Background Epidemiologic studies suggest that genetic factorsconfer a predisposition to the formation of renal calcium stonesor bone demineralization. Low serum phosphate concentrationsdue to a decrease in renal phosphate reabsorption have beenreported in some patients with these conditions, suggestingthat genetic factors leading to a decrease in renal phosphatereabsorption may contribute to them. We hypothesized that mutationsin the gene coding for the main renal sodiumphosphatecotransporter (NPT2a) may be present in patients with thesedisorders.
Methods We studied 20 patients with urolithiasis or bone demineralizationand persistent idiopathic hypophosphatemia associated with adecrease in maximal renal phosphate reabsorption. The codingregion of the gene for NPT2a was sequenced in all patients.The functional consequences of the mutations identified wereanalyzed by expressing the mutated RNA in Xenopus laevis oocytes.
Results Two patients, one with recurrent urolithiasis and onewith bone demineralization, were heterozygous for two distinctmutations. One mutation resulted in the substitution of phenylalaninefor alanine at position 48, and the other in a substitutionof methionine for valine at position 147. Phosphate-inducedcurrent and sodium-dependent phosphate uptake were impairedin oocytes expressing the mutant NPT2a. Coinjection of oocyteswith wild-type and mutant RNA indicated that the mutant proteinhad altered function.
Conclusions Heterozygous mutations in the NPT2a gene may beresponsible for hypophosphatemia and urinary phosphate lossin persons with urolithiasis or bone demineralization.
Epidemiologic studies have shown that both the formation ofrenal calcium stones1,2,3,4,5,6 and bone demineralization7,8,9,10,11exhibit familial aggregation findings that are compatiblewith the presence of genetic factors in these disorders. However,the search for gene variants that confer a predisposition tothese common disorders has generally had negative results. Bothdisorders are likely to be genetically heterogeneous, in whichcase a variety of biologic abnormalities may contribute to theclinical phenotype in individual patients. For example, lowserum phosphate concentrations due to a decrease in renal phosphatereabsorption have been reported in some patients with urolithiasis12,13,14,15,16,17or bone demineralization,14,15,18 suggesting that genetic factorsleading to a decrease in renal phosphate reabsorption can contributeto these diseases.
Since an evaluation of candidate genes can be useful in identifyingloci involved in a subgroup of patients, we have been usingthis approach to identify genetic abnormalities in patientswho have urolithiasis or bone demineralization associated withhypophosphatemia and low renal phosphate reabsorption. The genecoding for the type 2a sodiumphosphate cotransporter(NPT2a), which resides in the apical membrane of renal proximaltubular cells, is a likely candidate for these diseases.19,20Indeed, the kidney is principally responsible for phosphatehomeostasis, and it regulates serum phosphate by modulatingurinary phosphate excretion.19 Phosphate is filtered by theglomerulus and subsequently reabsorbed in the proximal tubule,in which the rate-limiting step is the uptake of phosphate throughNPT2a.19,20
Methods
Patients
We evaluated 20 unrelated patients at Hôpital Bichat inParis, using a protocol described previously.17,21 In accordancewith the national guidelines for research on human subjects,written, informed consent was obtained from all patients. Specimenswere obtained from the patients on two or more days. All thepatients had persistent hypophosphatemia; low maximal renalphosphate reabsorption, normalized according to the glomerularfiltration rate; normal ionized serum calcium concentrations;and normal plasma parathyroid hormone concentrations. Maximalrenal phosphate reabsorption, normalized according to the glomerularfiltration rate, was determined with the use of the nomogramdescribed by Walton and Bijvoët.22
Detection of Mutations
We used intronic primers to amplify the 13 exons of the NPT2agene. The 190-bp region upstream of exon 1 was also sequenced.Exons 3 and 5 were amplified with the use of the following primers:exon 3, 5'CCGCCTGTTCCTCCCCGCCTC (upper primer), 5'CCATGAGCATAGTGGGCAGAG(lower primer); exon 5, 5'AGGAGACCTGGGAGGGGTTCC (upper primer),5'AAGCTCTTCCCCACCCTGG (lower primer). Amplification was performedfor 35 cycles at an annealing temperature of 60°C. The sequenceof other primers is available as Supplementary Appendix 1 withthe full text of this article at http://www.nejm.org. The PCRproducts were sequenced with the use of the BigDye TerminatorCycle Sequencing Ready Reaction kit (PerkinElmer) onan ABI PRISM 3100 sequencer (Applied Biosystems). We analyzedboth strands of DNA using Sequencing Analysis (Applied Biosystems)and Clustal W (Infobiogen) software programs.
