The detection of an increasing number of circulating recombinantstrains of human immunodeficiency virus type 1 (HIV-1) indicatesthat genetic recombination can occur in cells infected withtwo strains of HIV-1.1,2 Coinfection with two circulating strainsof HIV-1 has been detected in a few subjects in communitieswhere HIV-1 infection is endemic.3 Coinfection may result fromexposure to a second virus either shortly after the initialinfection or during the course of established HIV-1 infection;the latter circumstance is called superinfection.
Most viral infections induce lifelong immunity, but reinfectionwith respiratory viruses such as respiratory syncytial virusis common, most likely because immunity becomes nonprotectiveor fades. It is thought that HIV-1 superinfection is a rareevent1,2,3,4,5,6 and that it is prevented by previous viralexposure through a phenomenon called superinfection immunity.5However, HIV-1 superinfection has been induced experimentallyin chimpanzees.7 In this animal model and in superinfectioninduced with the simian immunodeficiency virus in macaques,the second infection produces a slower deterioration in immunitythan does the initial infection,7,8,9 and there is more efficientcontrol of viremia. In this article, we report a case of HIV-1superinfection.
Case Report
In November 1998, a 38-year-old man presented with an acuteretroviral syndrome. AntiHIV-1 antibodies were undetectable,the level of p24 antigen was greater than 100 pg per millimeter,the plasma level of HIV-1 RNA was 805,000 copies per milliliter,and the CD4 cell count was 684 per cubic millimeter. Sequencesof the HIV-1 reverse transcriptase and protease genes revealedno mutations associated with drug resistance and identifiedthe HIV-1 as subtype AE. For years, the patient had had sexualcontacts with multiple unknown male partners. He enrolled inthe QUEST trial10 in November 1998 and received highly activeantiretroviral treatment (HAART) with zidovudine, lamivudine,abacavir, and amprenavir for 27 months. From month 21 to month27 he participated in a vaccination trial and was randomly assignedto receive ALVAC vector vCP1452.11
Six weeks after the initiation of HAART, the plasma level ofHIV-1 RNA declined to 1000 copies per milliliter. Treatmentwas then interrupted for six weeks because of toxic effectson the liver. After HAART was resumed, the HIV-1 RNA level decreasedrapidly, to less than 50 copies per milliliter (Figure 1). Aftervaccination, HAART was again interrupted (on January 21, 2001)as part of the vaccine research protocol. In February 2001,the patient's plasma HIV-1 RNA level rose to 80,000 copies permilliliter (the first rebound) and then decreased to 21,000copies per milliliter. A rapid increase in the HIV-1 RNA levelwas next observed on April 10 (the second rebound), and forthe next four months the level fluctuated between 200,000 and400,000 copies per milliliter. The patient's symptoms (transientfatigue and fever) were mild, and he declined to resume HAARTduring this period. His history revealed that he had had severalunprotected sexual contacts in Brazil three weeks before thesecond rebound of viremia. Four months after the second rebound,however, HAART was resumed, and the plasma level of HIV-1 RNArapidly decreased. Treatment was again interrupted after anincrease in the alanine aminotransferase level to 800 U perliter, as compared with a level of 200 U per liter before HAART.At this time, serologic data and quantification of hepatitisC virus (HCV) RNA (Figure 1) documented an acute HCV infection.The increase in alanine aminotransferase was attributed bothto HCV infection and to drug-induced toxic effects. Treatmentwith pegylated interferon and ribavirin was followed by clearanceof HCV RNA (to less than 500 copies per milliliter) within twomonths.
Figure 1. HIV-1 RNA Levels and CD4 Cell Counts during Acute HIV-1 Infection and 31 Months of Follow-up.
The limit of detection of HIV-1 RNA was 10 copies per milliliter. The horizontal bars show the periods during which the patient received highly active antiretroviral therapy (HAART) and the period of vaccination with ALVAC vCP1452, and the horizontal arrows show the change from subtype AE to subtype B. Also shown are the results of serologic tests for hepatitis B virus (HBV) and hepatitis C virus (HCV) and the qualitative results of analysis of plasma HCV RNA. Plus signs denote a positive result, and minus signs a negative result. The first sample positive for HCV RNA contained 103,000 copies per milliliter and was of genotype 3a.
