Endogenous Antimicrobial Peptides and Skin Infections in Atopic Dermatitis
Peck Y. Ong, M.D., Takaaki Ohtake, M.D., Ph.D., Corinne Brandt, B.S., Ian Strickland, Ph.D., Mark Boguniewicz, M.D., Tomas Ganz, M.D., Ph.D., Richard L. Gallo, M.D., Ph.D., and Donald Y.M. Leung, M.D., Ph.D.
Background The innate immune system of human skin contains antimicrobialpeptides known as cathelicidins (LL-37) and -defensins. In normalskin these peptides are negligible, but they accumulate in skinaffected by inflammatory diseases such as psoriasis. We comparedthe levels of expression of LL-37 and human -defensin 2 (HBD-2)in inflamed skin from patients with atopic dermatitis and fromthose with psoriasis.
Methods The expression of LL-37 and HBD-2 protein in skin-biopsyspecimens from patients with psoriasis, patients with atopicdermatitis, and normal subjects was determined by immunohistochemicalanalysis. The amount of antimicrobial peptides in extracts ofskin samples was also analyzed by immunodot blot analysis (forLL-37) and Western blot analysis (for HBD-2). Quantitative,real-time reverse-transcriptasepolymerase-chain-reaction(RT-PCR) assays were used to confirm the relative expressionof HBD-2 and LL-37 messenger RNA (mRNA) in the skin-biopsy specimens.These peptides were also tested for antimicrobial activity againstStaphylococcus aureus with the use of a colony-forming assay.
Results Immunohistochemical analysis confirmed the presenceof abundant LL-37 and HBD-2 in the superficial epidermis ofall patients with psoriasis. In comparison, immunostaining forthese peptides was significantly decreased in acute and chroniclesions from patients with atopic dermatitis (P=0.006 and P=0.03,respectively). These results were confirmed by immunodot blotand Western blot analyses. Real-time RT-PCR showed significantlylower expression of HBD-2 mRNA and LL-37 mRNA in atopic lesionsthan in psoriatic lesions (P=0.009 and P=0.02, respectively).The combination of LL-37 and HBD-2 showed synergistic antimicrobialactivity by effectively killing S. aureus.
Conclusions A deficiency in the expression of antimicrobialpeptides may account for the susceptibility of patients withatopic dermatitis to skin infection with S. aureus.
The skin's first line of defense against invasion by microbialagents is the stratum corneum, a nonviable, desiccated layerof the epidermis.1 However, this physical barrier is susceptibleto injuries that allow the entry of opportunistic microbialagents into the skin. The innate immune system can immediatelyrespond to this intrusion by helping to prevent further invasion.This immune response includes phagocytosis by neutrophils andmacrophages and their production of reactive oxygen intermediatesthat kill microbial agents.2
A number of endogenous antimicrobial peptides have been shownto play an integral part in innate immunity.3 Two major classesof peptides in mammalian skin, -defensins4,5 and cathelicidins,6,7have antimicrobial activity against bacterial, fungal, and viralpathogens.4,7,9 These peptides, which are produced by keratinocytesin the skin,4,7,8 disrupt the membrane of the target microbeor penetrate the microbial membrane, interfering with intracellularfunctions.10 The expression of some of these peptides, suchas human -defensin 1 (HBD-1), is constitutive,8 whereas theexpression of others, including human -defensin 2 (HBD-2) andLL-37, a cathelicidin, is triggered by injury or inflammationof the skin.4,7 Animal models have shown that the expressionor activation of antimicrobial peptides is essential for theability of skin to resist bacterial infection.11,12
Atopic dermatitis, a chronic inflammatory skin disease frequentlyfound in families with asthma and allergic rhinitis,13 is complicatedby recurrent infections of skin lesions by bacterial, viral,and fungal pathogens.14 About 30 percent of patients with atopicdermatitis have bacterial or viral infections of the skin, ascompared with only 7 percent of patients with psoriasis,15 eventhough both diseases are characterized by a defective skin barrier.16We compared the expression of HBD-2 and LL-37 in skin lesionsfrom patients with atopic dermatitis with their expression inpsoriatic lesions and normal skin, using immunohistochemicalstaining, Western and immunodot blotting, and a quantitative,real-time reverse-transcriptasepolymerase-chain-reaction(RT-PCR) assay. We also examined the capacity of tumor necrosisfactor (TNF-) to induce HBD-2 expression in a human keratinocytecell line after treatment with interleukin-4 and interleukin-13,cytokines that are abundant in the skin of patients with atopicdermatitis.13 Finally, we evaluated the combined antimicrobialeffects of LL-37 and HBD-2 on Staphylococcus aureus.
Methods
Patients
The study participants included 8 patients with moderate-to-severeatopic dermatitis (mean age, 33 years; extent of skin involvement,20 to 60 percent), 11 patients with psoriasis (mean age, 38years; extent of skin involvement, 15 to 40 percent), and 6healthy persons (mean age, 38 years). None of the patients hadreceived systemic corticosteroids previously, and none had receivedtopical corticosteroids for at least one week before enrollment.The study was approved by the institutional review board atNational Jewish Medical and Research Center, in Denver; allpatients and normal subjects gave written informed consent.