Expression of NPT2a in Xenopus laevis Oocytes
Wild-type complementary DNA (cDNA) encoding human NPT2a (kindlyprovided by Drs. J. Biber and H. Mürer, Physiology Institute,University of Zurich, Zurich) was introduced into the RNA expressionvector pSP64T23,24 between the XhoI and NotI sites. Mutant cDNAwas obtained from the wild-type construct with the use of theQuick Change Site-Directed Mutagenesis kit (Stratagene) accordingto the manufacturer's instructions. All constructs were verifiedby sequencing. RNA was synthesized with the use of the Riboprobein Vitro Transcription System kit (Promega) with SP6 RNA polymerase.Three independent RNA preparations were obtained for each construct,each from a different plasmid preparation. Purified RNA wasquantified by absorption at 260 nm, and the quality was verifiedby calculating the ratio of readings at 260 and 280 nm (A260/A280).The homogeneity and quantification of all preparations usedfor oocyte injection were controlled by agarose-gel electrophoresis.
Defolliculated oocytes (stage V or VI) from X. laevis were obtainedwith the use of standard procedures and injected 24 hours laterwith the indicated amount of wild-type or mutant RNA in 50 nlof water or with water alone. Oocytes were incubated at 18°Cin modified Barth's solution (5 mM HEPESsodium hydroxide[pH 7.5] containing 85 mM sodium chloride, 1 mM potassium chloride,1 mM calcium chloride, 1 mM magnesium chloride, and penicillinstreptomycin).Phosphate uptake was measured and voltage-clamp analysis performedthree days after the injection.
Oocytes were washed at room temperature in a sodium-free solution(sodium-free uptake solution without phosphorus-32) and incubatedeither with the sodium-containing uptake solution (10 mM HEPESTRIS[pH 7.5] containing 96 mM sodium chloride, 2 mM potassium chloride,1.8 mM calcium chloride, 1 mM magnesium chloride, 0.1 mM potassiumphosphate, and 10 µCi of [32P]orthophosphate per milliliter)or with the sodium-free uptake solution (with 100 mM cholinechloride substituted for sodium chloride). After 30 minutes,the oocytes were washed five times with sodium-free solutionand dissolved in 0.5 percent sodium dodecyl sulfate, and radioactivitywas determined. Ten to 14 oocytes were studied in each experimentalcondition. Three independent experiments with the use of differentpreparations of RNA were performed.
Voltage-Clamp Experiments
Phosphate-induced currents were measured in two-electrode voltage-clampexperiments with the use of a current-voltage amplifier (Axoclamp-2A).Three days after the RNA injection, a 50 mV holding potentialwas imposed, during which current was recorded on a multi chart-recorder(Arc-en-Ciel). Oocytes were perfused with a sodium-containingsolution (5 mM HEPESsodium hydroxide [pH 7.5] containing85 mM sodium chloride, 1 mM potassium chloride, 1 mM calciumchloride, and 1 mM magnesium chloride) before various concentrationsof phosphate were added, as indicated.
Statistical Analysis
The results are presented as means ±SD. Statistical analyseswere performed with the use of two-way analysis of varianceand a protected-least-significant-difference Fisher's test,when allowed by F values, or repeated-measures analysis of variance.
Results
The 20 patients were 13 men and 7 women (mean age, 47±11years) who had urolithiasis (14 patients, 10 of whom were men)or bone demineralization (6 patients, 3 of whom were men) associatedwith idiopathic hypophosphatemia (phosphate concentration, <2.48mg per deciliter [0.80 mmol per liter]) and reduced maximalrenal phosphate reabsorption, normalized according to the glomerularfiltration rate (<0.70 mmol per liter). The glomerular filtrationrate, determined by inulin clearance, was normal in all 20 patients(mean value, 90±14 ml per minute per 1.73 m2 of body-surfacearea). None of the patients had had rickets during childhood,and none had abnormal height as adults.
To determine whether NPT2a has a role in renal phosphate leak,we sequenced the 13 exons of the NPT2a gene and 190 nucleotideswithin the promoter region. Two distinct mutations were identifiedin two patients (Figure 1) in the heterozygous state.
Figure 1. Sequence Analysis of DNA from Two Patients with Hypophosphatemia and Mutations in NPT2a.
Panel A shows a portion of the sequence of exon 3 from a control subject and from Patient 1. The arrows indicate the heterozygous GT mutation at position 223 and CT mutation at position 224. The two mutations are present in the same allele, as shown in a fragment of exon 3 that was cloned after amplification by a polymerase-chain-reaction assay, resulting in the A48F substitution. Panel B shows a portion of the sequence of exon 5 from a control subject and from Patient 2. The arrow indicates the heterozygous GA mutation at position 520, which caused the V147M substitution. The same mutation was identified in the patient's daughter.