Methods
Assays
The levels of HIV-1 and HCV RNA in the plasma were quantitated(Amplicor HIV-1 Monitor Test, version 1.5, Roche Diagnostics),and serologic analyses, including analysis of p24 antigen, wereperformed with enzyme immunoassays (Abbott). The following stepswere performed as previously described12,13: purification ofplasma RNA and proviral DNA, population sequencing of HIV-1reverse transcriptase and protease and of the gag p17 and envC2V3 gene regions, and analyses of sequences.
Subtype-Specific Polymerase Chain Reaction
Primers were selected according to the patient's subtype AEand subtype B protease and reverse-transcriptase sequences,as follows: AE sense primer (position 2289 to 2312, based onthe subtype B reference genome HXB2; GenBank accession number,KO3455), 5'ACAGTAAAAATAGGAGGACAG; B sense primer, 5'ATAAAGGTAGGGGGGCAATTAAAG;AE antisense primer (position 2786 to 2806), 5'TCCTGAGTTCTTTTATTGAGC;and B antisense primer (position 2687 to 2712), 5'GATTTTCAGGCCCAATTTTTGAAATT.The polymerase chain reaction (PCR) consisted of 40 amplificationcycles at 95°C for 20 seconds and 65°C for 30 seconds.For each PCR, 100 µl of RNA was extracted from plasma.
In mixing experiments, the subtype-specific primers allowedthe detection of approximately 20 copies of the homologous subtypeamong 250,000 copies of the heterologous subtype and did notamplify the heterologous subtype. Successive plasma sampleswere amplified by both primer pairs within the same experiment.Twenty microliters of the amplicons was placed on a nylon membrane,which was hybridized with digoxigeninend-labeled probe(2431 to 2451, 5'ATTAAAGCCAGGAATGGATGG) and revealed with theuse of anti-digoxigenin Fab fragments conjugated with alkalinephosphatase (DIG High Prime DNA labeling and Detection StarterKit II reagents, Roche Diagnostics) as recommended by the manufacturer.
HIV-1 Proviral DNA PCR
PCR was performed with 1 µg of DNA purified from peripheral-bloodmononuclear cells by nested PCR. The first reaction consistedof 40 amplification cycles at 95°C for 20 seconds and 50°Cfor 30 seconds with the use of sense and antisense primers (positions1627 to 1655 and 2791 to 2812 of HXB2). Five percent of theamplicons were introduced into the nested PCR with the use ofsubtype-specific primers as described above. In mixing experiments,the subtype-specific primers allowed the detection of approximately10 copies of the homologous proviral DNA subtype among 1000copies of the heterologous subtype and did not amplify the heterologoussubtype. Twenty microliters of the amplicons was subjected toelectrophoresis on 2 percent agarose gel and stained with ethidiumbromide.
Isolation and Growth of Subtypes AE and B in Vitro
Stored peripheral-blood mononuclear cells collected at the timeof acute infection and one month after the second rebound ofviremia after the discontinuation of HAART were depleted ofCD8 T cells by beads coated with anti-CD8 (Dynabeads, Dynal),cocultivated with phytohemagglutinin-stimulated CD8-depletedperipheral-blood mononuclear cells from a single uninfectedblood donor. Culture supernatants were collected during viralexponential growth, which was assessed by quantification ofp24 antigen in culture supernatant (detection limit, 3 pg permilliliter). New cultures of CD8-depleted peripheral-blood mononuclearcells (2x106 cells) were inoculated in duplicate with 20 pgand 100 pg of p24 antigen recovered from the primary culturescontaining the AE and B subtypes, respectively. Viral replicationwas monitored by quantification of p24 antigen in the culturesupernatants.
