Detection of APC Mutations in Fecal DNA from Patients with Colorectal Tumors
Giovanni Traverso, B.A., Anthony Shuber, M.S., Bernard Levin, M.D., Constance Johnson, R.N., M.S., Louise Olsson, M.D., David J. Schoetz, Jr., M.D., Stanley R. Hamilton, M.D., Kevin Boynton, B.S., Kenneth W. Kinzler, Ph.D., and Bert Vogelstein, M.D.
Background Noninvasive methods for detecting colorectal tumorshave the potential to reduce morbidity and mortality from thisdisease. The mutations in the adenomatous polyposis coli (APC)gene that initiate colorectal tumors theoretically provide anoptimal marker for detecting colorectal tumors. The purposeof our study was to determine the feasibility of detecting APCmutations in fecal DNA with the use of newly developed methods.
Methods We purified DNA from routinely collected stool samplesand screened for APC mutations with the use of a novel approachcalled digital protein truncation. Many different mutationscould potentially be identified in a sensitive and specificmanner with this technique.
Results Stool samples from 28 patients with nonmetastatic colorectalcancers, 18 patients with adenomas that were at least 1 cm indiameter, and 28 control patients without neoplastic diseasewere studied. APC mutations were identified in 26 of the 46patients with neoplasia (57 percent; 95 percent confidence interval,41 to 71 percent) and in none of the 28 control patients (0percent; 95 percent confidence interval, 0 to 12 percent; P<0.001).In the patients with positive tests, mutant APC genes made up0.4 to 14.1 percent of all APC genes in the stool.
Conclusions APC mutations can be detected in fecal DNA frompatients with relatively early colorectal tumors. This feasibilitystudy suggests a new approach for the early detection of colorectalneoplasms.
Several strategies for the early detection of colorectal tumorshave been devised. Colonoscopy, sigmoidoscopy, and barium enemasare highly specific and sensitive tests for neoplasia,1,2,3,4but they are invasive and limited by the availability of expertsin the procedures and patient compliance.5,6 Testing for occultblood in the stool has been shown in some studies to reducethe incidence of and morbidity and mortality from colorectalcancer.7,8,9,10,11 These fecal occult-blood tests are noninvasiveand extremely useful but not sufficiently sensitive or specificfor neoplasia.12,13,14,15 Furthermore, some fecal occult-bloodtests require patients to change their diet before testing orrequire multiple tests, potentially reducing compliance.5,16,17There is thus a need to develop new screening tests that overcomethese obstacles.
One of the most promising classes of new diagnostic markersconsists of mutations in oncogenes and tumor-suppressor genes.18Because these mutations are directly responsible for neoplasticgrowth, they have clear advantages over indirect markers suchas fecal occult blood. Several groups have reported that mutationsin cancer-related genes can be detected in the stool of patientswith colorectal cancer.19,20,21,22,23,24,25,26,27,28,29,30,31,32,33However, the sensitivities and specificities of these approacheshave been limited by technical impediments or the low frequenciesof detectable mutations in any specific gene.
The intent of our study was to develop a test based on a singlegene that would facilitate the detection of colorectal tumorsat an early stage of disease. The optimal gene for such studiesis the adenomatous polyposis coli (APC) gene,34,35 since mutationsin this gene generally initiate colorectal neoplasia.36 Othermutations are present only in the later stages of colorectalneoplasia, such as those in p53,37 or may be present in non-neoplastic,hyperproliferative cells, such as those in c-Ki-ras.38,39,40However, the detection of mutations in APC presents extraordinarilydifficult technical challenges. Unlike mutations in c-Ki-ras,which have been used for most previous studies because mutationsare clustered at two codons, mutations in APC can occur virtuallyanywhere within the first 1600 codons of the gene.41 Moreover,the type of mutation (base substitutions or insertions or deletionsof diverse length) varies widely among tumors. Although suchAPC mutations can be detected relatively easily in tumors, wherethey are present in every neoplastic cell, they are much harderto detect in fecal DNA, where they may be present in less than1 in 100 APC genes in the sample. We describe an approach thatallowed us to detect such mutations in fecal DNA from patientswith adenomas and cancer in a precise, specific, and quantitativefashion.
Methods
Patients
A total of 74 stool samples were analyzed to determine theirAPC status. They were obtained from 28 patients with Dukes'stage B2 colon cancer, 28 control patients with no known colorectaltumor, and 18 patients with adenomas that were at least 1 cmin diameter. Of these 74 samples, 68 were derived from a groupof 315 patients who were sequentially evaluated at the M.D.Anderson Cancer Center in Houston or surrounding hospitals between1997 and 2000 for suspected colorectal neoplasia. Of these 315patients, 77 had cancer: 30 had Dukes' stage B2 (T3N0M0) disease,5 had in situ lesions, 6 had Dukes' stage A, 5 had Dukes' stageB1, 20 had Dukes' stage C, 9 had Dukes' stage D, and 2 had cancersof unknown or other classes. We chose to analyze the patientswith Dukes' stage B2 cancer because this was the most commontype; moreover, the effect of screening in such cases shouldbe considerable, because they are likely to be surgically curable.We excluded 2 of the 30 patients with Dukes' stage B2 becauseother colonic lesions were found at colonoscopy or surgery thatcould have complicated the analysis. For comparison with thepatients with cancer, we selected 28 control patients from amongthe 55 patients who proved to be tumor-free on colonoscopy.These controls were matched to the patients with cancer withregard to the reasons for initial colonoscopy and then matchedas well as possible for sex and age.