Punch biopsies were performed, with 2-mm samples obtained fromerythematous lesions that were less than three days old (acuteatopic dermatitis), lichenified lesions that were more thantwo weeks old (chronic atopic dermatitis), psoriatic lesions,and normal skin. The skin samples were immediately frozen at70°C for immunohistochemical studies or Western andimmunodot blot analyses.
Immunohistochemical Staining
For immunostaining of HBD-2, frozen 5-µm skin-tissue sectionswere fixed in acetone for 10 minutes and then incubated with10 percent nonimmune goat serum (Zymed) for 10 minutes. Blockingserum was removed, and the sections were stained with antiHBD-2rabbit polyclonal antibody (Peptide Institute) at a 1:50 dilution(vol/vol) in phosphate-buffered saline for one hour at roomtemperature in a humid atmosphere. The slides were rinsed twicewith phosphate-buffered saline and incubated with a biotinylatedgoat antirabbit secondary antibody (Zymed) at room temperaturefor 30 minutes, rinsed twice with phosphate-buffered saline,and incubated with a mixture of avidin and biotinylated horseradishperoxidase (1:1 vol/vol, Dako) for an additional 30 minutes.The reaction was developed with the use of amino-ethyl-carbazolesingle solution (Zymed) for 10 minutes and then counterstainedwith hematoxylin. Negative controls were established with theuse of nonimmune isotype antibodies and preincubation of theantiHBD-2 antibodies with a synthetic HBD-2 peptide (PeptideInstitute) to ensure the binding specificity of the antiHBD-2antibodies. All slides were coded before the samples were evaluatedso that the identity of the study subjects was not revealed.The intensity of the immunostaining was graded with the useof microscopy on a scale from 0 to 3, with 0 indicating no stainingand 3 the most intense staining.
For immunostaining of LL-37, frozen skin sections were treatedsimilarly at first and then incubated with rabbit antiLL-37antibody, as previously described,17 in phosphate-buffered salineand 0.1 percent bovine serum albumin. The sections were washedin phosphate-buffered saline and stained with goat antirabbithorseradish peroxidase (Vectastain Elite ABC Rabbit kit, VectorLaboratories) and diaminobenzidine substrate (Sigma) accordingto the manufacturer's instructions. The sections were counterstainedwith hematoxylin. The specificity of the primary antibody reactionwas confirmed in separate experiments by adsorption of eitherantiLL-37 antibody with excess amounts of the syntheticpeptide. The specificity of the secondary antibody reactionand of the immunostaining reagents was confirmed by routineuse of rabbit nonimmune serum.
Measurement of HBD-2 and LL-37 Peptides
Skin-biopsy samples were weighed and then homogenized for 10minutes with a loose-fitting Dounce homogenizer in 1 ml of 1M hydrogen chloride and 1 percent trifluoroacetic acid on ice.Homogenized tissues in solution were then rotated overnightat 4°C. After centrifugation for 20 minutes at 14,000 rpmat 4°C, supernatants were transferred to new tubes and lyophilizedcompletely. The resulting protein pellets were dissolved withdistilled water to obtain a final protein concentration of 0.1mg of tissue per microliter.
For the measurement of HBD-2, 15 µl of each sample waslyophilized again and resuspended in sodium dodecyl sulfatebuffer overnight at 4°C. Samples and known amounts of HBD-2for use as standards were then boiled for five minutes and loadedonto a 16.5 percent sodium dodecyl sulfatetricine polyacrylamidegel. The samples were placed on ImmobilonPSQ membranes(Millipore) for one hour at 0.18 mA in 0.05 M sodium borate,pH 9.0, with 20 percent methanol and 0.05 percent sodium dodecylsulfate. Blots were fixed for 30 minutes with 0.5 percent glutaraldehydein TRIS-buffered saline (500 mM sodium chloride and 20 mM TRIS,pH 7.5), blocked for 30 minutes in 0.75 percent Blotto (nonfatpowdered milk) in phosphate-buffered saline (0.9 percent sodiumchloride and 10 mM sodium phosphate buffer, pH 7.4), then incubatedfor 18 hours in a 1:500 dilution of rabbit antiHBD-2serum in antibody dilution buffer (0.25 percent Blotto in phosphate-bufferedsaline containing 0.01 percent thimerosal as a preservative).The blots were washed in 0.1 percent bovine serum albumin inBlotto TRIS-buffered saline (0.9 percent sodium chloride and20 mM TRIShydrogen chloride, pH 4.5 to 5.0) three timesfor 10 minutes each time. The membranes were incubated in a1:2000 dilution of alkaline phosphataseconjugated goatantirabbit IgG in antibody dilution buffer for one hour, thenwashed three times as before and developed in alkaline phosphatasedevelopment solution (bromochloroindolyl phosphatenitrobluetetrazolium).