Interferon- CD8 Enzyme-Linked Immunospot Assay
Peptides (8- to 15-mers) were synthesized according to the patient'savailable subtype AE and B sequences and his HLA subtypes (HLA-A*01/02and HLA-B*51/57). CD8 enzyme-linked immunospot assays (Elispot)were performed as previously reported.14 We also used an algorithmto generate a score that would predict the degree of bindingbetween a peptide and an HLA molecule.14
Results
The evolution of HIV-1 viremia and CD4 cell counts is shownin Figure 1. Successive serologic analyses for hepatitis B virus(HBV) and HCV as well as quantification of HCV RNA indicatethat the patient was coinfected with HBV and HIV-1 in Octoberor November 1998 and was infected with HCV in about March 2001.Sequencing of the reverse transcriptase and protease genes inthree successive plasma samples obtained at the time of acuteinfection, in a DNA sample obtained in January 2001, and ina plasma sample obtained at the time of the first rebound (inFebruary 2001) identified the HIV-1 subtype AE in all instances(data not shown). Sequencing of the gag p17 and env C2V3 regionsperformed during the same period also indicated that the AEsubtype was present. In contrast, sequencing of reverse transcriptase,protease, gag p17, and env C2V3 from plasma collected in April,May, and November 2001 indicated the presence of the HIV-1 subtypeB (GenBank accession numbers: subtype AE, AY122635-40, and subtypeB, AF517666-72). Figure 2 shows the results of the phylogeneticanalysis of the env C2V3 sequences. The subtype B sequencesin our patient from the end of April 2001 to April 2002 segregatedwith subtype B sequences from Brazil (BR.U16219, BR.U08800,and BR.U08799), with a bootstrap value of 86 percent.
Figure 2. Phylogenetic Analysis of env C2V3 Sequences.
Phylogenetic analysis was performed according to the FitchMargoliash method (with Phylogeny Inference Package software)15 with selected reference sequences, including subtype B sequences from Brazil and the patient's sequences derived from plasma samples (obtained November 18, 1998; February 21, April 23, June 12, and November 23, 2001; and January 4, 2002) and from a proviral DNA sample (obtained January 23, 2001). Letters outside parentheses are HIV-1 subtypes; codes inside parentheses refer to the country of origin and the number of the sequence according to the HIV Los Alamos data base (http://hiv-web.lanl.gov).2 Bootstrap values greater than 80 percent are indicated. The shaded bar indicates a genetic distance of 0.1 (10 percent divergence of nucleotide sequences).
To enhance the sensitivity of the detection of HIV-1 species,we performed plasma PCR with subtype B- and AE-specific primers.The only detectable virus circulating in plasma during the acuteHIV-1 infection from November 1998 to March 2001 was of theAE subtype (Figure 3A). In April 2001, during the second reboundof viremia, amplicons from both the AE subtype (weak staining)and B subtype (predominant staining) were detected. In subsequentplasma samples, the B subtype was predominant, with intermittenttraces of the AE subtype. Only the AE-specific primers amplifiedproviral DNA purified from peripheral-blood mononuclear cellscollected in November 1998 and March 2001, whereas both AE-and B-specific primers amplified DNA collected in April 2001(Figure 3B). Three months later, only B subtype amplicons weredetectable.
Figure 3. HIV-1 Subtype-Specific Analysis of Plasma RNA and Proviral DNA Amplified by the Polymerase Chain Reaction.
Panel A shows the results of immunoblot analysis, with chemiluminescence of amplicons derived from plasma HIV-1 RNA collected during the acute HIV-1 infection up to October 2001. The top row shows samples amplified by subtype AEspecific primers, and the bottom row shows samples amplified by subtype Bspecific primers. Panel B shows the results of electrophoresis, with ethidium bromide staining of amplicons derived from HIV-1 proviral DNA. Proviral DNA from peripheral-blood mononuclear cells was amplified by nested polymerase chain reaction. Subtype AE and subtype B amplicons had the expected molecular size, expressed in base pairs. The control corresponds to DNA purified from an uninfected, healthy blood donor. The first column contains molecular weight (MW) markers (X174 restriction-fragment DNA purified with HaeIII).