In this group of 315 subjects, 12 had single adenomas that wereat least 1 cm in diameter, which have a high risk of progressionto cancer.42,43 We also examined stool samples from six patientsfrom the Lahey Clinic (Burlington, Mass.) who had adenomas thatwere at least 1 cm in diameter. These 6 constituted all thosefound to have such tumors among 172 patients examined by colonoscopybetween September 2000 and June 2001.
Stool samples were collected before colonoscopy from 19 of the46 patients with neoplasia and before surgery in the remainder.All stool samples from the control patients were collected beforecolonoscopy. All stool samples were stored at 20°Cimmediately after collection and transferred to storage at 80°Cwithin 48 hours after collection. None of the patients had familialadenomatous polyposis or hereditary nonpolyposis colon cancer.The work was carried out in accordance with the institutionalreview board at each participating institution. Oral or writteninformed consent, as mandated by the institutional review board,was obtained from all patients.
Purification of DNA
DNA was purified with the use of modifications of proceduresdescribed by Ahlquist et al.30 All stool samples were thawedat room temperature and homogenized with an Exactor stool shaker(Exact Laboratories, Maynard, Mass.). After homogenization,a 4-g stool equivalent of each sample was subjected to two centrifugations(5 minutes at 2536xg and 10 minutes at 16,500xg) to remove largeand small particulate matter, respectively. Supernatants wereincubated with 20 µl of RNase (0.5 mg per milliliter)for 1 hour at 37°C, followed by precipitation with 1/10volume of 3 mol of sodium acetate per liter and an equal volumeof isopropanol. The crude DNA was dissolved in 10 ml of TRISEDTA(0.01 mol of TRIS per liter [pH 7.4] and 0.001 mol of EDTA perliter). Hybrid capture of APC genes was performed by adding300 µl of sample to an equal volume of 6 M guanidine isothiocyanatesolution (Invitrogen, Carlsbad, Calif.) containing 20 pmol oftwo biotinylated sequence-specific oligonucleotides (5'CAGATAGCCCTGGACAAACCATGCCACCAAGCAGAAG-3'and 5'TTCCAGCAGTGTCACAGCACCCTAGAACCAAATCCAG3'; Midland CertifiedReagent Company, Midland, Tex.). After a 12-hour incubationat 25°C, streptavidin-coated magnetic beads were added tothe solution, and the tubes were incubated for an additionalhour at room temperature. The beadhybrid-capture complexeswere then washed four times with 1x buffer and wash solution(1 mol of sodium chloride per liter, 0.01 mol of TRIShydrochloricacid per liter [pH 7.2], 0.001 mol of EDTA per liter, and 0.1percent Tween 20), and the sequence-specific captured DNA waseluted into 40 µl of low TRISEDTA (1 mmol of TRISper liter [pH 7.4] and 0.1 mol of EDTA per liter), prewarmedto 85°C, for four minutes. The concentration of amplifiableAPC templates in captured DNA was determined with the use oflimiting dilution, with the use of primers F1 and R1, as definedbelow, for the polymerase chain reaction (PCR).
Digital Protein Truncation
PCR
Each reaction mixture contained 1x PCR buffer (Invitrogen),0.9 µM of oligonucleotides F1 and R1, and 0.015 U of high-fidelityplatinum Taq DNA polymerase (Invitrogen) per microliter. A singlePCR mix was prepared for each stool sample, and the mix wasdistributed to 144 wells (12 rows of 12 wells in two standard96-well PCR plates); each well contained two to four APC templatesdistributed in a Poisson distribution. After an initial cycleof denaturation at 94°C for 2 minutes, amplifications wereperformed as follows: three cycles of denaturation at 94°Cfor 30 seconds, annealing at 67°C for 30 seconds, and extensionat 70°C for 1 minute; three cycles of denaturation at 94°Cfor 30 seconds, annealing at 64°C for 30 seconds, and extensionat 70°C for 1 minute; three cycles of denaturation at 94°Cfor 30 seconds, annealing at 61°C for 30 seconds, and extensionat 70°C for 1 minute; and 50 cycles of denaturation at 94°Cfor 30 seconds, annealing at 58°C for 30 seconds, and extensionat 70°C for 1 minute. One microliter of the reaction mixturewas added to a 10-µl PCR reaction mixture of the samemakeup as the one described above, except that primers F2 andR2 were used. After a 2-minute cycle of denaturation at 94°C,the reaction mixture was amplified for 15 cycles of 94°Cfor 30 seconds, 58°C for 30 seconds, and 70°C for 1minute. The primer sequences were 5'GGTAATTTTGAAGCAGTCTGGGC3'in the case of F1, 5'ACGTCATGTGGATCAGCCTATTG3' in the case ofR1, 5'GGATCCTAATACGACTCACTATAGGGAGACCACCATGA-TGATGATGATGATGATGATGATGATGATGTCTGGACAAAGCAGTAAAACCG3'in the case of F2, and 5'TTTTTTTTAACGTGATGACTTTGTTGGCATGGC3'in the case of R2.
In Vitro Transcription and Translation
In vitro transcription and translation of each of the PCR productswere performed in 5-µl volumes in 96-well polypropylenePCR plates. The reaction mixture consisted of 4 µl ofTnT T7 Quick for PCR DNA (Promega, Madison, Wis.), 0.25 µlof 35S-Promix (Amersham Pharmacia Biotech, Piscataway, N.J.),0.25 µl of deionized water, and 0.5 µl of PCR productsobtained with the use of the F2 and R2 primers. The wells werecovered with mineral oil and incubated at 30°C for 90 minutes,and then the contents were diluted with Laemmli sample bufferand denatured at 95°C for 2 minutes. Proteins were separatedon 10 to 20 percent TRISglycine gradient polyacrylamidegels (Invitrogen), then fixed in ethanol and dried before autoradiography.