Patient 1, a 34-year-old man, had recurrent urolithiasis, aphosphate concentration of 1.58 mg per deciliter (0.51 mmolper liter), and maximal renal phosphate reabsorption, normalizedaccording to the glomerular filtration rate, of 0.47 mmol perliter. He was heterozygous for two nucleotide substitutions:GT at position 223 and CT at position 224 (Figure 1A). The sequencingof cloned PCR products established that these substitutionscorresponded to a two-base change on the same allele locatedin exon 3 and resulted in a substitution of phenylalanine foralanine at position 48 (A48F).
Patient 2 was a 64-year-old woman with idiopathic bone demineralization(bone mineral density at the lumbar spine, 0.639 g per squarecentimeter; at the femoral neck, 0.679 g per square centimeter);the phosphate concentration was 2.17 mg per deciliter (0.70mmol per liter), and maximal renal phosphate reabsorption, normalizedaccording to the glomerular filtration rate, was 0.58 mmol perliter. She had a single GA transition at position 520 in exon5 that resulted in a substitution of methionine for valine atposition 147 (V147M) (Figure 1B). Her sole daughter had a spinaldeformity and a history of arm fractures, with a low phosphateconcentration (2.35 mg per deciliter [0.76 mmol per liter])and low maximal renal phosphate reabsorption, normalized accordingto the glomerular filtration rate (0.67 mmol per liter). Herdaughter had the same mutation. To exclude the possibility thatthe base changes identified in these patients represented commonpolymorphisms, exons 3 and 5 were amplified and sequenced fromthe genomic DNA of 120 subjects with normal maximal renal phosphatereabsorption, normalized according to the glomerular filtrationrate. No nucleotide variants were detected in these subjects,with the exception of two previously described single-nucleotidepolymorphisms.25,26
The NPT2a protein is thought to have an intracytoplasmic NH2tail and eight transmembrane segments.20 The A48 residue islocated in the NH2 terminal portion of the NPT2a protein,20and the V147 residue is located in the second transmembranesegment.20 Amino acids A48 and V147 are conserved in humans,rats, rabbits, mice, opossums, and flounder (Figure 2). Theconservation of A48 and V147 residues across species and theabsence of variants in control subjects support the hypothesisthat the identified mutations may cause the defect in renalphosphate reabsorption observed in these patients.
Figure 2. Evolutionary Conservation of the A48 and V147 Residues.
Partial amino acid sequences encoded by exon 3 (Panel A) and exon 5 (Panel B) are shown. The residues that were mutated in Patients 1 and 2 are boxed. Bold letters indicate residues conserved in at least five species.
We tested this hypothesis further by comparing the functionof wild-type and mutant NPT2a expressed in X. laevis oocytes.Injection of RNA into oocytes, as compared with cDNA transfectionwith the use of an expression vector, allows the expressionof known amounts of RNA and the assessment of protein functionwith two independent and complementary methods: measurementof phosphate-induced currents by electrophysiological studiesand quantification of phosphate uptake. NPT2a transports threesodium ions for one divalent phosphate ion.27 Hence, the uptakeof phosphate results in a net movement of positive charges intothe oocytes that can be recorded as an inward current in oocytesinjected with NPT2a RNA.27 Accordingly, we injected oocyteswith increasing concentrations of wild-type or mutant NPT2aRNA (Figure 3A). The inward current was related to the amountof injected NPT2a RNA until it reached a plateau of 30 ng ofwild-type or mutant RNA per oocyte. In the presence of a concentrationof 1 mM phosphate, at all concentrations of RNA tested, thecurrent induced by the mutant NPT2a was lower than that inducedby the wild-type NPT2a (Figure 3A). In oocytes injected with30 ng of mutant RNA, the current was 47 percent lower (in thecase of V147M) and 65 percent lower (in the case of A48F) thanthe current in oocytes injected with 30 ng of wild-type RNA.
Figure 3. Phosphate-Induced Current and Phosphate Uptake in Xenopus laevis Oocytes Injected with Wild-Type or Mutant NPT2a RNA.
Panel A shows the relation between injected RNA and phosphate uptake. Phosphate-induced current was recorded in voltage-clamped X. laevis oocytes (holding potential, 50 mV) injected with various amounts of wild-type or mutant NPT2a RNA in the presence of 1 mM extracellular phosphate. The phosphate-induced current increased with increasing doses of RNA and reached a plateau at 30 ng of RNA per oocyte. In oocytes expressing a mutant transporter, the amplitude of the current was decreased at all doses of RNA (P<0.001 by analysis of variance). Results are means ±SD for 5 to 12 oocytes per dose of RNA.
Panel B shows the effect of the extracellular phosphate concentration on the amplitude of phosphate-induced current. The maximal phosphate-induced current was recorded in oocytes injected with 10 ng of RNA coding for NPT2a with the wild-type, V147M, or A48F sequence. Voltage-clamped oocytes (holding potential, 50 mV) were exposed to increasing phosphate concentrations while the induced change in current was continuously recorded. Data are presented as the mean (±SD) result of three independent experiments, each involving 10 to 14 oocytes. The mutant transporters were associated with a significant reduction in the amplitude of the current at all phosphate concentrations (P<0.001 by analysis of variance for repeated measures).
