The New England Journal of Medicine
e-mail icon  FREE NEJM E-TOC    HOME   |   SUBSCRIBE   |   CURRENT ISSUE   |   PAST ISSUES   |   COLLECTIONS   |    Advanced Search
Sign in | Get NEJM's E-Mail Table of Contents — Free | Subscribe
 
Original Article
PreviousPrevious
Volume 346:311-320 January 31, 2002 Number 5
NextNext

Detection of APC Mutations in Fecal DNA from Patients with Colorectal Tumors
Giovanni Traverso, B.A., Anthony Shuber, M.S., Bernard Levin, M.D., Constance Johnson, R.N., M.S., Louise Olsson, M.D., David J. Schoetz, Jr., M.D., Stanley R. Hamilton, M.D., Kevin Boynton, B.S., Kenneth W. Kinzler, Ph.D., and Bert Vogelstein, M.D.

 

This Article
-Abstract
- PDF
-PDA Full Text
-PowerPoint Slide Set

Commentary
-Perspective
 by Schwartz, R. S.
-Letters

Tools and Services
-Add to Personal Archive
-Add to Citation Manager
-Notify a Friend
-E-mail When Cited

More Information
-PubMed Citation
ABSTRACT

Background Noninvasive methods for detecting colorectal tumors have the potential to reduce morbidity and mortality from this disease. The mutations in the adenomatous polyposis coli (APC) gene that initiate colorectal tumors theoretically provide an optimal marker for detecting colorectal tumors. The purpose of our study was to determine the feasibility of detecting APC mutations in fecal DNA with the use of newly developed methods.

Methods We purified DNA from routinely collected stool samples and screened for APC mutations with the use of a novel approach called digital protein truncation. Many different mutations could potentially be identified in a sensitive and specific manner with this technique.

Results Stool samples from 28 patients with nonmetastatic colorectal cancers, 18 patients with adenomas that were at least 1 cm in diameter, and 28 control patients without neoplastic disease were studied. APC mutations were identified in 26 of the 46 patients with neoplasia (57 percent; 95 percent confidence interval, 41 to 71 percent) and in none of the 28 control patients (0 percent; 95 percent confidence interval, 0 to 12 percent; P<0.001). In the patients with positive tests, mutant APC genes made up 0.4 to 14.1 percent of all APC genes in the stool.

Conclusions APC mutations can be detected in fecal DNA from patients with relatively early colorectal tumors. This feasibility study suggests a new approach for the early detection of colorectal neoplasms.


Several strategies for the early detection of colorectal tumors have been devised. Colonoscopy, sigmoidoscopy, and barium enemas are highly specific and sensitive tests for neoplasia,1,2,3,4 but they are invasive and limited by the availability of experts in the procedures and patient compliance.5,6 Testing for occult blood in the stool has been shown in some studies to reduce the incidence of and morbidity and mortality from colorectal cancer.7,8,9,10,11 These fecal occult-blood tests are noninvasive and extremely useful but not sufficiently sensitive or specific for neoplasia.12,13,14,15 Furthermore, some fecal occult-blood tests require patients to change their diet before testing or require multiple tests, potentially reducing compliance.5,16,17 There is thus a need to develop new screening tests that overcome these obstacles.

One of the most promising classes of new diagnostic markers consists of mutations in oncogenes and tumor-suppressor genes.18 Because these mutations are directly responsible for neoplastic growth, they have clear advantages over indirect markers such as fecal occult blood. Several groups have reported that mutations in cancer-related genes can be detected in the stool of patients with colorectal cancer.19,20,21,22,23,24,25,26,27,28,29,30,31,32,33 However, the sensitivities and specificities of these approaches have been limited by technical impediments or the low frequencies of detectable mutations in any specific gene.

The intent of our study was to develop a test based on a single gene that would facilitate the detection of colorectal tumors at an early stage of disease. The optimal gene for such studies is the adenomatous polyposis coli (APC) gene,34,35 since mutations in this gene generally initiate colorectal neoplasia.36 Other mutations are present only in the later stages of colorectal neoplasia, such as those in p53,37 or may be present in non-neoplastic, hyperproliferative cells, such as those in c-Ki-ras.38,39,40 However, the detection of mutations in APC presents extraordinarily difficult technical challenges. Unlike mutations in c-Ki-ras, which have been used for most previous studies because mutations are clustered at two codons, mutations in APC can occur virtually anywhere within the first 1600 codons of the gene.41 Moreover, the type of mutation (base substitutions or insertions or deletions of diverse length) varies widely among tumors. Although such APC mutations can be detected relatively easily in tumors, where they are present in every neoplastic cell, they are much harder to detect in fecal DNA, where they may be present in less than 1 in 100 APC genes in the sample. We describe an approach that allowed us to detect such mutations in fecal DNA from patients with adenomas and cancer in a precise, specific, and quantitative fashion.