The responses of CD8 cells to the patient's AE- and B-specificepitopes were investigated with the use of enzyme-linked immunospotassays. Only cells directed against AE-specific epitope SLYNTVATL(denoted with single-letter codes for amino acids) were detectedbetween November 1998 and March 2001 (from 595 to 727 spot-formingcells per 106 peripheral-blood mononuclear cells). They markedlydecreased in number after the switch to the B subtype (epitopeSLFNTIAVL) in April 2001 (100 spot-forming cells per 106 peripheral-bloodmononuclear cells) (Table 1). This B sequence, which containedmutations affecting the HLA-A2 binding score (which was 157for the AE peptide and 75 for the B peptide), was not recognizedat any time. In addition, 10 other reverse-transcriptase peptidescorresponding to AE or B sequences were tested but were notidentified at any time.
Table 1. Responses of CD8 Cells to Peptide-Specific Epitopes.
We assessed the growth of subtype AE and B isolates in cultureswith inocula of 20 pg and 100 pg of p24 antigen. The releaseof p24 antigen in culture supernatant was detected on day 3with both the 100-pg and 20-pg inocula of B isolate, whereaswith the subtype AE isolate, p24 antigen was detected only onday 7 (100-pg inoculum) and day 9 (20-pg inoculum).
Discussion
The patient we describe had HIV-1 seroconversion in November1998 as a result of infection with HIV-1 subtype AE; the infectionwas successfully treated with HAART. After the interruptionof HAART at the end of January 2001, subtype AE viremia rebounded(in February); the viremia then declined during the followingtwo weeks before a second rebound, at which time the HIV-1 RNAlevel plateaued at 400,000 copies per milliliter. This secondrebound involved HIV-1 subtype B, which rapidly replaced subtypeAE. This subtype B virus segregated with isolates from Brazil,a finding consistent with the patient's recent travel and sexualexposures in that country.
This observation provides strong evidence of HIV-1 superinfection.To rule out coinfection, we attempted to amplify subtype B bymeans of subtype-specific PCR. We failed to detect subtype Bin plasma RNA or in proviral DNA samples obtained up until thesecond viremia rebound. In addition, the subtype B isolate hada higher replicative capacity in vitro than the subtype AE isolateand, once detected, rapidly replaced subtype AE in vivo.
Strong, HIV-1specific CD8-cell responses were directedagainst a single AE-derived epitope during the period of infectionwith subtype AE. None of the subtype B epitopes derived fromthe patient's sequences were recognized at any time during eithersubtype AE or subtype B infection. The drop in subtype AE CD8cells at the time of the switch in subtypes could be attributedto the sequence variation in the B epitope that affected HLA-bindingcapacity. That the inhibition of subtype AE replication wasdue to an immune response to ALVAC epitopes after immunizationcannot be ruled out, since the p17 peptide SLYNTVATL in thepatient's AE was identical to the "subtype B" gag sequence insertedinto ALVAC.11
The biologic course after HIV-1 subtype B superinfection wascharacterized by the persistence of high plasma levels of HIV-1RNA and a loss of 300 CD4 cells per cubic millimeter withinthe four months after the emergence of subtype B. The subtypeB superinfection led to rapid progression of disease,16 in contrastto the pattern of disease observed after experimental superinfectionin monkeys.7,8,9 The early initiation of HAART in our patientmay have limited his exposure to HIV-1 antigens and his HIV-1specificimmune responses. In North America and western Europe, subtypeB predominates and diversifies rapidly within individual patients,17rendering the detection of superinfection especially difficult;the frequency of superinfection might thus be underestimated.
Our data indicate that natural infection does not necessarilyinduce cross-clade protection. There should be close monitoringof circulating HIV-1 strains in the context of vaccine development.Our observations also support the use of safe-sex precautionseven among HIV-1infected persons.
Supported by an unrestricted grant from GlaxoSmithKline andby a grant (3345-64120.00) from the Swiss National ResearchFoundation.
We are indebted to Kim Zollinger, Chantal Gaille, Laurence Wegmann,and Virginie Perrin for excellent technical support and to Anne-MarieAlajarin for editorial help.