Panel C shows phosphate uptake in oocytes. Phosphorus-32 uptake was measured in the presence or the absence of sodium in oocytes injected with 10 ng of RNA coding for the wild-type, A48F, or V147F sequence or injected with water alone. Sodium-dependent phosphate uptake was significantly lower in oocytes injected with A48F or V147M RNA than in oocytes injected with wild-type RNA and was also significantly lower in oocytes injected with A48F RNA than in those injected with V147M RNA (P<0.001 for all three comparisons). In the absence of sodium, phosphate uptake did not differ significantly between oocytes injected with water and those injected with wild-type or mutant RNA. Data are presented as the mean (±SD) result of three independent experiments, each performed in 10 to 14 oocytes.
We also tested the effect of increasing extracellular phosphateconcentrations on phosphate-induced current in oocytes injectedwith 10 ng of wild-type or mutant NPT2a RNA (Figure 3B). Theinward current increased with increasing concentrations of extracellularphosphate, reaching a plateau at 1 mM phosphate only in oocytesexpressing wild-type NPT2a; the phosphate concentration at whichthe current was half the maximal value was 0.55 mM (Figure 3B).In oocytes expressing the mutant NPT2a, the phosphate-inducedcurrent was lower at all phosphate concentrations tested thanthat in oocytes expressing the wild-type transporter (Figure 3B).No plateau in phosphate-induced current was observed inoocytes expressing the mutant NPT2a over the range of phosphateconcentrations tested, suggesting that the mutant transportershave a decreased affinity for phosphate.
The measurement of phosphate uptake in oocytes injected with10 ng of wild-type or mutant RNA confirmed the impaired functionof mutant NPT2a (Figure 3C). As expected, sodium-dependent phosphateuptake was lower in oocytes injected with vehicle (water) alonethan in those injected with wild-type NPT2a (Figure 3C), andin the absence of sodium, phosphate uptake was low and was similarin oocytes whether they were injected with wild-type or mutantRNA or water (Figure 3C). These results indicate that the phosphateuptake observed was due to the expression of NPT2a. Phosphateuptake was significantly lower in oocytes injected with theRNA coding for the V147M or A48F mutation than in oocytes injectedwith the wild-type RNA (P<0.001).
In all experiments, both phosphate-induced current and sodium-dependentphosphate uptake were lower in oocytes expressing NPT2a withthe A48F mutation than in those expressing the transporter withthe V147M mutation (Figure 3). Since both patients were heterozygousfor the mutations but had low maximal renal phosphate reabsorption,normalized according to the glomerular filtration rate, we assessedwhether the mutant proteins could interfere with the wild-typeproduct and diminish wild-type protein function by a dominantnegative effect. In oocytes coinjected with 10 ng of wild-typeRNA and 10 ng of mutant RNA, the phosphate-induced current waseither similar to that in oocytes expressing 10 ng of wild-typeNPT2a RNA alone (in the case of the V147M mutation) or significantlylower (in the case of the A48F mutation) and was reduced by50 percent (in the case of the V147M mutation) and 65 percent(in the case of the A48F mutation) as compared with the currentin oocytes injected with 20 ng of wild-type RNA alone (Figure 4).These results indicate that the mutant proteins alteredthe function of the wild-type NPT2a through a dominant negativeeffect.
Figure 4. Effect of the Coexpression of Wild-Type and Mutant NPT2a RNA on Phosphate-Induced Current.
As compared with the injection of oocytes with 10 ng of wild-type RNA alone, injection with 10 ng of mutant RNA together with 10 ng of wild-type RNA resulted in a slight decrease in phosphate-induced current (in the case of the V147M mutation) or a significant decrease (in the case of the A48F mutation, P<0.001). For both mutations, the phosphate-induced current was significantly lower than that associated with injection of 20 ng of wild-type RNA alone (P<0.001 for both comparisons). Data are presented as the mean (±SD) result of two independent experiments, each involving 10 oocytes.
To determine whether biologic data could help identify patientswith mutations in the NPT2a gene, we compared the findings inthe 2 patients who had mutations in the gene with those in the18 patients who did not have mutations (Figure 5). None of thevariables evaluated clearly distinguished patients with NPT2amutations from those without mutations. The abnormalities observedfor the patient with the A48F mutation were generally more pronouncedthan those observed for the patient with the V147M mutation.
Figure 5. Laboratory Values in the 20 Patients with Hypophosphatemia and Reduced Maximal Renal Phosphate Reabsorption, According to Whether Mutations in NPT2a Were Identified.