Methods

Patients

A total of 74 stool samples were analyzed to determine their APC status. They were obtained from 28 patients with Dukes' stage B2 colon cancer, 28 control patients with no known colorectal tumor, and 18 patients with adenomas that were at least 1 cm in diameter. Of these 74 samples, 68 were derived from a group of 315 patients who were sequentially evaluated at the M.D. Anderson Cancer Center in Houston or surrounding hospitals between 1997 and 2000 for suspected colorectal neoplasia. Of these 315 patients, 77 had cancer: 30 had Dukes' stage B2 (T3N0M0) disease, 5 had in situ lesions, 6 had Dukes' stage A, 5 had Dukes' stage B1, 20 had Dukes' stage C, 9 had Dukes' stage D, and 2 had cancers of unknown or other classes. We chose to analyze the patients with Dukes' stage B2 cancer because this was the most common type; moreover, the effect of screening in such cases should be considerable, because they are likely to be surgically curable. We excluded 2 of the 30 patients with Dukes' stage B2 because other colonic lesions were found at colonoscopy or surgery that could have complicated the analysis. For comparison with the patients with cancer, we selected 28 control patients from among the 55 patients who proved to be tumor-free on colonoscopy. These controls were matched to the patients with cancer with regard to the reasons for initial colonoscopy and then matched as well as possible for sex and age.

In this group of 315 subjects, 12 had single adenomas that were at least 1 cm in diameter, which have a high risk of progression to cancer.42,43 We also examined stool samples from six patients from the Lahey Clinic (Burlington, Mass.) who had adenomas that were at least 1 cm in diameter. These 6 constituted all those found to have such tumors among 172 patients examined by colonoscopy between September 2000 and June 2001.

Stool samples were collected before colonoscopy from 19 of the 46 patients with neoplasia and before surgery in the remainder. All stool samples from the control patients were collected before colonoscopy. All stool samples were stored at –20°C immediately after collection and transferred to storage at –80°C within 48 hours after collection. None of the patients had familial adenomatous polyposis or hereditary nonpolyposis colon cancer. The work was carried out in accordance with the institutional review board at each participating institution. Oral or written informed consent, as mandated by the institutional review board, was obtained from all patients.

Purification of DNA

DNA was purified with the use of modifications of procedures described by Ahlquist et al.30 All stool samples were thawed at room temperature and homogenized with an Exactor stool shaker (Exact Laboratories, Maynard, Mass.). After homogenization, a 4-g stool equivalent of each sample was subjected to two centrifugations (5 minutes at 2536xg and 10 minutes at 16,500xg) to remove large and small particulate matter, respectively. Supernatants were incubated with 20 µl of RNase (0.5 mg per milliliter) for 1 hour at 37°C, followed by precipitation with 1/10 volume of 3 mol of sodium acetate per liter and an equal volume of isopropanol. The crude DNA was dissolved in 10 ml of TRIS–EDTA (0.01 mol of TRIS per liter [pH 7.4] and 0.001 mol of EDTA per liter). Hybrid capture of APC genes was performed by adding 300 µl of sample to an equal volume of 6 M guanidine isothiocyanate solution (Invitrogen, Carlsbad, Calif.) containing 20 pmol of two biotinylated sequence-specific oligonucleotides (5'CAGATAGCCCTGGACAAACCATGCCACCAAGCAGAAG-3' and 5'TTCCAGCAGTGTCACAGCACCCTAGAACCAAATCCAG3'; Midland Certified Reagent Company, Midland, Tex.). After a 12-hour incubation at 25°C, streptavidin-coated magnetic beads were added to the solution, and the tubes were incubated for an additional hour at room temperature. The bead–hybrid-capture complexes were then washed four times with 1x buffer and wash solution (1 mol of sodium chloride per liter, 0.01 mol of TRIS–hydrochloric acid per liter [pH 7.2], 0.001 mol of EDTA per liter, and 0.1 percent Tween 20), and the sequence-specific captured DNA was eluted into 40 µl of low TRIS–EDTA (1 mmol of TRIS per liter [pH 7.4] and 0.1 mol of EDTA per liter), prewarmed to 85°C, for four minutes. The concentration of amplifiable APC templates in captured DNA was determined with the use of limiting dilution, with the use of primers F1 and R1, as defined below, for the polymerase chain reaction (PCR).