For the measurement of LL-37, immunodot blot analysis was performed.Positive controls and standard curves were generated with asynthetic LL-37 peptide (C-terminal, 18-mer fragment; aminoacid sequence, CZQPIKDFLRNLVPRTES; molecular weight, 2204).The peptide was diluted serially from 50 to 1600 nM; 100 µlof each peptide standard and 5 µl of each sample (equivalentto 0.5 mg of tissue), extracted in a manner identical to thatfor HBD-2 measurements, were dotted in triplicate on nitrocellulosemembrane. The membrane was blocked with 10 percent nonfat drymilk (Bio-Rad) and 0.1 percent Tween 20 in TRIS-buffered salineat room temperature for three hours and then incubated at 4°Covernight with rabbit antiLL-37 antibody diluted to 1:2500in the blocking solution. The membrane was then incubated atroom temperature for two hours with goat antirabbit antibodyhorseradishperoxidase (Dako) that was diluted to 1:4000 in blocking solution.Western Lightning chemiluminescence reagent (PerkinElmerLife Sciences) was used to detect electro-chemiluminescence.A low-light imaging system (ChemiImager 4400, Alpha Innotech)was used for densitometrical analysis. Signal detected by dotblot analysis was confirmed in some experiments by Western blotanalysis, which identified full-length LL-37 at 18 kD. For quantificationof both LL-37 and HBD-2, the signal intensity of tissue extractswas directly compared with that of a simultaneously preparedstandard consisting of known amounts of each synthetic peptide.The concentration of antimicrobial peptide in the original skin-biopsysample was then estimated by dividing the experimentally determinedmass of antimicrobial peptide from the skin-biopsy sample bythe epidermal volume. The epidermal volume was estimated byassuming an epidermal thickness of 0.1 mm; thus, the volumeof epidermis in a 2-mm punch-biopsy specimen was 3.14x101mm3.
RT-PCR Analysis of HBD-2 and LL-37 Messenger RNA
Total RNA was isolated from 2-mm skin-biopsy samples from thesubjects with the use of TRI Reagent (Sigma) according to themanufacturer's protocol. The primers and probe for HBD-2 weredesigned with the use of Prism 7700 sequence-detection software(Primer Express, PerkinElmer Applied Biosystems). Theprimer sequences were 5' TCCTCTTCTCGTTCCTCTTCATATTC3' (forwardprimer) and 5'TTAAGGCAGGTAACAGGATCGC3' (reverse primer). Thesequence for the probe (TaqMan, PerkinElmer) was 5'ACCACCAAAAACACCTGGAAGAGGCA3';the 5' end was labeled with 6-carboxyfluorescein, and the 3'end was labeled with 6-carboxytetramethylrhodamine.
Amplification reactions were performed with the use of a sequencedetector (ABI Prism 7700, PerkinElmer Applied Biosystems)in MicroAmp optical tubes (PerkinElmer Applied Biosystems)in a 25-µl mixture containing 8 percent glycerol, 1x TaqManbuffer A (500 mM potassium chloride, 100 mM TRIS-hydrogen chloride,0.1 M EDTA, and 600 nM passive reference dye ROX, pH 8.3, atroom temperature), 300 µM each of deoxyadenosine triphosphate,deoxyguanosine triphosphate, and deoxycytidine triphosphate,and 600 µM deoxyuridine triphosphate; 5.5 mM magnesiumchloride; 900 nM forward primer; 900 nM reverse primer; 200nM probe; 0.625 U of AmpliTaq Gold DNA Polymerase (PerkinElmer);6.25 U of Moloney murine leukemia virus reverse transcriptase(Life Technologies); 10 U of RNasin ribonuclease inhibitor (Promega);and the template RNA. The RT assay was performed at 48°Cfor 30 minutes, followed by activation of TaqGold at 95°Cfor 10 minutes. Forty cycles of amplification were then performedat 95°C for 15 seconds and at 60°C for 1 minute.
After amplification, real-time data acquisition and analysiswere performed. The fluorescence data were expressed as normalizedreporter signal, calculated by dividing the amount of reportersignal by the amount of passive reference signal, or as thechange in the normal reporter signal, calculated as the amountof normalized reporter signal minus the amount of reporter signalbefore PCR. The detection threshold was set above the mean base-linevalue for fluorescence determined on the basis of the first15 cycles. Amplification reactions in which the intensity offluorescence exceeded the threshold were defined as positivereactions. The threshold cycle (Ct) is the PCR cycle at whichan increase in reporter signal above the base-line signal canfirst be detected. A standard curve was generated with the useof the fluorescence data from the 10-fold serial dilutions oftotal RNA from a skin-biopsy sample from a patient with psoriasis.This curve was used to calculate the relative amounts of HBD-2in test samples. Quantities of HBD-2 in test samples were normalizedto the corresponding 18S ribosomal RNA (rRNA) (P/N 4308310,PerkinElmer Applied Biosystems).
