula NB. The gap junction communication channel. Cell 1996;84:381-388. [CrossRef][Web of Science][Medline]
16. Spicer SS, Schulte BA. The fine structure of spiral ligament cells relates to ion return to the stria and varies with place-frequency. Hear Res 1996;100:80-100. [CrossRef][Web of Science][Medline]
17. Spicer SS, Schulte BA. Evidence for a medial K⁺ recycling pathway from inner hair cells. Hear Res 1998;118:1-12. [CrossRef][Medline]
18. Wilcox SA, Osborn AH, Allen-Powell DR, Maw MA, Dahl HH, Gardner RJ. Connexin26 deafness in several interconnected families. J Med Genet 1999;36:383-385. [Free Full Text]
19. Kelley PM, Abe S, Askew JW, Smith SD, Usami S, Kimberling WJ. Human connexin 30 (GJB6), a candidate gene for nonsyndromic hearing loss: molecular cloning, tissue-specific expression, and assignment to chromosome 13q12. Genomics 1999;62:172-176. [CrossRef][Web of Science][Medline]
20. Lautermann J, ten Cate WJ, Altenhoff P, et al. Expression of the gap-junction connexins 26 and 30 in the rat cochlea. Cell Tissue Res 1998;294:415-420. [CrossRef][Web of Science][Medline]
21. Lautermann J, Frank HG, Jahnke K, Traub O, Winterhager E. Developmental expression patterns of connexin26 and -30 in the rat cochlea. Dev Genet 1999;25:306-311. [CrossRef][Web of Science][Medline]
22. Grifa A, Wagner CA, D'Ambrosio L, et al. Mutations in GJB6 cause nonsyndromic autosomal dominant deafness at DFNA3 locus. Nat Genet 1999;23:16-18. [Web of Science][Medline]
23. Dib C, Fauré S, Fizames C, et al. A comprehensive genetic map of the human genome based on 5,264 microsatellites. Nature 1996;380:152-154. [CrossRef][Medline]
24. Hudson TJ, Engelstein M, Lee MK, et al. Isolation and chromosomal assignment of 100 highly informative human simple sequence repeat polymorphisms. Genomics 1992;13:622-629. [CrossRef][Web of Science][Medline]
25. Kibar Z, Dube MP, Powell J, et al. Clouston hidrotic ectodermal dysplasia (HED): genetic homogeneity, presence of a founder effect in the French Canadian population and fine genetic mapping. Eur J Hum Genet 2000;8:372-380. [CrossRef][Web of Science][Medline]
26. White MB, Carvalho M, Derse D, O'Brien SJ, Dean M. Detecting single base substitutions as heteroduplex polymorphisms. Genomics 1992;12:301-306. [CrossRef][Web of Science][Medline]
27. Keen J, Lester D, Inglehearn C, Curtis A, Bhattacharya S. Rapid detection of single base mismatches as heteroduplexes on hydrolink gels. Trends Genet 1991;7:5-5. [CrossRef][Web of Science][Medline]
28. Gasparini P, Rabionet R, Barbujani G, et al. High carrier frequency of the 35delG deafness mutation in European populations. Eur J Hum Genet 2000;8:19-23. [CrossRef][Web of Science][Medline]
29. Dahl E, Manthey D, Chen Y, et al. Molecular cloning and functional expression of mouse connexin-30, a gap junction gene highly expressed in adult brain and skin. J Biol Chem 1996;271:17903-17910. [Erratum, J Biol Chem 1996;271:26444.] [Free Full Text]
30. Kajiwara K, Berson EL, Dryja TP. Digenic retinitis pigmentosa due to mutations at the unlinked peripherin/RDS and ROM1 loci. Science 1994;264:1064-1068. 
31. Lamartine J, Munhoz Essenfelder G, Kibar Z, et al. Mutations in GJB6 cause hidrotic ectodermal dysplasia. Nat Genet 2000;26:142-144. [CrossRef][Web of Science][Medline]
32. Maw MA, Allen-Powell DR, Goodey RJ, et al. The contribution of the DFNB1 locus to neurosensory deafness in a Caucasian population. Am J Hum Genet 1995;57:629-635. [Web of Science][Medline]
33. Lerer I, Sagi M, Ben-Neriah Z, et al. A deletion mutation in GJB6 cooperating with a GJB2 mutation in trans in non-syndromic deafness: a novel founder mutation in Ashkenazi Jews. Hum Mutat 2001;18:460-460. [Medline]