Sequencing Studies
PCR products from wells yielding truncated peptides in the digital-protein-truncationassay were isolated and cloned with the use of the TOPO Cloningkit (Invitrogen). Sequencing reactions from cloned DNA wereanalyzed on a SCE-9610 96-well capillary electrophoresis system(SpectruMedix, State College, Pa.). In 19 cases, DNA was preparedfrom archived tumors, and APC fragments of approximately 200bp were amplified and subjected to manual sequence analysiswith ThermoSequinase (Amersham Pharmacia Biotech).
Statistical Analysis
All statistical analyses employed Fisher's exact test to compareproportions. All reported P values are two-sided.
Results
Development of the Digital-Protein-Truncation Assay
In order to detect APC mutations in fecal DNA we had to surmounttwo major technical obstacles. The first involved purificationof DNA templates that were large enough to allow us to performPCR on a substantial region of the APC gene. About 83 percentof the APC mutations in sporadic tumors occur between codons1210 and 1581, an expanse of 1113 nucleotides.41 For our analysis,it was important to amplify this region within a single PCRproduct rather than in multiple overlapping PCR products. TheDNA molecules to be assessed must therefore be considerablylarger than 1100 nucleotides. However, stool contains numerousinhibitors of DNA polymerase, and long PCR products, such asthose of 1100 bp, are particularly sensitive to such inhibitors.The method we developed captured APC genes on magnetic beadsthat were coated with oligonucleotides corresponding to theregion between codons 1210 and 1581. This allowed amplificationof DNA fragments of the required size and concentration fromall 74 stool samples analyzed. Patients with colorectal cancerhad a median of 4.3 copies of the APC gene per milligram ofstool (Table 1), and patients without colorectal neoplasia hada median of 2.3 copies of the APC gene per milligram of stool(Table 2).
The second technical hurdle was identifying mutations withinthese PCR products. Virtually all APC mutations result in stopcodons caused by nonsense substitutions or small, out-of-framedeletions or insertions.41APC mutations can therefore be identifiedthrough in vitro transcription and translation of suitably engineeredPCR products.44,45 This "in vitro synthesized protein," or "protein-truncation,"test is the standard method for genetic diagnosis of familialadenomatous polyposis. However, it could not be used to evaluatefecal DNA samples, because of the preponderance of wild-typesequences in such samples. In particular, the sensitivity ofthe conventional method is limited to mutations that occur inmore than 15 percent of template molecules, whereas mutant APCgenes were expected to be present at much lower frequency infecal DNA (Figure 1). We therefore developed a modificationof the protein-truncation test, called digital protein truncation,which has considerably increased sensitivity (Figure 1). Inbrief, a small number of template molecules were included ineach reaction, and the protein products of each reaction wereseparated by polyacrylamide-gel electrophoresis. To increasethe specificity of the digital-protein-truncation test and tocontrol for polymerase-generated errors, we considered the testresult to be positive for a mutation only when a truncated proteinproduct of the same size was identified at least twice amongthe 144 reactions carried out on each sample.
Digital protein truncation relies on the amplification of a small number of APC gene templates in each polymerase chain reaction (PCR), and the detection of truncated polypeptides generated by in vitro transcription and translation of the PCR products. The term "digital" is used to indicate that each well either contains or does not contain APC gene templates and that each protein-truncation test is therefore positive (1) or negative (0). The lines within each large circle represent single-stranded APC templates present in a population of DNA, with black and red lines indicating wild-type (normal) and mutant APC gene copies, respectively. In circle A, the mutant APC genes represent a large fraction of the total APC genes, as would be found in a tumor or in the blood cells of a patient with familial adenomatous polyposis. Analysis of the entire population of molecules with the use of PCR and in vitro transcription and translation readily reveals the mutant product, which is equivalent in intensity to the normal APC product (as shown in lane A of the schematic gel on the right). In circle B, the mutant APC genes represent only a small fraction of the total APC genes, as would be found in the feces of a patient with colorectal cancer. Analysis of the entire population of molecules with the use of PCR and in vitro transcription and translation does not reveal the mutant product, because it is present in too small a proportion of the molecules to create a detectable signal in the assay (as shown in lane B of the gel on the right). To reduce the complexity and thereby increase the ratio of mutant genes to normal genes, we sampled two to four molecules in each well, as indicated by the circles labeled C through G within circle B. Lanes D, F, and G represent wells with no mutant products; lane C represents a well in which one of the two APC templates was mutant; and lane E represents a well in which one of the four APC templates was mutant. The number of copies of the APC gene per well varies stochastically according to a Poisson distribution.
Analysis of Data from Patients with Cancer and Control Patients
Mutations were identified in 26 of the 46 stool samples frompatients with neoplasia (57 percent; 95 percent confidence interval,41 to 71 percent) with use of the digital-protein-truncationassay. Representative positive results are shown in Figure 2.The average number of abnormal reactions in patients with positiveresults was 7.5 and ranged from 2 to 39 (of 144 total reactionscarried out in each patient). No mutations were identified bythe digital-protein-truncation assay in stools from the 28 controlpatients who did not have neoplastic disease (0 percent; 95percent confidence interval, 0 to 12 percent; P<0.001). Positiveresults were obtained in 17 of the 28 patients with Dukes' stageB2 cancer (61 percent; 95 percent confidence interval, 41 to79 percent) and 9 of the 18 patients who had adenomas that wereat least 1 cm in diameter (50 percent; 95 percent confidenceinterval, 26 to 74 percent). In addition, 20 of 36 patientswith neoplasms distal to the splenic flexure (56 percent; 95percent confidence interval, 38 to 72 percent) had positiveresults, as did 6 of 10 patients with more proximal lesions(60 percent; 95 percent confidence interval, 26 to 88 percent).In the positive stool samples, 0.4 to 14.1 percent of all APCgenes had mutations (Table 1).