Digital Protein Truncation

            PCR

Each reaction mixture contained 1x PCR buffer (Invitrogen), 0.9 µM of oligonucleotides F1 and R1, and 0.015 U of high-fidelity platinum Taq DNA polymerase (Invitrogen) per microliter. A single PCR mix was prepared for each stool sample, and the mix was distributed to 144 wells (12 rows of 12 wells in two standard 96-well PCR plates); each well contained two to four APC templates distributed in a Poisson distribution. After an initial cycle of denaturation at 94°C for 2 minutes, amplifications were performed as follows: three cycles of denaturation at 94°C for 30 seconds, annealing at 67°C for 30 seconds, and extension at 70°C for 1 minute; three cycles of denaturation at 94°C for 30 seconds, annealing at 64°C for 30 seconds, and extension at 70°C for 1 minute; three cycles of denaturation at 94°C for 30 seconds, annealing at 61°C for 30 seconds, and extension at 70°C for 1 minute; and 50 cycles of denaturation at 94°C for 30 seconds, annealing at 58°C for 30 seconds, and extension at 70°C for 1 minute. One microliter of the reaction mixture was added to a 10-µl PCR reaction mixture of the same makeup as the one described above, except that primers F2 and R2 were used. After a 2-minute cycle of denaturation at 94°C, the reaction mixture was amplified for 15 cycles of 94°C for 30 seconds, 58°C for 30 seconds, and 70°C for 1 minute. The primer sequences were 5'GGTAATTTTGAAGCAGTCTGGGC3' in the case of F1, 5'ACGTCATGTGGATCAGCCTATTG3' in the case of R1, 5'GGATCCTAATACGACTCACTATAGGGAGACCACCATGA-TGATGATGATGATGATGATGATGATGATGTCTGGACAAAGCAGTAAAACCG3' in the case of F2, and 5'TTTTTTTTAACGTGATGACTTTGTTGGCATGGC3' in the case of R2.

            In Vitro Transcription and Translation

In vitro transcription and translation of each of the PCR products were performed in 5-µl volumes in 96-well polypropylene PCR plates. The reaction mixture consisted of 4 µl of TnT T7 Quick for PCR DNA (Promega, Madison, Wis.), 0.25 µl of 35S-Promix (Amersham Pharmacia Biotech, Piscataway, N.J.), 0.25 µl of deionized water, and 0.5 µl of PCR products obtained with the use of the F2 and R2 primers. The wells were covered with mineral oil and incubated at 30°C for 90 minutes, and then the contents were diluted with Laemmli sample buffer and denatured at 95°C for 2 minutes. Proteins were separated on 10 to 20 percent TRIS–glycine gradient polyacrylamide gels (Invitrogen), then fixed in ethanol and dried before autoradiography.

Sequencing Studies

PCR products from wells yielding truncated peptides in the digital-protein-truncation assay were isolated and cloned with the use of the TOPO Cloning kit (Invitrogen). Sequencing reactions from cloned DNA were analyzed on a SCE-9610 96-well capillary electrophoresis system (SpectruMedix, State College, Pa.). In 19 cases, DNA was prepared from archived tumors, and APC fragments of approximately 200 bp were amplified and subjected to manual sequence analysis with ThermoSequinase (Amersham Pharmacia Biotech).

Statistical Analysis

All statistical analyses employed Fisher's exact test to compare proportions. All reported P values are two-sided.

Results

Development of the Digital-Protein-Truncation Assay

In order to detect APC mutations in fecal DNA we had to surmount two major technical obstacles. The first involved purification of DNA templates that were large enough to allow us to perform PCR on a substantial region of the APC gene. About 83 percent of the APC mutations in sporadic tumors occur between codons 1210 and 1581, an expanse of 1113 nucleotides.41 For our analysis, it was important to amplify this region within a single PCR product rather than in multiple overlapping PCR products. The DNA molecules to be assessed must therefore be considerably larger than 1100 nucleotides. However, stool contains numerous inhibitors of DNA polymerase, and long PCR products, such as those of 1100 bp, are particularly sensitive to such inhibitors. The method we developed captured APC genes on magnetic beads that were coated with oligonucleotides corresponding to the region between codons 1210 and 1581. This allowed amplification of DNA fragments of the required size and concentration from all 74 stool samples analyzed. Patients with colorectal cancer had a median of 4.3 copies of the APC gene per milligram of stool (Table 1), and patients without colorectal neoplasia had a median of 2.3 copies of the APC gene per milligram of stool (Table 2).

View this table:
[in this window]
[in a new window]
 
Table 1. Characteristics of 46 Patients with Neoplasia.

 
View this table:
[in this window]
[in a new window]
 
Table 2. Characteristics of 28 Control Patients.