The real-time, quantitative PCR assay for LL-37 was performedwith the use of a sequence-detection system (GeneAmp 5700, PerkinElmer).Classic 18S primers (Ambion) were used to amplify 18S rRNA.The primer sequences used to amplify LL-37 complementary DNA(cDNA) were 5'GCAGTCACCAGAGGATTGTGAC3' (forward primer) and5'CACCGCTTCACCAGCCC3' (reverse primer). For the PCR assay ofLL-37, 1.2 µl of RT reaction was used; 1.2 µl of200-fold diluted RT reaction was used for PCR of 18S rRNA. Amplificationreactions were performed in a final total volume of 25.7 µlcontaining SYBR Green PCR Master Mix (Applied Biosystems), 10µM primer, and nuclease-free water. The assay was performedat 50°C for 2 minutes and at 95°C for 10 minutes. Fortycycles of amplification were then performed at 94°C for15 seconds and at 60°C for 1 minute. The results were analyzedwith the use of the comparative Ct method. This method is basedon the assumption that the target (LL-37) and reference (18S)primers amplify with the same efficiency within a given rangeof initial messenger RNA (mRNA) concentrations. To test thisassumption, cDNA was made from total RNA of a psoriasis sampleat the initial total RNA concentrations of 1000, 500, 100, 50,and 10 ng. Real-time PCR was performed in triplicate for eachstarting concentration, and the change in Ct (Ct) was calculated.For each starting concentration of total RNA, Ct = CtR CtG, where CtR denotes the reference Ct and CtG the target Ct.This value was plotted against the log of the initial totalRNA concentration. The efficiencies of gene amplification wereclose enough that a correction factor over the specified rangewas not required if the slope was less than or equal to 0.1.We calculated the Ct for samples as follows: Ct = CtE CtB, where CtE denotes the experimental Ct and CtB the base-lineCt. The base-line sample was a normal control sample, whichhad low expression of LL-37 mRNA. The relative expression wascalculated as 2Ct in order to account for the exponential amplificationof the PCR reaction.
Cell Culture
HaCat cells, a human keratinocyte cell line, were grown in Dulbecco'sModified Eagle's medium (Cellgro), supplemented with 10 percentfetal-calf serum (Gemini) and 1 percent of each of the following:200 mM L-glutamine, minimal essential medium (MEM) with nonessentialamino acids (GIBCO), MEM Vitamins Solution (Life Technologies),and penicillinstreptomycin. To study the effects of interleukin-4and interleukin-13 on HBD-2 mRNA expression in HaCat cells,5x105 cells per milliliter were incubated in control medium,20 ng of TNF- per milliliter alone or 20 ng of TNF- per milliliterplus 50 ng of interleukin-4 per milliliter, alone or in combinationwith 50 ng of interleukin-13 per milliliter, for 24 hours. Thecells were then washed once and homogenized in TRI reagent byrepeated pipetting. Total RNA was isolated according to themanufacturer's protocol.
Measurement of Antimicrobial Activity
LL-37 and HBD-2 peptides were synthesized as previously described.17,18The antimicrobial activity of the peptides was determined withthe use of a solution colony-forming unit (CFU) assay. Wild-typeS. aureus isolated from patients with atopic dermatitis wasassessed. Bacteria were grown to a concentration at which theywere multiplying exponentially (mid log phase; A600 1.5=8.0x109CFU per milliliter) in Todd Hewitt broth medium (Sigma). Bacteriawere washed twice with 10 mM sodium phosphate buffer (pH 7.4)containing 0.1 percent (wt/vol) Todd Hewitt broth and were dilutedto a final concentration of 2.0x107 cells per milliliter inthe same buffer. Ten microliters of this bacterial suspensionwas then placed in round-bottom, 96-well cell-culture platesand incubated at 37°C and 100 percent humidity for two hourswith various concentrations of LL-37, HBD-2, or both. The cytotoxicactivity and minimal bactericidal activity of LL-37 and HBD-2were analyzed by plating serial dilutions of the incubationmixture in triplicate on Todd Hewitt broth agar plates and determiningthe CFU the following day. The percentage of killed bacteriawas expressed as [1 (CFU after peptide incubation) ÷(CFU after control incubation)] x 100.
Statistical Analysis
The nonparametric median test from the JMP4 statistical package19was used to determine significant differences. We constrainedexperimentwise error rates to the standard alpha level of 0.05by the Bonferroni method; the alpha level was 0.025 for a comparisonof two means and 0.017 for a comparison of three means.