Figure 2. Examples of the Results of the Digital-Protein-Truncation Test in Six Patients with Truncating Mutations in APC.
The wild-type protein product is 43 kD. The products of in vitro transcription and translation from 30 individual reactions (15 reactions per panel) are shown for each patient, and the abnormal polypeptides are indicated by arrowheads. Because of the Poisson distribution of template molecules, an occasional lane contains no templates and is blank (e.g., lane 2 of the sample from Patient 5).
Confirmation of Mutations
To confirm that the abnormal polypeptides detected by the digital-protein-truncationassay represented APC mutations, we determined the sequenceof corresponding PCR products. In each of the 26 patients withpositive tests, we found a mutation that was predicted to resultin a truncated polypeptide of exactly the size found in thedigital-protein-truncation assay (Figure 3). The spectrum ofmutations was broad (Figure 4 and Table 1) and closely resembledthose in sporadic colorectal neoplasms.41
Figure 3. Mutations Producing Truncated Polypeptides in the Digital-Protein-Truncation Test.
Polymerase-chain-reaction (PCR) products that generated abnormal polypeptides in the digital-protein-truncation test were used for sequence analyses, as described in the Methods section. In each case, primers were chosen on the basis of the position of the mutation expected from the digital-protein-truncation results. For each patient, the upper chromatogram represents the wild-type sequence and the lower chromatogram depicts the mutant sequence (arrowheads indicate the site of the genetic alteration). Autoradiograms of sequencing gels from PCR products derived from tumor samples from the four patients are also shown; arrowheads indicate the mutations, which were identical to those observed in the stool samples. As expected, sequences of tumor-derived templates revealed the simultaneous presence of wild-type and mutant sequences. Examples of a base substitution (in the case of Patient 11), a 5-bp deletion (in the case of Patient 23), and an insertion of one base (in the case of Patient 44) are illustrated. All mutations resulted in stop codons (solid circles) immediately downstream from the mutations, as indicated on the right.
Figure 4. Spectrum of APC Mutations Identified between Codons 1210 and 1581 in Fecal DNA.
Twenty-seven different mutations were identified among the 26 patients with positive digital-protein-truncation tests. Mutations occurred in the form of deletions (red triangles), insertions (green squares), and base substitutions (yellow circles). The numbers within each symbol refer to the patient numbers shown in Table 1.
We next sought to confirm that mutations identified in the stoolwere also present in the patients' tumors. Although in the majorityof patients, tumor material suitable for mutational analyseswas not available, we were able to evaluate APC mutations inthe tumors of seven patients who had positive results on thedigital-protein-truncation assay. The mutations in these tumorswere identical to those found in the stool (Figure 3). We alsoassessed the nature of APC mutations in tumors from 12 patientswith negative results on the digital-protein-truncation assay.Tumors from 6 of these 12 patients had truncating mutations(at codons 1284, 1291, 1309, 1376, 1464, and 1488). Thus, 36of the 46 patients with neoplasia (78 percent; 95 percent confidenceinterval, 65 to 89 percent) in our study were estimated to havemutations that could have been detected by the digital-protein-truncationassay (26 of the patients with positive test results plus 10of the 20 patients with negative test results). This estimateof 78 percent is quite close to the value of 75 percent expectedon the basis of previous studies.35,41
Discussion
Our results show that PCR-amplifiable DNA fragments of morethan 1100 bp could be purified from the stools of all patientsstudied, regardless of the presence or absence of a colorectaltumor or colonic adenoma. The fraction of mutant APC moleculesin the samples from patients with neoplasia ranged from 0.4to 14.1 percent. Knowledge gained from our study should be helpfulin the design of future studies. For example, any techniqueto assess mutant DNA molecules in fecal DNA must have the capacityto distinguish 1 mutant molecule from more than 250 wild-typemolecules if a sensitivity comparable to the one achieved inthis study is to be achieved. By increasing the number of copiesof APC examined, further increases in sensitivity should beachievable. Furthermore, our study focused on relatively early-stagelesions. Because of the high potential for cure by surgicalor endoscopic removal of these lesions, their detection by noninvasivemethods such as the digital-protein-truncation assay has thecapacity to reduce morbidity and mortality in the future.
An important component of our study was the high specificityof the test: no APC alterations were identified in any of the28 control samples from patients without neoplasia. Among thepublished studies of fecal-DNA mutations,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33few used more than three stool samples from normal subjectsas controls. In one such study, c-Ki-ras mutations were identifiedin 7 percent of the controls.30 Nondysplastic aberrant cryptfoci and small hyperplastic polyps, which occur relatively frequentlyin normal people but are not thought to be precursors of cancer,often contain c-Ki-ras mutations but not APC mutations,38,39,40a finding further emphasizing the value of APC for stool-basedtesting.