 
The second technical hurdle was identifying mutations within these PCR products. Virtually all APC mutations result in stop codons caused by nonsense substitutions or small, out-of-frame deletions or insertions.41 APC mutations can therefore be identified through in vitro transcription and translation of suitably engineered PCR products.44,45 This "in vitro synthesized protein," or "protein-truncation," test is the standard method for genetic diagnosis of familial adenomatous polyposis. However, it could not be used to evaluate fecal DNA samples, because of the preponderance of wild-type sequences in such samples. In particular, the sensitivity of the conventional method is limited to mutations that occur in more than 15 percent of template molecules, whereas mutant APC genes were expected to be present at much lower frequency in fecal DNA (Figure 1). We therefore developed a modification of the protein-truncation test, called digital protein truncation, which has considerably increased sensitivity (Figure 1). In brief, a small number of template molecules were included in each reaction, and the protein products of each reaction were separated by polyacrylamide-gel electrophoresis. To increase the specificity of the digital-protein-truncation test and to control for polymerase-generated errors, we considered the test result to be positive for a mutation only when a truncated protein product of the same size was identified at least twice among the 144 reactions carried out on each sample.


View larger version (18K):
[in this window]
[in a new window]
 
Figure 1. The Digital-Protein-Truncation Test.

Digital protein truncation relies on the amplification of a small number of APC gene templates in each polymerase chain reaction (PCR), and the detection of truncated polypeptides generated by in vitro transcription and translation of the PCR products. The term "digital" is used to indicate that each well either contains or does not contain APC gene templates and that each protein-truncation test is therefore positive (1) or negative (0). The lines within each large circle represent single-stranded APC templates present in a population of DNA, with black and red lines indicating wild-type (normal) and mutant APC gene copies, respectively. In circle A, the mutant APC genes represent a large fraction of the total APC genes, as would be found in a tumor or in the blood cells of a patient with familial adenomatous polyposis. Analysis of the entire population of molecules with the use of PCR and in vitro transcription and translation readily reveals the mutant product, which is equivalent in intensity to the normal APC product (as shown in lane A of the schematic gel on the right). In circle B, the mutant APC genes represent only a small fraction of the total APC genes, as would be found in the feces of a patient with colorectal cancer. Analysis of the entire population of molecules with the use of PCR and in vitro transcription and translation does not reveal the mutant product, because it is present in too small a proportion of the molecules to create a detectable signal in the assay (as shown in lane B of the gel on the right). To reduce the complexity and thereby increase the ratio of mutant genes to normal genes, we sampled two to four molecules in each well, as indicated by the circles labeled C through G within circle B. Lanes D, F, and G represent wells with no mutant products; lane C represents a well in which one of the two APC templates was mutant; and lane E represents a well in which one of the four APC templates was mutant. The number of copies of the APC gene per well varies stochastically according to a Poisson distribution.

 
Analysis of Data from Patients with Cancer and Control Patients

Mutations were identified in 26 of the 46 stool samples from patients with neoplasia (57 percent; 95 percent confidence interval, 41 to 71 percent) with use of the digital-protein-truncation assay. Representative positive results are shown in Figure 2. The average number of abnormal reactions in patients with positive results was 7.5 and ranged from 2 to 39 (of 144 total reactions carried out in each patient). No mutations were identified by the digital-protein-truncation assay in stools from the 28 control patients who did not have neoplastic disease (0 percent; 95 percent confidence interval, 0 to 12 percent; P<0.001). Positive results were obtained in 17 of the 28 patients with Dukes' stage B2 cancer (61 percent; 95 percent confidence interval, 41 to 79 percent) and 9 of the 18 patients who had adenomas that were at least 1 cm in diameter (50 percent; 95 percent confidence interval, 26 to 74 percent). In addition, 20 of 36 patients with neoplasms distal to the splenic flexure (56 percent; 95 percent confidence interval, 38 to 72 percent) had positive results, as did 6 of 10 patients with more proximal lesions (60 percent; 95 percent confidence interval, 26 to 88 percent). In the positive stool samples, 0.4 to 14.1 percent of all APC genes had mutations (Table 1).


View larger version (21K):
[in this window]
[in a new window]
 
Figure 2. Examples of the Results of the Digital-Protein-Truncation Test in Six Patients with Truncating Mutations in APC.

The wild-type protein product is 43 kD. The products of in vitro transcription and translation from 30 individual reactions (15 reactions per panel) are shown for each patient, and the abnormal polypeptides are indicated by arrowheads. Because of the Poisson distribution of template molecules, an occasional lane contains no templates and is blank (e.g., lane 2 of the sample from Patient 5).