Open circles represent patients with wild-type NPT2a, solid circles the patient with the A48F mutation, and shaded circles the patient with the V147M mutation. In some cases, two or more patients had the same value. The shaded area in each panel shows the range of normal values. Data are mean values for measurements in at least three different samples. To convert the values for serum phosphorus to milligrams per deciliter, divide by 0.3229.
Discussion
Our findings suggest that NPT2a mutations identified in twopatients caused an impairment in renal phosphate reabsorption,resulting in hypophosphatemia. A low serum phosphate concentration,in turn, would be expected to increase 1,25-dihydroxyvitaminD production,28,29 leading to hypercalciuria,16 as observed.This phenotype resembles that of heterozygous Npt2a-deficientmice (Npt2a+/), which have increased urinary phosphateand calcium excretion, elevated plasma concentrations of 1,25-dihydroxyvitaminD,30 and urolithiasis.31 The functional defect of NPT2a is moresevere with the A48F mutation than with the V147M mutation;this observation is consistent with the phenotype in our twopatients, since the serum phosphorus concentration and the maximalcapacity of the kidney to reabsorb phosphate were lower in thepatient with the A48F mutation.
The findings in the daughter of the patient with the V147M mutationand the correlation between functional and biologic data supportthe hypothesis that the NPT2a mutations were responsible forthe hypophosphatemia and loss of renal phosphate. The patientswere heterozygous for the mutations, suggesting a dominant effectof the mutant allele. This is consistent with the observationof a dominant negative effect of the mutant proteins on thefunction of the wild-type transporter, leading to substantialrenal phosphate losses in heterozygous patients. The underlyingmechanism may involve either a competition between wild-typeand mutant transporters for the interaction with a rate-limitingintracellular protein or a direct interaction between wild-typeand mutant transporters, although there are conflicting datawith regard to the existence of dimers of NPT2a.32,33
The reason why renal phosphate loss may lead to either the formationof calcium stones or bone demineralization is unknown, but itmight be due to sex, environmental factors, or other geneticdifferences. Only 2 of our 20 patients with idiopathic renalphosphate loss had mutations in the NPT2a gene. Although itis possible that we did not detect all NPT2a mutations in ourpatients (e.g., mutations in introns or regulatory regions),other genes may be involved in the renal phosphate loss in thesepatients. In patients who have hereditary hypophosphatemic ricketswith hypercalciuria, an autosomal recessive disorder, no mutationin the coding region of the NPT2a gene has been found.25,26Similarly, mutations in the NPT2a gene have been ruled out intwo additional forms of familial hypophosphatemia: X-linkedhypophosphatemic rickets34 and autosomal dominant hereditaryrickets.35 These disorders are associated with mutations inthe phosphate-regulating gene with homologies to endopeptidaseson the X chromosome (PHEX) and the gene encoding fibroblastgrowth factor 23 (FGF-23), respectively.34,35
Our study provides genetic evidence that heterozygous NPT2amutations are involved in hypophosphatemia resulting from idiopathicrenal phosphate loss and indicates that NPT2a plays a majorpart in phosphate homeostasis. The identification of functionalvariants of the NPT2a gene in patients with hypophosphatemiaassociated with urolithiasis or bone demineralization also providesgenetic evidence that a defect in renal phosphate reabsorptionmay contribute to the pathogenesis of these two common disorders.
Supported by grants (CRC 940247 and CRIC 99228) from the DélégationRégionale à la Recherche Clinique, AssistancePubliqueHôpitaux de Paris.
We are indebted to Dr. Allan Hance for help during the preparationof the manuscript, to Dominique Henry for assistance with thesequencing, to Dr. Laurent Gouya for assistance with the directedmutagenesis, and to Dr. Boccon Gibod for referrals of patientswith urolithiasis to the Service de PhysiologieExplorationsFonctionnelles.
Source Information
From the Service de PhysiologieExplorations Fonctionnelles (D.P., V.H., F.B.-B., G.F.) and the Service de Biochimie B (B. Gérard, B. Grandchamp), Hôpital Bichat, Assistance PubliqueHôpitaux de Paris; INSERM Unité 426 and Institut Fédératif de Recherche 02 (D.P., V.H., O.D., C.S., G.F.) and INSERM Unité 409 (B. Grandchamp), Faculté de Médecine Xavier Bichat; and INSERM Unité 467, Faculté de Médecine, Necker (N.B., G.P., P.H.) all in Paris.
Address reprint requests to Dr. Prié at INSERM Unité 426, Faculté de Médecine Xavier Bichat, 16 rue Henri Huchard, 75018 Paris, France, or at dprie{at}bichat.inserm.fr.