In summary, it is possible to detect APC mutations in fecalDNA in patients with potentially curable colorectal tumors.It is important to emphasize, however, that our study does notdemonstrate that the digital-protein-truncation test is a clinicallyuseful screening test. It was of interest that five of the controlpatients in our study underwent colonoscopy because of a positivefecal occult-blood test, whereas in another six, the reasonfor undergoing colonoscopy was rectal bleeding, which precludesfecal occult-blood testing. Although this result points to thepotential value of a more specific genetically based test forscreening feces, further studies will be required to determinewhether the digital-protein-truncation test is as sensitiveand specific as the fecal occult-blood test in persons at averagerisk. Because the digital-protein-truncation test is based onthe identification of abnormal proteins synthesized from mutantgenes, the powerful new tools being developed for proteomicsshould be directly applicable to this approach in the future,further increasing its power.
Supported by the National Colorectal Cancer Research Alliance,by the Caroline Law Fund, by the University of Texas M.D. AndersonCancer Center, by the Clayton Fund, and by grants (CA 62924,CA 43460, CA 57345, and GM 07184) from the National Institutesof Health.
Drs. Kinzler and Vogelstein are entitled to royalties on salesof products related to the use of stool DNA for the diagnosisof cancer. Dr. Kinzler owns stock in and serves as a consultantto Genzyme and Exact Sciences. Dr. Vogelstein owns stock inand has served as a consultant to Genzyme and Exact Sciences.Dr. Schoetz owns stock in Exact Sciences, and the recruitmentof patients and collection of samples at the Lahey Clinic werefunded in part by Exact Sciences.
We are indebted to Dr. Steven N. Goodman for statistical evaluation;to Ms. Pam Shaw, Ms. Ji-Lei Jiang, Ms. Janice Gorham, Mr. CarloRago, and Mr. Dipayan Chaudhuri for expert technical assistance;to Drs. F. Lyone Hochman, Michael F. Appel, and Atilla Ertanfor assistance with sample accrual; and to Dr. Ie-Ming Shihfor pathological consultation.
Source Information
From the Graduate Program in Human Genetics (G.T.), Howard Hughes Medical Institute (B.V.), and the Sidney Kimmel Comprehensive Cancer Center at Johns Hopkins (G.T., K.W.K., B.V.), Johns Hopkins School of Medicine, Baltimore; Exact Sciences, Maynard, Mass. (A.S., K.B.); the Division of Cancer Prevention (B.L.), the Department of Epidemiology (C.J.), and the Division of Pathology and Laboratory Medicine (S.R.H.), University of Texas M.D. Anderson Cancer Center, Houston; the Department of Surgery, Central Hospital, Västerås, Center for Clinical Research, Uppsala University, Uppsala, Sweden (L.O.); and the Department of Colon-Rectal Surgery, Lahey Clinic, Burlington, Mass. (D.J.S.).
Address reprint requests to Dr. Vogelstein at the Sidney Kimmel Comprehensive Cancer Center, 1650 Orleans St., Baltimore, MD 21231, or at vogelbe{at}welch.jhu.edu.
References
Newcomb PA, Norfleet RG, Storer BE, Surawicz TS, Marcus PM. Screening sigmoidoscopy and colorectal cancer mortality. J Natl Cancer Inst 1992;84:1572-1575. [Free Full Text]
Selby JV, Friedman GD, Quesenberry CP Jr, Weiss NS. A case-control study of screening sigmoidoscopy and mortality from colorectal cancer. N Engl J Med 1992;326:653-657. [Abstract]
Lieberman DA, Weiss DG, Bond JH, Ahnen DJ, Garewal H, Chejfec G. Use of colonoscopy to screen asymptomatic adults for colorectal cancer. N Engl J Med 2000;343:162-168. [Erratum, N Engl J Med 2000;343:1204.] [Free Full Text]
Imperiale TF, Wagner DR, Lin CY, Larkin GN, Rogge JD, Ransohoff DF. Risk of advanced proximal neoplasms in asymptomatic adults according to the distal colorectal findings. N Engl J Med 2000;343:169-174. [Free Full Text]
Trends in screening for colorectal cancer -- United States, 1997 and 1999. JAMA 2001;285:1570-1571. [Free Full Text]
Scotiniotis I, Lewis JD, Strom BL. Screening for colorectal cancer and other GI cancers. Curr Opin Oncol 1999;11:305-311. [Medline]
Mandel JS, Bond JH, Church TR, et al. Reducing mortality from colorectal cancer by screening for fecal occult blood. N Engl J Med 1993;328:1365-1371. [Erratum, N Engl J Med 1993;329:672.] [Free Full Text]
Kronborg O, Fenger C, Olsen J, Jorgensen OD, Sondergaard O. Randomised study of screening for colorectal cancer with faecal-occult-blood test. Lancet 1996;348:1467-1471. [CrossRef][ISI][Medline]
Hardcastle JD, Chamberlain JO, Robinson MH, et al. Randomised controlled trial of faecal-occult-blood screening for colorectal cancer. Lancet 1996;348:1472-1477. [CrossRef][ISI][Medline]
Towler B, Irwig L, Glasziou P, Kewenter J, Weller D, Silagy C. A systematic review of the effects of screening for colorectal cancer using the faecal occult blood test, Hemoccult. BMJ 1998;317:559-565. [Free Full Text]
Mandel JS, Church TR, Bond JH, et al. The effect of fecal occult-blood screening on the incidence of colorectal cancer. N Engl J Med 2000;343:1603-1607. [Free Full Text]
Allison JE, Feldman R, Tekawa IS. Hemoccult screening in detecting colorectal neoplasm: sensitivity, specificity, and predictive value: long-term follow-up in a large group practice setting. Ann Intern Med 1990;112:328-333.