 
Confirmation of Mutations

To confirm that the abnormal polypeptides detected by the digital-protein-truncation assay represented APC mutations, we determined the sequence of corresponding PCR products. In each of the 26 patients with positive tests, we found a mutation that was predicted to result in a truncated polypeptide of exactly the size found in the digital-protein-truncation assay (Figure 3). The spectrum of mutations was broad (Figure 4 and Table 1) and closely resembled those in sporadic colorectal neoplasms.41


View larger version (31K):
[in this window]
[in a new window]
 
Figure 3. Mutations Producing Truncated Polypeptides in the Digital-Protein-Truncation Test.

Polymerase-chain-reaction (PCR) products that generated abnormal polypeptides in the digital-protein-truncation test were used for sequence analyses, as described in the Methods section. In each case, primers were chosen on the basis of the position of the mutation expected from the digital-protein-truncation results. For each patient, the upper chromatogram represents the wild-type sequence and the lower chromatogram depicts the mutant sequence (arrowheads indicate the site of the genetic alteration). Autoradiograms of sequencing gels from PCR products derived from tumor samples from the four patients are also shown; arrowheads indicate the mutations, which were identical to those observed in the stool samples. As expected, sequences of tumor-derived templates revealed the simultaneous presence of wild-type and mutant sequences. Examples of a base substitution (in the case of Patient 11), a 5-bp deletion (in the case of Patient 23), and an insertion of one base (in the case of Patient 44) are illustrated. All mutations resulted in stop codons (solid circles) immediately downstream from the mutations, as indicated on the right.

 

View larger version (12K):
[in this window]
[in a new window]
 
Figure 4. Spectrum of APC Mutations Identified between Codons 1210 and 1581 in Fecal DNA.

Twenty-seven different mutations were identified among the 26 patients with positive digital-protein-truncation tests. Mutations occurred in the form of deletions (red triangles), insertions (green squares), and base substitutions (yellow circles). The numbers within each symbol refer to the patient numbers shown in Table 1.

 
We next sought to confirm that mutations identified in the stool were also present in the patients' tumors. Although in the majority of patients, tumor material suitable for mutational analyses was not available, we were able to evaluate APC mutations in the tumors of seven patients who had positive results on the digital-protein-truncation assay. The mutations in these tumors were identical to those found in the stool (Figure 3). We also assessed the nature of APC mutations in tumors from 12 patients with negative results on the digital-protein-truncation assay. Tumors from 6 of these 12 patients had truncating mutations (at codons 1284, 1291, 1309, 1376, 1464, and 1488). Thus, 36 of the 46 patients with neoplasia (78 percent; 95 percent confidence interval, 65 to 89 percent) in our study were estimated to have mutations that could have been detected by the digital-protein-truncation assay (26 of the patients with positive test results plus 10 of the 20 patients with negative test results). This estimate of 78 percent is quite close to the value of 75 percent expected on the basis of previous studies.35,41

Discussion

Our results show that PCR-amplifiable DNA fragments of more than 1100 bp could be purified from the stools of all patients studied, regardless of the presence or absence of a colorectal tumor or colonic adenoma. The fraction of mutant APC molecules in the samples from patients with neoplasia ranged from 0.4 to 14.1 percent. Knowledge gained from our study should be helpful in the design of future studies. For example, any technique to assess mutant DNA molecules in fecal DNA must have the capacity to distinguish 1 mutant molecule from more than 250 wild-type molecules if a sensitivity comparable to the one achieved in this study is to be achieved. By increasing the number of copies of APC examined, further increases in sensitivity should be achievable. Furthermore, our study focused on relatively early-stage lesions. Because of the high potential for cure by surgical or endoscopic removal of these lesions, their detection by noninvasive methods such as the digital-protein-truncation assay has the capacity to reduce morbidity and mortality in the future.

An important component of our study was the high specificity of the test: no APC alterations were identified in any of the 28 control samples from patients without neoplasia. Among the published studies of fecal-DNA mutations,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33 few used more than three stool samples from normal subjects as controls. In one such study, c-Ki-ras mutations were identified in 7 percent of the controls.30 Nondysplastic aberrant crypt foci and small hyperplastic polyps, which occur relatively frequently in normal people but are not thought to be precursors of cancer, often contain c-Ki-ras mutations but not APC mutations,38,39,40 a finding further emphasizing the value of APC for stool-based testing.