Source Information
From the Division of Infectious Diseases, University of Geneva, Geneva (S.J., M.-C.B., L.K., S.Y., B.H., L.P.); the Laboratoire d'Immunologie Cellulaire, Hôpital Pitié Salpêtrière, Paris (A.S., B.A.); and Clinical Development Medical Affairs, GlaxoSmithKline, Greenford, United Kingdom (L.-E.G.).
Address reprint requests to Dr. Perrin at the Laboratory of Virology, Geneva University Hospital, 1211 Geneva 14, Switzerland, or at luc.perrin{at}hcuge.ch.
References
Korber B, Gaschen B, Yusim K, Thakallapally R, Kesmir C, Detours V. Evolutionary and immunological implications of contemporary HIV-1 variation. Br Med Bull 2001;58:19-42. [Free Full Text]
HIV sequence data base: the circulating recombinant forms (CRFs) of HIV-1. Los Alamos, N.M.: Los Alamos National Laboratory, 2002. (Also available at http://hiv-web.lanl.gov/CRFs/CRFs.html.)
Kampinga GA, Simonon A, Van de Perre P, Karita E, Msellati P, Goudsmit J. Primary infections with HIV-1 of women and their offspring in Rwanda: findings of heterogeneity at seroconversion, coinfection, and recombinants of HIV-1 subtypes A and C. Virology 1997;227:63-76. [CrossRef][Medline]
Zhu T, Wang N, Carr A, Wolinsky S, Ho DD. Evidence for coinfection by multiple strains of human immunodeficiency virus type 1 subtype B in an acute seroconvertor. J Virol 1995;69:1324-1327. [Abstract]
Malim MH, Emerman M. HIV-1 sequence variation: drift, shift, and attenuation. Cell 2001;104:469-472. [CrossRef][ISI][Medline]
Angel JB, Kravcik S, Balaskas E, et al. Documentation of HIV-1 superinfection and acceleration of disease progression. In: Program and abstracts of the 7th Conference on Retroviruses and Opportunistic Infections, San Francisco, January 30February 2, 2000. San Francisco: Foundation for Retrovirology and Human Health, 2000:235. abstract.
Shibata R, Siemon C, Cho MW, et al. Resistance of previously infected chimpanzees to successive challenges with a heterologous intraclade B strain of human immunodeficiency virus type 1. J Virol 1996;70:4361-4369. [Abstract]
Stephens EB, Joag SV, Atkinson B, et al. Infected macaques that controlled replication of SIVmac or nonpathogenic SHIV developed sterilizing resistance against pathogenic SHIV(KU-1). Virology 1997;234:328-339. [CrossRef][Medline]
Stahl-Hennig C, Dittmer U, Nisslein T, et al. Rapid development of vaccine protection in macaques by live-attenuated simian immunodeficiency virus. J Gen Virol 1996;77:2969-2981. [Free Full Text]
Goh LE, Perrin L, Hoen B, et al. Study protocol for the evaluation of the potential for durable viral suppression after quadruple HAART with or without HIV vaccination: the QUEST study. HIV Clin Trials 2001;2:438-44.
Yerly S, Quadri R, Negro F, et al. Nosocomial outbreak of multiple bloodborne viral infections. J Infect Dis 2001;184:369-372. [CrossRef][ISI][Medline]
Yerly S, Vora S, Rizzardi P, et al. Acute HIV infection: impact on the spread of HIV and transmission of drug resistance. AIDS 2001;15:2287-2292. [CrossRef][ISI][Medline]
Samri A, Haas G, Duntze J, et al. Immunogenicity of mutations induced by nucleoside reverse transcriptase inhibitors for human immunodeficiency virus type 1-specific cytotoxic T cells. J Virol 2000;74:9306-9312. [Free Full Text]
Felsenstein J. PHYLIP, Phylogeny Inference Package, version 3.6 (alpha). Seattle: Department of Genetics, University of Washington, 2001.