Results
Figure 1 shows the immunostaining of HBD-2 and LL-37 in skin-biopsysamples. The samples from psoriatic lesions had much more intensestaining for both HBD-2 and LL-37 than the samples from acuteor chronic atopic lesions or normal skin. Figure 2 shows thecomposite data on HBD-2 immunostaining for all the skin-biopsysamples. The intensity of the immunostaining of samples fromacute atopic lesions did not differ significantly from thatof chronic atopic lesions or normal skin. Psoriatic lesions,however, had significantly more intense immunostaining thanacute atopic lesions (P=0.006), chronic atopic lesions (P=0.03),or normal skin (P=0.02). The results of immunostaining for LL-37in the samples of normal skin and psoriatic lesions were consistentwith a previous study showing that psoriatic lesions have greaterexpression of LL-37 than normal skin.7 The inflammatory skinlesions from patients with atopic dermatitis had markedly lowerexpression of LL-37 than the skin lesions from patients withpsoriasis. The biggest difference was in the region of the granularcell layer and stratum corneum, which was relatively devoidof LL-37 in the atopic lesions but had the highest expressionof LL-37 in the psoriatic lesions. The absence of HBD-2 andLL-37 in the normal skin also confirms previous reports thatthese antimicrobial peptides are not normally produced but areup-regulated under inflammatory conditions.4,7
Figure 1. Immunostaining for HBD-2 (Panel A) and LL-37 (Panel B) in Frozen Skin Sections from Patients with Psoriasis or Atopic Dermatitis (AD) and Normal Subjects.
Immunostaining for HBD-2 and LL-37 was more intense in the psoriatic lesions than in the atopic lesions or normal skin. The arrows in Panels A and B indicate immune reactivity to HBD-2 and LL-37, respectively.
Figure 2. Intensity of Immunostaining for HBD-2 in Skin from Patients with Atopic Dermatitis, Patients with Psoriasis, and Normal Subjects.
The intensity of the staining was graded visually on a scale from 0 (no staining) to 3 (the most intense staining). There was no staining in any of the skin-biopsy samples from normal subjects.
For further quantification of the relative amounts of antimicrobialpeptides in skin lesions, 2-mm biopsy specimens were acid-extracted,and the total amount of LL-37 and HBD-2 was measured (Figure 3).Sufficient skin samples were available for analysis fromonly five patients with psoriasis and six with atopic dermatitis.Western blotting, as compared with a standard curve of recombinantHBD-2, showed that the amount of HBD-2 present in the psoriaticlesions ranged from 2.3 to 157 µM (median, 20), whereasno HBD-2 was detectable in the atopic lesions (Figure 3A). Theresults of quantification of LL-37 in skin-biopsy samples withthe use of immunodot blot analysis were similar, with an abundanceof LL-37 in the psoriatic lesions (median, 304 µM; range,0 to 1605); only one of the six atopic lesions had detectableLL-37 (Figure 3B). The single positive sample from a patientwith atopic dermatitis was from a chronic lesion, probably reflectingthe contribution of LL-37 from an inflammatory-cell infiltrate.
Figure 3. Quantification of HBD-2 (Panel A) and LL-37 (Panel B) in Epidermis of Atopic and Psoriatic Skin Lesions.
Data for HDB-2 are based on Western blot analysis, and data for LL-37 on immunodot blot analysis.
The difference in the expression of HBD-2 and LL-37 proteinbetween atopic lesions and psoriatic lesions was further confirmedby the measurement of mRNA with the use of real-time RT-PCR.As shown in Figure 4, the expression of HBD-2 mRNA was significantlylower in acute atopic lesions (median, 98 pg per nanogram ofrRNA) and chronic atopic lesions (median, 3268 pg per nanogramof rRNA) than in psoriatic lesions (median, 31,660 pg per nanogramof rRNA; P=0.009 for both comparisons). Real-time RT-PCR analysesof LL-37 mRNA showed similar results, with significantly lowerexpression of LL-37 peptide in acute and chronic atopic lesionsthan in psoriatic lesions (P=0.02 for both comparisons) (Figure 4).
Figure 4. HBD-2 and LL-37 Messenger RNA (mRNA) in Atopic and Psoriatic Skin Lesions.
Data are based on real-time reverse-transcriptasepolymerase-chain-reaction analyses of HBD-2 (Panel A) and LL-37 (Panel B). The abbreviation rRNA denotes ribosomal RNA.
Previous studies have shown that LL-37 and HBD-2 are greatlyincreased in patients with inflammatory skin conditions.5,6,7Therefore, the diminished expression of the peptides in lesionsfrom patients with atopic dermatitis was an unexpected observation.To determine the mechanism underlying the reduced expressionof antimicrobial peptides in atopic dermatitis, we studied theeffects of two cytokines (interleukin-4 and interleukin-13)that are elevated in atopic dermatitis but not in psoriasis.13Figure 5 shows the effects of interleukin-4 and interleukin-13on TNF-induced expression of HBD-2 in HaCat cells. Interleukin-4alone or in combination with interleukin-13 significantly suppressedthe up-regulation of HBD-2 mRNA by TNF- (P=0.04). In normalhuman skin, both interleukin-4 and interleukin-13 suppressedTNF-induced HBD-2 mRNA expression in these explants (datanot shown). Since atopic lesions are characterized by the predominanceof interleukin-4 and interleukin-13 expression, the suppressionof HBD-2 mRNA by these cytokines may account for the low expressionof HBD-2 in these lesions.