In summary, it is possible to detect APC mutations in fecal DNA in patients with potentially curable colorectal tumors. It is important to emphasize, however, that our study does not demonstrate that the digital-protein-truncation test is a clinically useful screening test. It was of interest that five of the control patients in our study underwent colonoscopy because of a positive fecal occult-blood test, whereas in another six, the reason for undergoing colonoscopy was rectal bleeding, which precludes fecal occult-blood testing. Although this result points to the potential value of a more specific genetically based test for screening feces, further studies will be required to determine whether the digital-protein-truncation test is as sensitive and specific as the fecal occult-blood test in persons at average risk. Because the digital-protein-truncation test is based on the identification of abnormal proteins synthesized from mutant genes, the powerful new tools being developed for proteomics should be directly applicable to this approach in the future, further increasing its power.

Supported by the National Colorectal Cancer Research Alliance, by the Caroline Law Fund, by the University of Texas M.D. Anderson Cancer Center, by the Clayton Fund, and by grants (CA 62924, CA 43460, CA 57345, and GM 07184) from the National Institutes of Health.

Drs. Kinzler and Vogelstein are entitled to royalties on sales of products related to the use of stool DNA for the diagnosis of cancer. Dr. Kinzler owns stock in and serves as a consultant to Genzyme and Exact Sciences. Dr. Vogelstein owns stock in and has served as a consultant to Genzyme and Exact Sciences. Dr. Schoetz owns stock in Exact Sciences, and the recruitment of patients and collection of samples at the Lahey Clinic were funded in part by Exact Sciences.

We are indebted to Dr. Steven N. Goodman for statistical evaluation; to Ms. Pam Shaw, Ms. Ji-Lei Jiang, Ms. Janice Gorham, Mr. Carlo Rago, and Mr. Dipayan Chaudhuri for expert technical assistance; to Drs. F. Lyone Hochman, Michael F. Appel, and Atilla Ertan for assistance with sample accrual; and to Dr. Ie-Ming Shih for pathological consultation.


Source Information

From the Graduate Program in Human Genetics (G.T.), Howard Hughes Medical Institute (B.V.), and the Sidney Kimmel Comprehensive Cancer Center at Johns Hopkins (G.T., K.W.K., B.V.), Johns Hopkins School of Medicine, Baltimore; Exact Sciences, Maynard, Mass. (A.S., K.B.); the Division of Cancer Prevention (B.L.), the Department of Epidemiology (C.J.), and the Division of Pathology and Laboratory Medicine (S.R.H.), University of Texas M.D. Anderson Cancer Center, Houston; the Department of Surgery, Central Hospital, Västerås, Center for Clinical Research, Uppsala University, Uppsala, Sweden (L.O.); and the Department of Colon-Rectal Surgery, Lahey Clinic, Burlington, Mass. (D.J.S.).

Address reprint requests to Dr. Vogelstein at the Sidney Kimmel Comprehensive Cancer Center, 1650 Orleans St., Baltimore, MD 21231, or at vogelbe{at}welch.jhu.edu.