References
Resnick M, Pridgen DB, Goodman HO. Genetic predisposition to formation of calcium oxalate renal calculi. N Engl J Med 1968;278:1313-1318. [Medline]
Pridgen DB, Resnick M, Goodman HO, Boyce WH. Inheritance of calcium renal stones. Lancet 1968;1:537-538. [Medline]
Ljunghall S, Danielson BG, Fellstrom B, Holmgren K, Johansson G, Wikstrom B. Family history of renal stones in recurrent stone patients. Br J Urol 1985;57:370-374. [Medline]
Coe FL, Parks JH, Moore ES. Familial idiopathic hypercalciuria. N Engl J Med 1979;300:337-340. [Abstract]
Robertson WG, Peacock M, Baker M, et al. Studies on the prevalence and epidemiology of urinary stone disease in men in Leeds. Br J Urol 1983;55:595-598. [ISI][Medline]
Polito C, La Manna A, Nappi B, Villani J, Di Toro R. Idiopathic hypercalciuria and hyperuricosuria: family prevalence of nephrolithiasis. Pediatr Nephrol 2000;14:1102-1104. [CrossRef][Medline]
Lutz J, Tesar R. Mother-daughter pairs: spinal and femoral bone densities and dietary intakes. Am J Clin Nutr 1990;52:872-877. [Free Full Text]
Hansen MA, Hassager C, Jensen SB, Christiansen C. Is heritability a risk factor for postmenopausal osteoporosis? J Bone Miner Res 1992;7:1037-1043. [ISI][Medline]
Arden NK, Baker J, Hogg C, Baan K, Spector TD. The heritability of bone mineral density, ultrasound of the calcaneus and hip axis length: a study of postmenopausal twins. J Bone Miner Res 1996;11:530-534. [ISI][Medline]
Ferrari S, Rizzoli R, Slosman D, Bonjour JP. Familial resemblance for bone mineral mass is expressed before puberty. J Clin Endocrinol Metab 1998;83:358-361. [Free Full Text]
Danielson ME, Cauley JA, Baker CE, et al. Familial resemblance of bone mineral density (BMD) and calcaneal ultrasound attenuation: the BMD in mothers and daughters study. J Bone Miner Res 1999;14:102-110. [CrossRef][Medline]
Shen FH, Ivey JL, Sherrard DJ, Nielsen RL, Haussler MR, Baylink DJ. Further evidence supporting the phosphate leak hypothesis of idiopathic hypercalciuria. Adv Exp Med Biol 1978;103:217-223. [Medline]
Pabico RC, McKenna BA, Freeman RB. Renal threshold phosphate concentration in patients with idiopathic nephrolithiasis: correlations with tubular functions, serum parathyroid hormone and 1,25(OH)2D3. Proc Eur Dial Transplant Assoc 1983;20:450-454. [Medline]
Tieder M, Modai D, Samuel R, et al. Hereditary hypophosphatemic rickets with hypercalciuria. N Engl J Med 1985;312:611-617. [Abstract]
Tieder M, Modai D, Shaked U, et al. "Idiopathic" hypercalciuria and hereditary hypophosphatemic rickets: two phenotypical expressions of a common genetic defect. N Engl J Med 1987;316:125-129. [Abstract]
Williams CP, Child DF, Hudson PR, et al. Inappropriate phosphate excretion in idiopathic hypercalciuria: the key to a common cause and future treatment? J Clin Pathol 1996;49:881-888. [Free Full Text]
Prie D, Ravery V, Boccon-Gibod L, Friedlander G. Frequency of renal phosphate leak among patients with calcium nephrolithiasis. Kidney Int 2001;60:272-276. [CrossRef][ISI][Medline]
de Vernejoul MC, Marie P, Kuntz D, Gueris J, Miravet L, Ryckewaert A. Nonosteomalacic osteopathy associated with chronic hypophosphatemia. Calcif Tissue Int 1982;34:219-223. [Medline]
Suki WN, Lederer ED, Rouse D. Renal transport of calcium, magnesium, and phosphate. In: Brenner BM, ed. Brenner & Rector's the kidney. 6th ed. Vol. 1. Philadelphia: W.B. Saunders, 2000:520-74.