Farzadegan H, Henrard DR, Kleeberger CA, et al. Virologic and serologic markers of rapid progression to AIDS after HIV-1 seroconversion. J Acquir Immune Defic Syndr Hum Retrovirol 1996;13:448-455. [ISI][Medline]
Liu SL, Schacker T, Musey L, et al. Divergent patterns of progression to AIDS after infection from the same source: human immunodeficiency virus type 1 evolution and antiviral responses. J Virol 1997;71:4284-4295. [Abstract]
Blish, C. A., Dogan, O. C., Derby, N. R., Nguyen, M.-A., Chohan, B., Richardson, B. A., Overbaugh, J.
(2008). Human Immunodeficiency Virus Type 1 Superinfection Occurs despite Relatively Robust Neutralizing Antibody Responses. J. Virol.
82: 12094-12103
[Abstract][Full Text]
Giannecchini, S., Pistello, M., Isola, P., Matteucci, D., Mazzetti, P., Freer, G., Bendinelli, M.
(2007). Role of Env in Resistance of Feline Immunodeficiency Virus (FIV)-Infected Cats to Superinfection by a Second FIV Strain as Determined by Using a Chimeric Virus. J. Virol.
81: 10474-10485
[Abstract][Full Text]
Deeks, S. G., Schweighardt, B., Wrin, T., Galovich, J., Hoh, R., Sinclair, E., Hunt, P., McCune, J. M., Martin, J. N., Petropoulos, C. J., Hecht, F. M.
(2006). Neutralizing Antibody Responses against Autologous and Heterologous Viruses in Acute versus Chronic Human Immunodeficiency Virus (HIV) Infection: Evidence for a Constraint on the Ability of HIV To Completely Evade Neutralizing Antibody Responses.. J. Virol.
80: 6155-6164
[Abstract][Full Text]
Bergmeier, L.A., Lehner, T.
(2006). Innate and Adaptive Mucosal Immunity in Protection against HIV Infection. Adv. Dent. Res.
19: 21-28
[Abstract][Full Text]
Galetto, R., Giacomoni, V., Veron, M., Negroni, M.
(2006). Dissection of a Circumscribed Recombination Hot Spot in HIV-1 after a Single Infectious Cycle. J. Biol. Chem.
281: 2711-2720
[Abstract][Full Text]
McCutchan, F. E., Hoelscher, M., Tovanabutra, S., Piyasirisilp, S., Sanders-Buell, E., Ramos, G., Jagodzinski, L., Polonis, V., Maboko, L., Mmbando, D., Hoffmann, O., Riedner, G., von Sonnenburg, F., Robb, M., Birx, D. L.
(2005). In-Depth Analysis of a Heterosexually Acquired Human Immunodeficiency Virus Type 1 Superinfection: Evolution, Temporal Fluctuation, and Intercompartment Dynamics from the Seronegative Window Period through 30 Months Postinfection. J. Virol.
79: 11693-11704
[Abstract][Full Text]
Chohan, B., Lavreys, L., Rainwater, S. M. J., Overbaugh, J.
(2005). Evidence for Frequent Reinfection with Human Immunodeficiency Virus Type 1 of a Different Subtype. J. Virol.
79: 10701-10708
[Abstract][Full Text]
Strain, M. C., Letendre, S., Pillai, S. K., Russell, T., Ignacio, C. C., Gunthard, H. F., Good, B., Smith, D. M., Wolinsky, S. M., Furtado, M., Marquie-Beck, J., Durelle, J., Grant, I., Richman, D. D., Marcotte, T., McCutchan, J. A., Ellis, R. J., Wong, J. K.
(2005). Genetic Composition of Human Immunodeficiency Virus Type 1 in Cerebrospinal Fluid and Blood without Treatment and during Failing Antiretroviral Therapy. J. Virol.
79: 1772-1788
[Abstract][Full Text]
van Kesteren, N. M. C., Hospers, H. J., Kok, G., van Empelen, P.
(2005). Sexuality and Sexual Risk Behavior in HIV-Positive Men Who Have Sex With Men. Qual Health Res
15: 145-168
[Abstract]
Yang, O. O., Daar, E. S., Jamieson, B. D., Balamurugan, A., Smith, D. M., Pitt, J. A., Petropoulos, C. J., Richman, D. D., Little, S. J., Brown, A. J. L.