Verne JE, Aubrey R, Love SB, Talbot IC, Northover JM. Population based randomized study of uptake and yield of screening by flexible sigmoidoscopy compared with screening by faecal occult blood testing. BMJ 1998;317:182-185. [Free Full Text]
Mandel JS, Church TR, Ederer F, Bond JH. Colorectal cancer mortality: effectiveness of biennial screening for fecal occult blood. J Natl Cancer Inst 1999;91:434-437. [Free Full Text]
Rozen P, Knaani J, Samuel Z. Comparative screening with a sensitive guaiac and specific immunochemical occult blood test in an endoscopic study. Cancer 2000;89:46-52. [CrossRef][ISI][Medline]
Ore L, Hagoel L, Lavi I, Rennert G. Screening with faecal occult blood test (FOBT) for colorectal cancer: assessment of two methods that attempt to improve compliance. Eur J Cancer Prev 2001;10:251-256. [CrossRef][ISI][Medline]
Shields HM, Weiner MS, Henry DR, et al. Factors that influence the decision to do an adequate evaluation of a patient with a positive stool for occult blood. Am J Gastroenterol 2001;96:196-203. [CrossRef][ISI][Medline]
Vogelstein B, Kinzler KW, eds. The genetic basis of human cancer. New York: McGraw-Hill, 1998.
Sidransky D, Tokino T, Hamilton SR, et al. Identification of ras oncogene mutations in the stool of patients with curable colorectal tumors. Science 1992;256:102-105. [Free Full Text]
Smith-Ravin J, England J, Talbot IC, Bodmer W. Detection of c-Ki-ras mutations in faecal samples from sporadic colorectal cancer patients. Gut 1995;36:81-86. [Free Full Text]
Hasegawa Y, Takeda S, Ichii S, et al. Detection of K-ras mutations in DNAs isolated from feces of patients with colorectal tumors by mutant-allele-specific amplification (MASA). Oncogene 1995;10:1441-1445. [ISI][Medline]
Ulvik A, Koornstra JJ, Røkke O, Halvorsen JF, Haug K, Øgreid D. Påvishing av aktivert protoonkogen (Ki-ras) i avføringsprøver: ny laboratorieanalyse for tidlig diagnostikk av kolorektal cancer. Tidsskr Nor Laegeforen 1995;115:3266-3270. [Medline]
Ratto C, Flamini G, Sofo L, et al. Detection of oncogene mutation from neoplastic colonic cells exfoliated in feces. Dis Colon Rectum 1996;39:1238-1244. [CrossRef][ISI][Medline]
Villa E, Dugani A, Rebecchi AM, et al. Identification of subjects at risk for colorectal carcinoma through a test based on K-ras determination in the stool. Gastroenterology 1996;110:1346-1353. [CrossRef][ISI][Medline]
Eguchi S, Kohara N, Komuta K, Kanematsu T. Mutations of the p53 gene in the stool of patients with resectable colorectal cancer. Cancer 1996;77:Suppl:1707-1710. [ISI][Medline]
Kohata Y. Detection of K-ras point mutations in the stool of patients with colorectal tumors. Nippon Shokakibyo Gakkai Zasshi 1996;93:391-397. [Medline]
Nollau P, Moser C, Weinland G, Wagener C. Detection of K-ras mutations in stools of patients with colorectal cancer by mutant-enriched PCR. Int J Cancer 1996;66:332-336. [CrossRef][ISI][Medline]
Deuter R, Muller O. Detection of APC mutations in stool DNA of patients with colorectal cancer by HD-PCR. Hum Mutat 1998;11:84-89. [CrossRef][ISI][Medline]
Puig P, Urgell E, Capella G, et al. Improved detection of K-ras codon 12 mutations in fecal exfoliated cells. Lab Invest 1999;79:617-618. [ISI][Medline]
Ahlquist DA, Skoletsky JE, Boynton KA, et al. Colorectal cancer screening by detection of altered human DNA in stool: feasibility of a multitarget assay panel. Gastroenterology 2000;119:1219-1227. [CrossRef][ISI][Medline]
Dong SM, Traverso G, Johnson C, et al. Detecting colorectal cancer in stool with the use of multiple genetic targets. J Natl Cancer Inst 2001;93:858-865. [Free Full Text]
Rengucci C, Maiolo P, Saragoni L, Zoli W, Amadori D, Calistri D. Multiple detection of genetic alterations in tumors and stool. Clin Cancer Res 2001;7:590-593. [Free Full Text]
Doolittle BR, Emanuel J, Tuttle C, Costa J. Detection of the mutated K-Ras biomarker in colorectal carcinoma. Exp Mol Pathol 2001;70:289-301. [CrossRef][Medline]
Kinzler KW, Vogelstein B. Lessons from hereditary colorectal cancer. Cell 1996;87:159-170. [CrossRef][ISI][Medline]
Tsao J, Shibata D. Further evidence that one of the earliest alterations in colorectal carcinogenesis involves APC. Am J Pathol 1994;145:531-534. [Abstract]
Baker SJ, Preisinger AC, Jessup JM, et al. p53 Gene mutations occur in combination with 17p allelic deletions as late events in colorectal tumorigenesis. Cancer Res 1990;50:7717-7722. [Free Full Text]
Smith AJ, Stern HS, Penner M, et al. Somatic APC and K-ras codon 12 mutations in aberrant crypt foci from human colons. Cancer Res 1994;54:5527-5530. [Free Full Text]
Jen J, Powell SM, Papadopoulos N, et al. Molecular determinants of dysplasia in colorectal lesions. Cancer Res 1994;54:5523-5526. [Free Full Text]
Pretlow TP. Aberrant crypt foci and K-ras mutations: earliest recognized players or innocent bystanders in colon carcinogenesis? Gastroenterology 1995;108:600-603. [CrossRef][Medline]
Laurent-Puig P, Beroud C, Soussi T. APC gene: database of germline and somatic mutations in human tumors and cell lines. Nucleic Acids Res 1998;26:269-270. [Free Full Text]
Bond JH. Clinical relevance of the small colorectal polyp. Endoscopy 2001;33:454-457. [CrossRef][Medline]
Powell SM, Petersen GM, Krush AJ, et al. Molecular diagnosis of familial adenomatous polyposis. N Engl J Med 1993;329:1982-1987. [Free Full Text]
van der Luijt R, Khan PM, Vasen H, et al. Rapid detection of translation-terminating mutations at the adenomatous polyposis coli (APC) gene by direct protein truncation test. Genomics 1994;20:1-4. [CrossRef][ISI][Medline]
Koga, Y., Yasunaga, M., Moriya, Y., Akasu, T., Fujita, S., Yamamoto, S., Baba, H., Matsumura, Y.