Figure 5. Effects of Interleukin-4 and Interleukin-13 on Tumor Necrosis Factor (TNF-)Induced HBD-2 Expression in HaCat Cells.
The concentration of TNF- was 20 ng per milliliter, and the concentrations of interleukin-4 and interleukin-13 were 50 ng per milliliter each. The data are based on a total of three experiments. The bars indicate standard deviations, and rRNA denotes ribosomal RNA.
The relative absence of HBD-2 and LL-37 in the epidermis inatopic lesions, as compared with psoriatic lesions, suggestedthat the lack of these antimicrobial peptides in patients withatopic dermatitis might contribute to their susceptibility tobacterial colonization and infection. To investigate this possibility,we evaluated the susceptibility of clinical isolates of S. aureusto cytotoxic activity by both LL-37 and HBD-2. Alone, LL-37showed strong activity (Figure 6A), whereas HBD-2 was much lesspotent (minimal bactericidal concentration, >160 µM).No significant difference in susceptibility to these antimicrobialpeptides was detected in clinical isolates, as compared withwild-type S. aureus (American Type Culture Collection number25923), but all the isolates were more resistant than defensin-sensitivestrains lacking cell-wall charge modifications that confer resistance.20The relative resistance of S. aureus isolates from patientswith atopic dermatitis argues against the reversion of the bacteriato less resistant forms in this disorder. When these resistantstrains of S. aureus were exposed to antimicrobial peptidesexpressed in psoriatic skin, however, the presence of both peptidesenhanced their cytotoxic activity (Figure 6). A combinationof HBD-2 (at 80 µM or 160 µM) and LL-37 (at 4 µM)killed significantly more S. aureus organisms than did HBD-2alone.
Figure 6. Cytotoxic Activity of HBD-2 and LL-37 against Wild-Type Staphylococcus aureus.
Wild-type S. aureus (2.0x107 per milliliter) was incubated with increasing concentrations of LL-37 alone (Panel A) or LL-37 combined with HBD-2 at a concentration of 80 µm (Panel B) or 160 µm (Panel C). The I bars denote standard deviations.
Discussion
Atopic dermatitis is a very common skin disease known to beassociated with a high prevalence of skin infections, particularlywith S. aureus.13 The density of S. aureus in inflamed atopiclesions without clinical superinfection can be as high as 107colony-forming units per square centimeter of lesional skin.The important role of S. aureus is supported by the observationthat even in patients with atopic dermatitis who do not havesuperinfection, the severity of the skin disease is reducedby treatment with a combination of antistaphylococcal antibioticsand topical corticosteroids.21
Since S. aureus infection is a frequent trigger for the exacerbationof skin disease, there has been considerable interest in themechanisms underlying the increased colonization of atopic skinlesions with S. aureus.22 Atopic skin has significantly greaterbinding affinity for S. aureus than nonatopic or psoriatic skin,probably as the result of underlying inflammation.23 This viewis supported by the observation that treatment with topicalglucocorticoids or tacrolimus reduces S. aureus counts on atopicskin.24,25 Indeed, a recent study has shown that the numberof S. aureus organisms that bind to inflammatory skin lesionsis significantly higher when the inflammation is mediated bytype 2 helper T cells than when it is mediated by type 1 helperT cells.26
The increased avidity of S. aureus for atopic skin, however,can account only for a several-fold increase in S. aureus onatopic skin.23 Examination of skin-biopsy samples from patientswith atopic dermatitis has shown that S. aureus grows in coloniesin the upper layers of the epidermis between keratinocytes.27This suggests that an exponential increase in S. aureus couldresult from failure of the innate immune defense system of atopicskin to restrict the growth of the organisms. Naturally occurringantimicrobial peptides are a critical component of this innateimmune system that have been shown to provide mammalian skinwith resistance to bacterial infection.11 The antimicrobialpeptides HBD-2 and LL-37 are normally produced by keratinocytesin response to inflammatory stimuli such as psoriasis or injury.7Consistent with the concept that the activity of keratinocytesin atopic dermatitis differs from that in psoriasis, recentobservations indicate that in atopic dermatitis, but not psoriasis,keratinocytes produce a distinct profile of chemokines thatpromote the influx of eosinophils and type 2 helper T cellsinto the skin, whereas psoriatic keratinocytes promote infiltrationby neutrophils and type 1 helper T cells.28
In our study, several independent approaches demonstrated thatat both the protein level and the mRNA level, LL-37 and HBD-2are deficient in skin lesions from patients with atopic dermatitis.We also demonstrated that the combination of HBD-2 and LL-37at the concentrations found in psoriatic lesions, but not atopiclesions, was sufficient to kill S. aureus. These antimicrobialpeptides have activity not only against bacteria but also againstfungi and viruses. Thus, our observations may explain the increasedsusceptibility of patients with atopic dermatitis to fungaland viral infections such as herpes simplex and molluscum contagiosum.