(2005). Human Immunodeficiency Virus Type 1 Clade B Superinfection: Evidence for Differential Immune Containment of Distinct Clade B Strains. J. Virol.
79: 860-868
[Abstract][Full Text]
Martinez-Picado, J., Morales-Lopetegi, K., Villena, C., Gutierrez, C., Izquierdo, N., Marfil, S., Clotet, B., Ruiz, L.
(2005). Evidence for Preferential Genotyping of a Minority Human Immunodeficiency Virus Population Due to Primer-Template Mismatching during PCR-Based Amplification. J. Clin. Microbiol.
43: 436-438
[Abstract][Full Text]
Haaft, P. t., Verschoor, E. J., Verstrepen, B., Niphuis, H., Dubbes, R., Koornstra, W., Bogers, W., Rosenwirth, B., Heeney, J. L.
(2004). Readily acquired secondary infections of human and simian immunodeficiency viruses following single intravenous exposure in non-human primates. J. Gen. Virol.
85: 3735-3745
[Abstract][Full Text]
Furutsuki, T., Hosoya, N., Kawana-Tachikawa, A., Tomizawa, M., Odawara, T., Goto, M., Kitamura, Y., Nakamura, T., Kelleher, A. D., Cooper, D. A., Iwamoto, A.
(2004). Frequent Transmission of Cytotoxic-T-Lymphocyte Escape Mutants of Human Immunodeficiency Virus Type 1 in the Highly HLA-A24-Positive Japanese Population. J. Virol.
78: 8437-8445
[Abstract][Full Text]
Reggeti, F., Bienzle, D.
(2004). Feline immunodeficiency virus subtypes A, B and C and intersubtype recombinants in Ontario, Canada. J. Gen. Virol.
85: 1843-1852
[Abstract][Full Text]
Wherry, E. J., Ahmed, R.
(2004). Memory CD8 T-Cell Differentiation during Viral Infection. J. Virol.
78: 5535-5545
[Full Text]
Tsui, R., Herring, B. L., Barbour, J. D., Grant, R. M., Bacchetti, P., Kral, A., Edlin, B. R., Delwart, E. L.
(2004). Human Immunodeficiency Virus Type 1 Superinfection Was Not Detected following 215 Years of Injection Drug User Exposure. J. Virol.
78: 94-103
[Abstract][Full Text]
Pistello, M., Matteucci, D., Bonci, F., Isola, P., Mazzetti, P., Zaccaro, L., Merico, A., Del Mauro, D., Flynn, N., Bendinelli, M.
(2003). AIDS Vaccination Studies Using an Ex Vivo Feline Immunodeficiency Virus Model: Protection from an Intraclade Challenge Administered Systemically or Mucosally by an Attenuated Vaccine. J. Virol.
77: 10740-10750
[Abstract][Full Text]
Roland, M. E., Lo, B., Braff, J., Stock, P. G.
(2003). Key Clinical, Ethical, and Policy Issues in the Evaluation of the Safety and Effectiveness of Solid Organ Transplantation in HIV-Infected Patients. Arch Intern Med
163: 1773-1778
[Full Text]
Youle, M., Wainberg, M. A.
(2003). Pre-Exposure Chemoprophylaxis (PREP) as an HIV Prevention Strategy. J Int Assoc Physicians AIDS Care (Chic Ill)
2: 102-105
[Abstract]
(2003). Therapeutic Vaccination: Where Are We Now?. AIDS Clin Care
2003: 1-1
[Full Text]
(2002). HIV Superinfection. AIDS Clin Care
2002: 9-9
[Full Text]
(2002). A Case Worth Noting: HIV Superinfection. JWatch Infect. Diseases
2002: 1-1
[Full Text]
Gottlieb, S.
(2002). Patient is reinfected with a different HIV strain. BMJ
325: 564-564
[Full Text]
Goulder, P. J.R., Walker, B. D.
(2002). HIV-1 Superinfection -- A Word of Caution. NEJM
347: 756-758
[Full Text]