References

  1. Newcomb PA, Norfleet RG, Storer BE, Surawicz TS, Marcus PM. Screening sigmoidoscopy and colorectal cancer mortality. J Natl Cancer Inst 1992;84:1572-1575. [Free Full Text]
  2. Selby JV, Friedman GD, Quesenberry CP Jr, Weiss NS. A case-control study of screening sigmoidoscopy and mortality from colorectal cancer. N Engl J Med 1992;326:653-657. [Abstract]
  3. Lieberman DA, Weiss DG, Bond JH, Ahnen DJ, Garewal H, Chejfec G. Use of colonoscopy to screen asymptomatic adults for colorectal cancer. N Engl J Med 2000;343:162-168. [Erratum, N Engl J Med 2000;343:1204.] [Free Full Text]
  4. Imperiale TF, Wagner DR, Lin CY, Larkin GN, Rogge JD, Ransohoff DF. Risk of advanced proximal neoplasms in asymptomatic adults according to the distal colorectal findings. N Engl J Med 2000;343:169-174. [Free Full Text]
  5. Trends in screening for colorectal cancer -- United States, 1997 and 1999. JAMA 2001;285:1570-1571. [Free Full Text]
  6. Scotiniotis I, Lewis JD, Strom BL. Screening for colorectal cancer and other GI cancers. Curr Opin Oncol 1999;11:305-311. [Medline]
  7. Mandel JS, Bond JH, Church TR, et al. Reducing mortality from colorectal cancer by screening for fecal occult blood. N Engl J Med 1993;328:1365-1371. [Erratum, N Engl J Med 1993;329:672.] [Free Full Text]
  8. Kronborg O, Fenger C, Olsen J, Jorgensen OD, Sondergaard O. Randomised study of screening for colorectal cancer with faecal-occult-blood test. Lancet 1996;348:1467-1471. [CrossRef][ISI][Medline]
  9. Hardcastle JD, Chamberlain JO, Robinson MH, et al. Randomised controlled trial of faecal-occult-blood screening for colorectal cancer. Lancet 1996;348:1472-1477. [CrossRef][ISI][Medline]
  10. Towler B, Irwig L, Glasziou P, Kewenter J, Weller D, Silagy C. A systematic review of the effects of screening for colorectal cancer using the faecal occult blood test, Hemoccult. BMJ 1998;317:559-565. [Free Full Text]
  11. Mandel JS, Church TR, Bond JH, et al. The effect of fecal occult-blood screening on the incidence of colorectal cancer. N Engl J Med 2000;343:1603-1607. [Free Full Text]
  12. Allison JE, Feldman R, Tekawa IS. Hemoccult screening in detecting colorectal neoplasm: sensitivity, specificity, and predictive value: long-term follow-up in a large group practice setting. Ann Intern Med 1990;112:328-333.
  13. Verne JE, Aubrey R, Love SB, Talbot IC, Northover JM. Population based randomized study of uptake and yield of screening by flexible sigmoidoscopy compared with screening by faecal occult blood testing. BMJ 1998;317:182-185. [Free Full Text]
  14. Mandel JS, Church TR, Ederer F, Bond JH. Colorectal cancer mortality: effectiveness of biennial screening for fecal occult blood. J Natl Cancer Inst 1999;91:434-437. [Free Full Text]
  15. Rozen P, Knaani J, Samuel Z. Comparative screening with a sensitive guaiac and specific immunochemical occult blood test in an endoscopic study. Cancer 2000;89:46-52. [CrossRef][ISI][Medline]
  16. Ore L, Hagoel L, Lavi I, Rennert G. Screening with faecal occult blood test (FOBT) for colorectal cancer: assessment of two methods that attempt to improve compliance. Eur J Cancer Prev 2001;10:251-256. [CrossRef][ISI][Medline]
  17. Shields HM, Weiner MS, Henry DR, et al. Factors that influence the decision to do an adequate evaluation of a patient with a positive stool for occult blood. Am J Gastroenterol 2001;96:196-203. [CrossRef][ISI][Medline]
  18. Vogelstein B, Kinzler KW, eds. The genetic basis of human cancer. New York: McGraw-Hill, 1998.
  19. Sidransky D, Tokino T, Hamilton SR, et al. Identification of ras oncogene mutations in the stool of patients with curable colorectal tumors. Science 1992;256:102-105. [Free Full Text]
  20. Smith-Ravin J, England J, Talbot IC, Bodmer W. Detection of c-Ki-ras mutations in faecal samples from sporadic colorectal cancer patients. Gut 1995;36:81-86. [Free Full Text]
  21. Hasegawa Y, Takeda S, Ichii S, et al. Detection of K-ras mutations in DNAs isolated from feces of patients with colorectal tumors by mutant-allele-specific amplification (MASA). Oncogene 1995;10:1441-1445. [ISI][Medline]
  22. Ulvik A, Koornstra JJ, Røkke O, Halvorsen JF, Haug K, Øgreid D. Påvishing av aktivert protoonkogen (Ki-ras) i avføringsprøver: ny laboratorieanalyse for tidlig diagnostikk av kolorektal cancer. Tidsskr Nor Laegeforen 1995;115:3266-3270. [Medline]
  23. Ratto C, Flamini G, Sofo L, et al. Detection of oncogene mutation from neoplastic colonic cells exfoliated in feces. Dis Colon Rectum 1996;39:1238-1244. [CrossRef][ISI][Medline]