(2008). Detection of the DNA Point Mutation of Colorectal Cancer Cells Isolated from Feces Stored Under Different Conditions. Jpn J Clin Oncol
0: hyn129v1-8
[Abstract][Full Text]
Ahlquist, D. A., Sargent, D. J., Loprinzi, C. L., Levin, T. R., Rex, D. K., Ahnen, D. J., Knigge, K., Lance, M. P., Burgart, L. J., Hamilton, S. R., Allison, J. E., Lawson, M. J., Devens, M. E., Harrington, J. J., Hillman, S. L.
(2008). Stool DNA and Occult Blood Testing for Screen Detection of Colorectal Neoplasia. ANN INTERN MED
149: 441-450
[Abstract][Full Text]
Velculescu, V. E.
(2008). Defining the blueprint of the cancer genome. Carcinogenesis
29: 1087-1091
[Abstract][Full Text]
Zou, H., Harrington, J., Rego, R. L., Ahlquist, D. A.
(2007). A Novel Method to Capture Methylated Human DNA from Stool: Implications for Colorectal Cancer Screening. Clin. Chem.
53: 1646-1651
[Abstract][Full Text]
Mathers, J. C., Hesketh, J. E.
(2007). The Biological Revolution: Understanding the Impact of SNPs on Diet-Cancer Interrelationships. J. Nutr.
137: 253S-258S
[Abstract][Full Text]
Levin, B.
(2006). Molecular Screening Testing for Colorectal Cancer. Clin. Cancer Res.
12: 5014-5017
[Full Text]
Zou, H., Harrington, J. J., Klatt, K. K., Ahlquist, D. A.
(2006). A sensitive method to quantify human long DNA in stool: relevance to colorectal cancer screening.. Cancer Epidemiol. Biomarkers Prev.
15: 1115-1119
[Abstract][Full Text]
Sun, X., Liu, Y., Lutterbaugh, J., Chen, W.-D., Markowitz, S. D., Guo, B.
(2006). Detection of Mononucleotide Repeat Sequence Alterations in a Large Background of Normal DNA for Screening High-Frequency Microsatellite Instability Cancers. Clin. Cancer Res.
12: 454-459
[Abstract][Full Text]
Chen, W.-D., Han, Z. J., Skoletsky, J., Olson, J., Sah, J., Myeroff, L., Platzer, P., Lu, S., Dawson, D., Willis, J., Pretlow, T. P., Lutterbaugh, J., Kasturi, L., Willson, J. K. V., Rao, J. S., Shuber, A., Markowitz, S. D.
(2005). Detection in Fecal DNA of Colon Cancer-Specific Methylation of the Nonexpressed Vimentin Gene. JNCI J Natl Cancer Inst
97: 1124-1132
[Abstract][Full Text]
Jardine, V L, Sala, E, Lomas, D J
(2005). MR colonography: baseline appearance of the unprepared rectosigmoid. Br. J. Radiol.
78: 202-206
[Abstract][Full Text]
Petko, Z., Ghiassi, M., Shuber, A., Gorham, J., Smalley, W., Washington, M. K., Schultenover, S., Gautam, S., Markowitz, S. D., Grady, W. M.
(2005). Aberrantly Methylated CDKN2A, MGMT, and MLH1 in Colon Polyps and in Fecal DNA from Patients with Colorectal Polyps. Clin. Cancer Res.
11: 1203-1209
[Abstract][Full Text]
Lippman, S. M., Levin, B.
(2005). Cancer Prevention: Strong Science and Real Medicine. JCO
23: 249-253
[Full Text]
Hawk, E. T., Levin, B.
(2005). Colorectal Cancer Prevention. JCO
23: 378-391
[Abstract][Full Text]
Imperiale, T. F., Ransohoff, D. F., Itzkowitz, S. H., Turnbull, B. A., Ross, M. E., the Colorectal Cancer Study Group,
(2004). Fecal DNA versus Fecal Occult Blood for Colorectal-Cancer Screening in an Average-Risk Population. NEJM
351: 2704-2714
[Abstract][Full Text]
Whitney, D., Skoletsky, J., Moore, K., Boynton, K., Kann, L., Brand, R., Syngal, S., Lawson, M., Shuber, A.
(2004). Enhanced Retrieval of DNA from Human Fecal Samples Results in Improved Performance of Colorectal Cancer Screening Test. J. Mol. Diagn.
6: 386-395
[Abstract][Full Text]
Karlan, B. Y.
(2004). The Colon Is a Pelvic Organ Too: Taking the Couric Challenge. Obstet Gynecol
104: 907-909
[Full Text]
Leung, W. K., To, K.-F., Man, E. P.S., Chan, M. W.Y., Bai, A. H.C., Hui, A. J., Chan, F. K.L., Lee, J. F.Y., Sung, J. J. Y.