Supplementary Appendix 1

A pair of primers was designed to amplify marker D13S175. The forward primer was 5'GTTGGTCAAAGGGTACAAACTTG3', and the reverse primer was 5'ATTACCGCAATCAAACTAAATAACTA3'. Four pairs of primers were used to amplify four overlapping fragments (A, B, C, and D) of the GJB6 coding region. Forward primer Cx30-1 (5'TCAGGGATAAACCAGCGCAAT3') and reverse primer Cx30-2 (5'ACACCGGGAAAAAGTGGTCAT3') were used to amplify fragment A. Forward primer Cx30-3 (5'GCAAGAGGACTTCGTCTGCAACA3') and reverse primer Cx30-4 (5'CGGAAAAAGATGCTGCTGGTGT3') were used to amplify fragment B. Forward primer Cx30-5 (5'AAGCACAAGGTTCGGATAGAGG3') and reverse primer Cx30-6 (5'AGCAGCAGGTAGCACAACTCTG3') were used to amplify fragment C. Forward primer Cx30-7 (5'CCATTTTTATGATTTCTGCGTCTG3') and reverse primer Cx30-8 (5'GTTGGTATTGCCTTCTGGAGAAGA3') were used to amplify fragment D. The entire coding region was amplified with the use of primers Cx30-1 and Cx30-8. Probe 1R was amplified with the use of primers GJB6-1F (5'TGGGGGACGCTGCACACTTT3') and GJB6-1R (5'TTTAGGGCATGATTGGGGTGATTT3'). Probe 2R was amplified with the use of primers GJB6-1F and GJB6-2R (5'TGCGAGTGGTTTCGTGCCTGTA3').

Two pairs of primers were developed for the sequence-tagged sites. Forward primer 5'GAAAGGAAGGTCGGGCAAGGT3' and reverse primer 5'CACAATCAAACCTCACTGCCATCTT3' were developed for STS-CX650. Forward primer 5'GTTGCTTGTGCTTTTGGTGTCAT3' and reverse primer 5'AGCCCAGAAACAAACCCTTACATA3' were developed for STS-CX680. Primers used in the polymerase-chain-reaction (PCR) assay specific for the (GJB6-D13S1830) deletion were forward primer GJB6-1R and reverse primer BKR-1 (5'CACCATGCGTAGCCTTAACCATTTT3').

All PCR amplifications were performed with use of a Perkin-Elmer GeneAmp PCR System 9600, according to the following program: 1 cycle of denaturation at 95°C for 5 minutes; 5 cycles of denaturation at 96°C for 15 seconds, with annealing for 15 seconds at 68°C for the first cycle and a reduction in temperature of 1°C for each of the next 4 cycles and extension at 72°C for 30 seconds; 25 cycles of denaturation at 96°C for 15 seconds, with annealing for 15 seconds at 63°C and extension at 72°C for 30 seconds; and a final period of extension at 72°C for 10 minutes.

Abstract PDF PDA Full Text PowerPoint Slide Set Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited PubMed Citation

This article has been cited by other articles:

• Ortolano, S., Di Pasquale, G., Crispino, G., Anselmi, F., Mammano, F., Chiorini, J. A. (2008). Coordinated control of connexin 26 and connexin 30 at the regulatory and functional level in the inner ear. Proc. Natl. Acad. Sci. USA 105: 18776-18781 [Abstract] [Full Text]  
• Nozu, K, Inagaki, T, Fu, X J, Nozu, Y, Kaito, H, Kanda, K, Sekine, T, Igarashi, T, Nakanishi, K, Yoshikawa, N, Iijima, K, Matsuo, M (2008). Molecular analysis of digenic inheritance in Bartter syndrome with sensorineural deafness. J. Med. Genet. 45: 182-186 [Abstract] [Full Text]  
• Matos, T D, Caria, H, Simoes-Teixeira, H, Aasen, T, Nickel, R, Jagger, D J, O'Neill, A, Kelsell, D P, Fialho, G (2007). A novel hearing loss-related mutation occurring in the GJB2 basal promoter. J. Med. Genet. 44: 721-725 [Abstract] [Full Text]  
• Kamiya, K., Fujinami, Y., Hoya, N., Okamoto, Y., Kouike, H., Komatsuzaki, R., Kusano, R., Nakagawa, S., Satoh, H., Fujii, M., Matsunaga, T. (2007). Mesenchymal Stem Cell Transplantation Accelerates Hearing Recovery through the Repair of Injured Cochlear Fibrocytes. Am. J. Pathol. 171: 214-226 [Abstract] [Full Text]  
• Ahmad, S., Tang, W., Chang, Q., Qu, Y., Hibshman, J., Li, Y., Sohl, G., Willecke, K., Chen, P., Lin, X. (2007). Restoration of connexin26 protein level in the cochlea completely rescues hearing in a mouse model of human connexin30-linked deafness. Proc. Natl. Acad. Sci. USA 104: 1337-1341 [Abstract] [Full Text]  
• Zariwala, M. A., Leigh, M. W., Ceppa, F., Kennedy, M. P., Noone, P. G., Carson, J. L., Hazucha, M. J., Lori, A., Horvath, J., Olbrich, H., Loges, N. T., Bridoux, A.-M., Pennarun, G., Duriez, B., Escudier, E., Mitchison, H. M., Chodhari, R., Chung, E. M. K., Morgan, L. C., de Iongh, R. U., Rutland, J., Pradal, U., Omran, H., Amselem, S., Knowles, M. R. (2006). Mutations of DNAI1 in Primary Ciliary Dyskinesia: Evidence of Founder Effect in a Common Mutation. Am. J. Respir. Crit. Care Med. 174: 858-866 [Abstract] [Full Text]  
• Siemering, K., Manji, S. S.M., Hutchison, W. M., Du Sart, D., Phelan, D., Dahl, H.-H. M. (2006). Detection of Mutations in Genes Associated with Hearing Loss Using a Microarray-Based Approach. J. Mol. Diagn. 8: 483-489 [Abstract] [Full Text]  
• Bicego, M., Beltramello, M., Melchionda, S., Carella, M., Piazza, V., Zelante, L., Bukauskas, F. F., Arslan, E., Cama, E., Pantano, S., Bruzzone, R., D'Andrea, P., Mammano, F. (2006). Pathogenetic role of the deafness-related M34T mutation of Cx26. Hum Mol Genet 15: 2569-2587 [Abstract] [Full Text]  
• Gardner, P., Oitmaa, E., Messner, A., Hoefsloot, L., Metspalu, A., Schrijver, I. (2006). Simultaneous Multigene Mutation Detection in Patients With Sensorineural Hearing Loss Through a Novel Diagnostic Microarray: A New Approach for Newborn Screening Follow-up. Pediatrics 118: 985-994 [Abstract] [Full Text]  
• Taitelbaum-Swead, R., Brownstein, Z., Muchnik, C., Kishon-Rabin, L., Kronenberg, J., Megirov, L., Frydman, M., Hildesheimer, M., Avraham, K. B. (2006). Connexin-associated deafness and speech perception outcome of cochlear implantation.. Arch Otolaryngol Head Neck Surg 132: 495-500 [Abstract] [Full Text]  
• Eiberg, H, Hansen, L, Kjer, B, Hansen, T, Pedersen, O, Bille, M, Rosenberg, T, Tranebjaerg, L (2006). Autosomal dominant optic atrophy associated with hearing impairment and impaired glucose regulation caused by a missense mutation in the WFS1 gene.. J. Med. Genet. 43: 435-440 [Abstract] [Full Text]  
• del Castillo, F J, Rodriguez-Ballesteros, M, Alvarez, A, Hutchin, T, Leonardi, E, de Oliveira, C A, Azaiez, H, Brownstein, Z, Avenarius, M R, Marlin, S, Pandya, A, Shahin, H, Siemering, K R, Weil, D, Wuyts, W, Aguirre, L A, Martin, Y, Moreno-Pelayo, M A, Villamar, M, Avraham, K B, Dahl, H-H M, Kanaan, M, Nance, W E, Petit, C, Smith, R J H, Van Camp, G, Sartorato, E L, Murgia, A, Moreno, F, del Castillo, I (2005). A novel deletion involving the connexin-30 gene, del(GJB6-d13s1854), found in trans with mutations in the GJB2 gene (connexin-26) in subjects with DFNB1 non-syndromic hearing impairment. J. Med. Genet. 42: 588-594 [Full Text]  