We also investigated the potential mechanism (or mechanisms)for the reduced expression of antimicrobial peptides such asHBD-2. Since it is well established that atopic skin lesionsare associated with increased expression of interleukin-4 andinterleukin-13, we explored the possibility that these type2 helper cytokines may inhibit HBD-2 gene expression. Indeed,we found that the combination of interleukin-4 and interleukin-13was highly effective in inhibiting HBD-2 gene expression. Thus,type 2 helper cytokines account not only for the high IgE concentrationsand eosinophilia in patients with atopic dermatitis but alsofor their increased susceptibility to skin infections.
In summary, our study showed that inflammatory skin lesionsfrom patients with atopic dermatitis had significantly lowerconcentrations of HBD-2 and LL-37 than skin lesions from patientswith psoriasis. The inhibitory effects of interleukin-4 andinterleukin-13, both of which are abundant in atopic skin, mayaccount for this finding. Furthermore, the low concentrationsof HBD-2 and LL-37 in the patients with atopic dermatitis wereunable to kill S. aureus. Therefore, a deficiency in the expressionof inflammation-induced antimicrobial peptides may explain thesusceptibility of patients with atopic dermatitis to skin infections.Our findings demonstrate the presence of skin-localized immunodeficiencyin atopic dermatitis and the correlation between deficient expressionof antimicrobial peptides and infection. These findings pointto the role of antimicrobial-peptide function in clinical diseaseand highlight the importance of considering the interactionbetween the innate and adaptive immune systems.
Supported in part by grants from the National Institutes ofHealth (HL36577, AR41256, and HL37260), the Division of ResearchResources (Clinical Research Center grant MO1 RR00051), andthe University of Colorado Cancer Center to Dr. Leung; a NationalResearch Service Award (T32 AI 07365) and a Fujisawa HealthCare Allergic Skin Diseases Award to Dr. Ong; a Veterans AffairsMerit Review Award and grants from the Stern Foundation andthe National Institutes of Health (AI48176) to Dr. Gallo; anda grant from the National Institutes of Health (HL46809) toDr. Ganz.
We are indebted to Birgitta Agerberth for the gift of antiLL-37antibody, to Dr. Bryan R. Hauge and Umarani Pugazhenthi at theUniversity of Colorado Cancer Center Core Facility for assistancewith the real time RT-PCR analyses of HBD-2, to Maureen Sandovalfor assistance with the preparation of the manuscript, to Dr.James Murphy for assistance with the statistical analyses, andto Dr. Hal Jenkins for his critical reading of the manuscript.
Source Information
From the Division of Allergy and Immunology, Department of Pediatrics, National Jewish Medical and Research Center, Denver (P.Y.O., I.S., M.B., D.Y.M.L.); the Department of Pediatrics, University of Colorado Health Sciences Center, Denver (M.B., D.Y.M.L.); the Division of Dermatology, Department of Medicine and Pediatrics, University of California, San Diego, and the Veterans Affairs San Diego Health Care System, San Diego (T.O., C.B., R.L.G.); and the Division of Pulmonary and Critical Care Medicine, Departments of Medicine and Pathology, School of Medicine, University of California, Los Angeles (T.G.).
Address reprint requests to Dr. Leung at the National Jewish Medical and Research Center, Department of Pediatrics, Rm. K926, 1400 Jackson St., Denver, CO 80206.
References
Jackson SM, Elias PM. Skin as an organ of protection. In: Fitzpatrick TB, Eisen AZ, Wolff K, Freedberg IM, Austen KF, eds. Dermatology in general medicine. 4th ed. Vol. 1. New York: McGraw-Hill, 1993:241-53.