Murer H, Hernando N, Forster I, Biber J. Proximal tubular phosphate reabsorption: molecular mechanisms. Physiol Rev 2000;80:1373-1409. [Free Full Text]
Prie D, Blanchet FB, Essig M, Jourdain JP, Friedlander G. Dipyridamole decreases renal phosphate leak and augments serum phosphorus in patients with low renal phosphate threshold. J Am Soc Nephrol 1998;9:1264-1269. [Abstract]
Walton RJ, Bijvoët OL. Nomogram for derivation of renal threshold phosphate concentration. Lancet 1975;2:309-310. [ISI][Medline]
Krieg PA, Melton DA. Functional messenger RNAs are produced by SP6 in vitro transcription of cloned cDNAs. Nucleic Acids Res 1984;12:7057-7070. [Free Full Text]
Melton DA, Krieg PA, Rebagliati MR, Maniatis T, Zinn K, Green MR. Efficient in vitro synthesis of biologically active RNA and RNA hybridization probes from plasmids containing a bacteriophage SP6 promoter. Nucleic Acids Res 1984;12:7035-7056. [Free Full Text]
Jones A, Tzenova J, Frappier D, et al. Hereditary hypophosphatemic rickets with hypercalciuria is not caused by mutations in the Na/Pi cotransporter NPT2 gene. J Am Soc Nephrol 2001;12:507-514. [Free Full Text]
van den Heuvel L, Op de Koul K, Knots E, Knoers N, Monnens L. Autosomal recessive hypophosphataemic rickets with hypercalciuria is not caused by mutations in the type II renal sodium/phosphate cotransporter gene. Nephrol Dial Transplant 2001;16:48-51. [Free Full Text]
Busch A, Waldegger S, Herzer T, et al. Electrophysiological analysis of Na+/Pi cotransport mediated by a transporter cloned from rat kidney and expressed in Xenopus oocytes. Proc Natl Acad Sci U S A 1994;91:8205-8208. [Free Full Text]
Gray RW, Wilz DR, Caldas AE, Lemann J Jr. The importance of phosphate in regulating plasma 1,25-(OH)2-vitamin D levels in humans: studies in healthy subjects, in calcium-stone formers and in patients with primary hyperparathyroidism. J Clin Endocrinol Metab 1977;45:299-306. [Abstract]
Portale AA, Halloran BP, Morris RC Jr. Physiologic regulation of the serum concentration of 1,25-dihydroxyvitamin D by phosphorus in normal men. J Clin Invest 1989;83:1494-1499. [ISI][Medline]
Beck L, Karaplis AC, Amizuka N, Hewson AS, Ozawa H, Tenenhouse HS. Targeted inactivation of Npt2 in mice leads to severe renal phosphate wasting, hypercalciuria, and skeletal abnormalities. Proc Natl Acad Sci U S A 1998;95:5372-5377. [Free Full Text]
Chau H, Tenenhouse HS. Renal phosphate wasting and hypercalciuria in Npt2 knockout mice are associated with nephrocalcinosis. J Am Soc Nephrol 2001;12:751A-751A. abstract.
Xiao Y, Boyer CJ, Vincent E, et al. Involvement of disulphide bonds in the renal sodium/phosphate co-transporter NaPi-2. Biochem J 1997;323:401-408.
Lambert G, Forster IC, Biber J, Murer H. Cysteine residues and the structure of the rat renal proximal tubular type II sodium phosphate cotransporter (rat NaPi IIa). J Membr Biol 2000;176:133-141. [CrossRef][Medline]
A gene (PEX) with homologies to endopeptidases is mutated in patients with X-linked hypophosphataemic rickets. Nat Genet 1995;11:130-136. [CrossRef][ISI][Medline]
Autosomal dominant hypophosphataemic rickets is associated with mutations in FGF23. Nat Genet 2000;26:345-348. [CrossRef][ISI][Medline]
Karim, Z., Gerard, B., Bakouh, N., Alili, R., Leroy, C., Beck, L., Silve, C., Planelles, G., Urena-Torres, P., Grandchamp, B., Friedlander, G., Prie, D.
(2008). NHERF1 Mutations and Responsiveness of Renal Parathyroid Hormone. NEJM
359: 1128-1135
[Abstract][Full Text]
Levi, M., Bruesegem, S.
(2008). Renal Phosphate-Transporter Regulatory Proteins and Nephrolithiasis. NEJM
359: 1171-1173
[Full Text]
Iwaki, T., Sandoval-Cooper, M. J., Tenenhouse, H. S., Castellino, F. J.
(2008). A Missense Mutation in the Sodium Phosphate Co-transporter Slc34a1 Impairs Phosphate Homeostasis. J. Am. Soc. Nephrol.
19: 1753-1762
[Abstract][Full Text]
Wagner, C. A., Biber, J., Murer, H.
(2008). Of Men and Mice: Who Is in Control of Renal Phosphate Reabsorption?. J. Am. Soc. Nephrol.
19: 1625-1626
[Full Text]
Khundmiri, S. J., Ahmad, A., Bennett, R. E., Weinman, E. J., Steplock, D., Cole, J., Baumann, P. D., Lewis, J., Singh, S., Clark, B. J., Lederer, E. D.
(2008). Novel regulatory function for NHERF-1 in Npt2a transcription. Am. J. Physiol. Renal Physiol.
294: F840-F849
[Abstract][Full Text]
Virkki, L. V., Biber, J., Murer, H., Forster, I. C.
(2007). Phosphate transporters: a tale of two solute carrier families. Am. J. Physiol. Renal Physiol.
293: F643-F654
[Abstract][Full Text]
Sperandeo, M. P., Annunziata, P., Bozzato, A., Piccolo, P., Maiuri, L., D'Armiento, M., Ballabio, A., Corso, G., Andria, G., Borsani, G., Sebastio, G.