• Marlin, S., Feldmann, D., Blons, H., Loundon, N., Rouillon, I., Albert, S., Chauvin, P., Garabedian, E.-N., Couderc, R., Odent, S., Joannard, A., Schmerber, S., Delobel, B., Leman, J., Journel, H., Catros, H., Lemarechal, C., Dollfus, H., Eliot, M.-M., Delaunoy, J.-L., David, A., Calais, C., Drouin-Garraud, V., Obstoy, M.-F., Goizet, C., Duriez, F., Fellmann, F., Helias, J., Vigneron, J., Montaut, B., Matin-Coignard, D., Faivre, L., Baumann, C., Lewin, P., Petit, C., Denoyelle, F. (2005). GJB2 and GJB6 Mutations: Genotypic and Phenotypic Correlations in a Large Cohort of Hearing-Impaired Patients. Arch Otolaryngol Head Neck Surg 131: 481-487 [Abstract] [Full Text]  
• Leonard, N J, Krol, A L, Bleoo, S, Somerville, M J (2005). Sensorineural hearing loss, striate palmoplantar hyperkeratosis, and knuckle pads in a patient with a novel connexin 26 (GJB2) mutation. J. Med. Genet. 42: e2-e2 [Full Text]  
• Schrijver, I. (2004). Hereditary Non-Syndromic Sensorineural Hearing Loss: Transforming Silence to Sound. J. Mol. Diagn. 6: 275-284 [Abstract] [Full Text]  
• Lustig, L. R., Lin, D., Venick, H., Larky, J., Yeagle, J., Chinnici, J., Polite, C., Mhatre, A. N., Niparko, J. K., Lalwani, A. K. (2004). GJB2 Gene Mutations in Cochlear Implant Recipients: Prevalence and Impact on Outcome. Arch Otolaryngol Head Neck Surg 130: 541-546 [Abstract] [Full Text]  
• Modamio-Hoybjor, S, Moreno-Pelayo, M A, Mencia, A, del Castillo, I, Chardenoux, S, Morais, D, Lathrop, M, Petit, C, Moreno, F (2004). A novel locus for autosomal dominant nonsyndromic hearing loss, DFNA50, maps to chromosome 7q32 between the DFNB17 and DFNB13 deafness loci. J. Med. Genet. 41: e14-14 [Full Text]  
• Moreno-Pelayo, M A, Modamio-Hoybjor, S, Mencia, A, del Castillo, I, Chardenoux, S, Fernandez-Burriel, M, Lathrop, M, Petit, C, Moreno, F (2003). DFNA49, a novel locus for autosomal dominant non-syndromic hearing loss, maps proximal to DFNA7/DFNM1 region on chromosome 1q21-q23. J. Med. Genet. 40: 832-836 [Full Text]  
• Michel, V., Hardelin, J.-P., Petit, C. (2003). Molecular Mechanism of a Frequent Genetic Form of Deafness. NEJM 349: 716-717 [Full Text]  
• Alvarez, A, del Castillo, I, Pera, A, Villamar, M, Moreno-Pelayo, M A, Rivera, T, Solanellas, J, Moreno, F (2003). Uniparental disomy of chromosome 13q causing homozygosity for the 35delG mutation in the gene encoding connexin26 (GJB2) results in prelingual hearing impairment in two unrelated Spanish patients. J. Med. Genet. 40: 636-639 [Full Text]  
• Bakirtzis, G., Choudhry, R., Aasen, T., Shore, L., Brown, K., Bryson, S., Forrow, S., Tetley, L., Finbow, M., Greenhalgh, D., Hodgins, M. (2003). Targeted epidermal expression of mutant Connexin 26(D66H) mimics true Vohwinkel syndrome and provides a model for the pathogenesis of dominant connexin disorders. Hum Mol Genet 12: 1737-1744 [Abstract] [Full Text]  
• RamShankar, M, Girirajan, S, Dagan, O, Ravi Shankar, H M, Jalvi, R, Rangasayee, R, Avraham, K B, Anand, A (2003). Contribution of connexin26 (GJB2) mutations and founder effect to non-syndromic hearing loss in India. J. Med. Genet. 40: e68-68 [Full Text]  
• Slavotinek, A., Biesecker, L. G. (2003). Genetic modifiers in human development and malformation syndromes, including chaperone proteins. Hum Mol Genet 12: R45-50 [Abstract] [Full Text]  
• Teubner, B., Michel, V., Pesch, J., Lautermann, J., Cohen-Salmon, M., Sohl, G., Jahnke, K., Winterhager, E., Herberhold, C., Hardelin, J.-P., Petit, C., Willecke, K. (2003). Connexin30 (Gjb6)-deficiency causes severe hearing impairment and lack of endocochlear potential. Hum Mol Genet 12: 13-21 [Abstract] [Full Text]  
• Morton, C. C. (2002). Genetics, genomics and gene discovery in the auditory system. Hum Mol Genet 11: 1229-1240 [Abstract] [Full Text]