(2004). Detection of Epigenetic Changes in Fecal DNA as a Molecular Screening Test for Colorectal Cancer: A Feasibility Study. Clin. Chem.
50: 2179-2182
[Full Text]
Pincas, H., Pingle, M. R., Huang, J., Lao, K., Paty, P. B., Friedman, A. M., Barany, F.
(2004). High sensitivity EndoV mutation scanning through real-time ligase proofreading. Nucleic Acids Res
32: e148-e148
[Abstract][Full Text]
Khoury, M. J, Millikan, R., Little, J., Gwinn, M.
(2004). The emergence of epidemiology in the genomics age. Int J Epidemiol
33: 936-944
[Full Text]
Belshaw, N. J., Elliott, G. O., Williams, E. A., Bradburn, D. M., Mills, S. J., Mathers, J. C., Johnson, I. T.
(2004). Use of DNA from Human Stools to Detect Aberrant CpG Island Methylation of Genes Implicated in Colorectal Cancer. Cancer Epidemiol. Biomarkers Prev.
13: 1495-1501
[Abstract][Full Text]
Wong, S C C, Lo, E S F, Cheung, M T
(2004). An optimised protocol for the extraction of non-viral mRNA from human plasma frozen for three years. J. Clin. Pathol.
57: 766-768
[Abstract][Full Text]
Maitra, A., Cohen, Y., Gillespie, S. E.D., Mambo, E., Fukushima, N., Hoque, M. O., Shah, N., Goggins, M., Califano, J., Sidransky, D., Chakravarti, A.
(2004). The Human MitoChip: A High-Throughput Sequencing Microarray for Mitochondrial Mutation Detection. Genome Res
14: 812-819
[Abstract][Full Text]
Hasan, R. K., Wulfkuhle, J. D., Liotta, L. A., Petricoin, E. F
(2004). Molecular Technologies for Personalized Cancer Management. JAMA
291: 1644-1645
[Full Text]
Sabichi, A. L., Demierre, M.-F., Hawk, E. T., Lerman, C. E., Lippman, S. M.
(2003). Frontiers in Cancer Prevention Research. Cancer Res.
63: 5649-5655
[Full Text]
Schoen, R. E., Pinsky, P. F., Weissfeld, J. L., Bresalier, R. S., Church, T., Prorok, P., Gohagan, J. K.
(2003). Results of Repeat Sigmoidoscopy 3 Years After a Negative Examination. JAMA
290: 41-48
[Abstract][Full Text]
Delude, C.
(2003). Genetic Research: Mining for Medical Treasures. FASEB J.
17: 787e-787
[Full Text]
Ferenci, P
(2003). How to identify the genetic basis of gastrointestinal and liver diseases?. Gut
52: ii6-9
[Abstract][Full Text]
Walsh, J. M. E., Terdiman, J. P.
(2003). Colorectal Cancer Screening: Scientific Review. JAMA
289: 1288-1296
[Abstract][Full Text]
Macafee, D A L, Scholefield, J H
(2003). Population based endoscopic screening for colorectal cancer. Gut
52: 323-326
[Full Text]
Araki, Y., Okamura, S., Hussain, S. P., Nagashima, M., He, P., Shiseki, M., Miura, K., Harris, C. C.
(2003). Regulation of Cyclooxygenase-2 Expression by the Wnt and Ras Pathways. Cancer Res.
63: 728-734
[Abstract][Full Text]
Frattini, M., Balestra, D., Pilotti, S., Bertario, L., Pierotti, M. A.
(2003). Tumor Location and Detection of K-Ras Mutations in Stool From Colorectal Cancer Patients. JNCI J Natl Cancer Inst
95: 72-73
[Full Text]
Jen, J., Vogelstein, B.
(2003). RESPONSE: Tumor Location and Detection of K-Ras Mutations in Stool From Colorectal Cancer Patients. JNCI J Natl Cancer Inst
95: 73-73
[Full Text]
Levin, B., Brooks, D., Smith, R. A., Stone, A.
(2003). Emerging Technologies in Screening for Colorectal Cancer: CT Colonography, Immunochemical Fecal Occult Blood Tests, and Stool Screening Using Molecular Markers. CA Cancer J Clin
53: 44-55
[Abstract][Full Text]
Moayyedi, P., Ford, A.
(2002). Recent developments in gastroenterology. BMJ
325: 1399-1402
[Full Text]
Lippman, S. M., Hong, W. K.
(2002). Cancer Prevention Science and Practice. Cancer Res.
62: 5119-5125
[Full Text]
Ransohoff, D. F., Traverso, G., Kinzler, K. W., Vogelstein, B.
(2002). Fecal DNA Tests for Colorectal Cancer. NEJM
346: 1912-1913
[Full Text]
Toyooka, S., Toyooka, K. O., Harada, K., Miyajima, K., Makarla, P., Sathyanarayana, U. G., Yin, J., Sato, F., Shivapurkar, N., Meltzer, S. J., Gazdar, A. F.
(2002). Aberrant Methylation of the CDH13 (H-cadherin) Promoter Region in Colorectal Cancers and Adenomas. Cancer Res.
62: 3382-3386
[Abstract][Full Text]
(2002). More on Stool DNA Tests for Colorectal Cancer and Adenomas. JWatch Gastroenterology
2002: 1-1
[Full Text]
(2002). New Fecal Test for Colorectal Tumors. JWatch General
2002: 1-1
[Full Text]