(2007). Slc7a7 disruption causes fetal growth retardation by downregulating Igf1 in the mouse model of lysinuric protein intolerance. Am. J. Physiol. Cell Physiol.
293: C191-C198
[Abstract][Full Text]
Ichikawa, S., Sorenson, A. H., Imel, E. A., Friedman, N. E., Gertner, J. M., Econs, M. J.
(2006). Intronic Deletions in the SLC34A3 Gene Cause Hereditary Hypophosphatemic Rickets with Hypercalciuria. J. Clin. Endocrinol. Metab.
91: 4022-4027
[Abstract][Full Text]
Weinman, E. J., Mohanlal, V., Stoycheff, N., Wang, F., Steplock, D., Shenolikar, S., Cunningham, R.
(2006). Longitudinal study of urinary excretion of phosphate, calcium, and uric acid in mutant NHERF-1 null mice. Am. J. Physiol. Renal Physiol.
290: F838-F843
[Abstract][Full Text]
Rendina, D., Mossetti, G., De Filippo, G., Cioffi, M., Strazzullo, P.
(2006). Fibroblast Growth Factor 23 Is Increased in Calcium Nephrolithiasis with Hypophosphatemia and Renal Phosphate Leak. J. Clin. Endocrinol. Metab.
91: 959-963
[Abstract][Full Text]
Silve, C., Petrel, C., Leroy, C., Bruel, H., Mallet, E., Rognan, D., Ruat, M.
(2005). Delineating a Ca2+ Binding Pocket within the Venus Flytrap Module of the Human Calcium-sensing Receptor. J. Biol. Chem.
280: 37917-37923
[Abstract][Full Text]
Jan de Beur, S. M.
(2005). Tumor-Induced Osteomalacia. JAMA
294: 1260-1267
[Abstract][Full Text]
Bevilacqua, M., Dominguez, L. J., Righini, V., Valdes, V., Toscano, R., Sangaletti, O., Vago, T., Baldi, G., Barrella, M., Bianchi-Porro, G.
(2005). Increased Gastrin and Calcitonin Secretion after Oral Calcium or Peptones Administration in Patients with Hypercalciuria: A Clue to an Alteration in Calcium-Sensing Receptor Activity. J. Clin. Endocrinol. Metab.
90: 1489-1494
[Abstract][Full Text]
Moe, O. W., Bonny, O.
(2005). Genetic Hypercalciuria. J. Am. Soc. Nephrol.
16: 729-745
[Abstract][Full Text]
Bai, X., Miao, D., Li, J., Goltzman, D., Karaplis, A. C.
(2004). Transgenic Mice Overexpressing Human Fibroblast Growth Factor 23 (R176Q) Delineate a Putative Role for Parathyroid Hormone in Renal Phosphate Wasting Disorders. Endocrinology
145: 5269-5279
[Abstract][Full Text]
Bakouh, N., Benjelloun, F., Hulin, P., Brouillard, F., Edelman, A., Cherif-Zahar, B., Planelles, G.
(2004). NH3 Is Involved in the NH4 Transport Induced by the Functional Expression of the Human Rh C Glycoprotein. J. Biol. Chem.
279: 15975-15983
[Abstract][Full Text]
Hoopes, R. R. Jr., Reid, R., Sen, S., Szpirer, C., Dixon, P., Pannett, A. A.J., Thakker, R. V., Bushinsky, D. A., Scheinman, S. J.
(2003). Quantitative Trait Loci for Hypercalciuria in a Rat Model of Kidney Stone Disease. J. Am. Soc. Nephrol.
14: 1844-1850
[Abstract][Full Text]
Frick, K. K., Bushinsky, D. A.
(2003). Molecular Mechanisms of Primary Hypercalciuria. J. Am. Soc. Nephrol.
14: 1082-1095
[Full Text]
Bai, X.-Y., Miao, D., Goltzman, D., Karaplis, A. C.
(2003). The Autosomal Dominant Hypophosphatemic Rickets R176Q Mutation in Fibroblast Growth Factor 23 Resists Proteolytic Cleavage and Enhances in Vivo Biological Potency. J. Biol. Chem.
278: 9843-9849
[Abstract][Full Text]
Scheinman, S. J., Tenenhouse, H. S., Prie, D., Friedlander, G., Silve, C.
(2003). Nephrolithiasis, Osteoporosis, and Mutations in the Type 2a Sodium-Phosphate Cotransporter. NEJM
348: 264-265
[Full Text]
Tenenhouse, H. S., Murer, H.
(2003). Disorders of Renal Tubular Phosphate Transport. J. Am. Soc. Nephrol.
14: 240-247
[Full Text]
Kronenberg, H. M.
(2002). NPT2a -- The Key to Phosphate Homeostasis. NEJM
347: 1022-1024
[Full Text]