  24. Villa E, Dugani A, Rebecchi AM, et al. Identification of subjects at risk for colorectal carcinoma through a test based on K-ras determination in the stool. Gastroenterology 1996;110:1346-1353. [CrossRef][ISI][Medline]
  25. Eguchi S, Kohara N, Komuta K, Kanematsu T. Mutations of the p53 gene in the stool of patients with resectable colorectal cancer. Cancer 1996;77:Suppl:1707-1710. [ISI][Medline]
  26. Kohata Y. Detection of K-ras point mutations in the stool of patients with colorectal tumors. Nippon Shokakibyo Gakkai Zasshi 1996;93:391-397. [Medline]
  27. Nollau P, Moser C, Weinland G, Wagener C. Detection of K-ras mutations in stools of patients with colorectal cancer by mutant-enriched PCR. Int J Cancer 1996;66:332-336. [CrossRef][ISI][Medline]
  28. Deuter R, Muller O. Detection of APC mutations in stool DNA of patients with colorectal cancer by HD-PCR. Hum Mutat 1998;11:84-89. [CrossRef][ISI][Medline]
  29. Puig P, Urgell E, Capella G, et al. Improved detection of K-ras codon 12 mutations in fecal exfoliated cells. Lab Invest 1999;79:617-618. [ISI][Medline]
  30. Ahlquist DA, Skoletsky JE, Boynton KA, et al. Colorectal cancer screening by detection of altered human DNA in stool: feasibility of a multitarget assay panel. Gastroenterology 2000;119:1219-1227. [CrossRef][ISI][Medline]
  31. Dong SM, Traverso G, Johnson C, et al. Detecting colorectal cancer in stool with the use of multiple genetic targets. J Natl Cancer Inst 2001;93:858-865. [Free Full Text]
  32. Rengucci C, Maiolo P, Saragoni L, Zoli W, Amadori D, Calistri D. Multiple detection of genetic alterations in tumors and stool. Clin Cancer Res 2001;7:590-593. [Free Full Text]
  33. Doolittle BR, Emanuel J, Tuttle C, Costa J. Detection of the mutated K-Ras biomarker in colorectal carcinoma. Exp Mol Pathol 2001;70:289-301. [CrossRef][Medline]
  34. Boland CR. Genetic pathways to colorectal cancer. Hosp Pract (Off Ed) 1997;32:79-84, 87. 
  35. Kinzler KW, Vogelstein B. Lessons from hereditary colorectal cancer. Cell 1996;87:159-170. [CrossRef][ISI][Medline]
  36. Tsao J, Shibata D. Further evidence that one of the earliest alterations in colorectal carcinogenesis involves APC. Am J Pathol 1994;145:531-534. [Abstract]
  37. Baker SJ, Preisinger AC, Jessup JM, et al. p53 Gene mutations occur in combination with 17p allelic deletions as late events in colorectal tumorigenesis. Cancer Res 1990;50:7717-7722. [Free Full Text]
  38. Smith AJ, Stern HS, Penner M, et al. Somatic APC and K-ras codon 12 mutations in aberrant crypt foci from human colons. Cancer Res 1994;54:5527-5530. [Free Full Text]
  39. Jen J, Powell SM, Papadopoulos N, et al. Molecular determinants of dysplasia in colorectal lesions. Cancer Res 1994;54:5523-5526. [Free Full Text]
  40. Pretlow TP. Aberrant crypt foci and K-ras mutations: earliest recognized players or innocent bystanders in colon carcinogenesis? Gastroenterology 1995;108:600-603. [CrossRef][Medline]
  41. Laurent-Puig P, Beroud C, Soussi T. APC gene: database of germline and somatic mutations in human tumors and cell lines. Nucleic Acids Res 1998;26:269-270. [Free Full Text]
  42. Stryker SJ, Wolff BG, Culp CE, Libbe SD, Ilstrup DM, MacCarty RL. Natural history of untreated colonic polyps. Gastroenterology 1987;93:1009-1013. [ISI][Medline]
  43. Bond JH. Clinical relevance of the small colorectal polyp. Endoscopy 2001;33:454-457. [CrossRef][Medline]
  44. Powell SM, Petersen GM, Krush AJ, et al. Molecular diagnosis of familial adenomatous polyposis. N Engl J Med 1993;329:1982-1987. [Free Full Text]
  45. van der Luijt R, Khan PM, Vasen H, et al. Rapid detection of translation-terminating mutations at the adenomatous polyposis coli (APC) gene by direct protein truncation test. Genomics 1994;20:1-4. [CrossRef][ISI][Medline]

 

This Article
-Abstract
- PDF
-PDA Full Text
-PowerPoint Slide Set

Commentary
-Perspective
 by Schwartz, R. S.
-Letters

Tools and Services
-Add to Personal Archive
-Add to Citation Manager
-Notify a Friend
-E-mail When Cited

More Information
-PubMed Citation

Related Letters:

Fecal DNA Tests for Colorectal Cancer
Ransohoff D. F., Traverso G., Kinzler K. W., Vogelstein B.
Extract | Full Text | PDF  
N Engl J Med 2002; 346:1912-1913, Jun 13, 2002. Correspondence

This article has been cited by other articles:



HOME  |  SUBSCRIBE  |  SEARCH  |  CURRENT ISSUE  |  PAST ISSUES  |  COLLECTIONS  |  PRIVACY  |  HELP  |  beta.nejm.org

Comments and questions? Please contact us.

The New England Journal of Medicine is owned, published, and copyrighted © 2008 Massachusetts Medical Society. All rights reserved.