Fearon DT, Locksley RM. The instructive role of innate immunity in the acquired immune response. Science 1996;272:50-53. [Abstract]
Lehrer RI, Lichtenstein AK, Ganz T. Defensins: antimicrobial and cytotoxic peptides of mammalian cells. Annu Rev Immunol 1993;11:105-128. [CrossRef][Web of Science][Medline]
Harder J, Bartels J, Christophers E, Schroder JM. A peptide antibiotic from human skin. Nature 1997;387:861-861. [CrossRef][Medline]
Stolzenberg ED, Anderson GM, Ackermann MR, Whitlock RH, Zasloff M. Epithelial antibiotic induced in states of disease. Proc Natl Acad Sci U S A 1997;94:8686-8690. [Free Full Text]
Gallo RL, Ono M, Povsic T, et al. Syndecans, cell surface heparan sulfate proteoglycans, are induced by a proline-rich antimicrobial peptide from wounds. Proc Natl Acad Sci U S A 1994;91:11035-11039. [Free Full Text]
Frohm M, Agerberth B, Ahangari G, et al. The expression of the gene coding for the antibacterial peptide LL-37 is induced in human keratinocytes during inflammatory disorders. J Biol Chem 1997;272:15258-15263. [Free Full Text]
Fulton C, Anderson GM, Zasloff M, Bull R, Quinn AG. Expression of natural peptide antibiotics in human skin. Lancet 1997;350:1750-1751. [CrossRef][Web of Science][Medline]
Gropp R, Frye M, Wagner TO, Bargon J. Epithelial defensins impair adenoviral infection: implication for adenovirus-mediated gene therapy. Hum Gene Ther 1999;10:957-964. [CrossRef][Web of Science][Medline]
Gallo RL, Huttner KM. Antimicrobial peptides: an emerging concept in cutaneous biology. J Invest Dermatol 1998;111:739-743. [CrossRef][Web of Science][Medline]
Nizet V, Ohtake T, Lauth X, et al. Innate antimicrobial peptide protects the skin from invasive bacterial infection. Nature 2001;414:454-457. [CrossRef][Medline]
Panyutich A, Shi J, Boutz PL, Zhao C, Ganz T. Porcine polymorphonuclear leukocytes generate extracellular microbicidal activity by elastase-mediated activation of secreted proprotegrins. Infect Immun 1997;65:978-985. [Abstract]
Leung DYM. Atopic dermatitis: new insights and opportunities for therapeutic intervention. J Allergy Clin Immunol 2000;105:860-876. [CrossRef][Web of Science][Medline]
Leung DYM, Tharp M, Boguniewicz M. Atopic dermatitis (atopic eczema). In: Freedberg IM, Eisen AZ, Wolff K, et al., eds. Fitzpatrick's dermatology in general medicine. 5th ed. Vol. 1. New York: McGraw-Hill, 1998:1464-80.
Christophers E, Henseler T. Contrasting disease patterns in psoriasis and atopic dermatitis. Arch Dermatol Res 1987;279:Suppl:S48-S51.
Grice K, Sattar H, Baker H, Sharratt M. The relationship of transepidermal water loss to skin temperature in psoriasis and eczema. J Invest Dermatol 1975;64:313-315. [CrossRef][Medline]
Dorschner RA, Pestonjamasp VK, Tamakuwala S, et al. Cutaneous injury induces the release of cathelicidin anti-microbial peptides active against group A Streptococcus. J Invest Dermatol 2001;117:91-97. [CrossRef][Web of Science][Medline]
Liu AY, Destoumieux D, Wong AV, et al. Human -defensin-2 production in keratinocytes is regulated by interleukin-1, bacteria, and the state of differentiation. J Invest Dermatol 2002;118:275-281. [CrossRef][Web of Science][Medline]
Conover WJ. Practical nonparametric statistics. 2nd ed. New York: John Wiley, 1980.
Peschel A, Jack RW, Otto M, et al. Staphylococcus aureus resistance to human defensins and evasion of neutrophil killing via the novel virulence factor MprF is based on modification of membrane lipids with L-lysine. J Exp Med 2001;193:1067-1076. [Free Full Text]
Bunikowski R, Mielke ME, Skarabis H, et al. Evidence for a disease-promoting effect of Staphylococcus aureus-derived exotoxins in atopic dermatitis. J Allergy Clin Immunol 2000;105:814-819. [CrossRef][Web of Science][Medline]
Cho SH, Strickland I, Tomkinson A, Fehringer AP, Gelfand EW, Leung DY. Preferential binding of Staphylococcus aureus to skin sites of Th2-mediated inflammation in a murine model. J Invest Dermatol 2001;116:658-663. [CrossRef][Web of Science][Medline]
Nilsson EJ, Henning CG, Magnusson J. Topical corticosteroids and Staphylococcus aureus in atopic dermatitis. J Am Acad Dermatol 1992;27:29-34. [Web of Science][Medline]
Remitz A, Kyllonen H, Granlund H, Reitamo S. Tacrolimus ointment reduces staphylococcal colonization of atopic dermatitis lesions. J Allergy Clin Immunol 2001;107:196-197. [CrossRef][Medline]
Cho SH, Strickland I, Boguniewicz M, Leung DY. Fibronectin and fibrinogen contribute to the enhanced binding of Staphylococcus aureus to atopic skin. J Allergy Clin Immunol 2001;108:269-274. [CrossRef][Web of Science][Medline]
Morishita Y, Tada J, Sato A, et al. Possible influences of Staphylococcus aureus on atopic dermatitis -- the colonizing features and the effects of staphylococcal enterotoxins. Clin Exp Allergy 1999;29:1110-1117. [CrossRef][Web of Science][Medline]
Giustizieri ML, Mascia F, Frezzolini A, et al. Keratinocytes from patients with atopic dermatitis and psoriasis show a distinct chemokine production profile in response to T cell-derived cytokines. J Allergy Clin Immunol 2001;107:871-877. [CrossRef][Web of Science][Medline]
Rivas-Santiago, B., Serrano, C. J., Enciso-Moreno, J. A.
(2009). Susceptibility to Infectious Diseases Based on Antimicrobial Peptide Production. Infect. Immun.
77: 4690-4695
[Abstract][Full Text]
Li, H.-N., Barlow, P. G., Bylund, J., Mackellar, A., Bjorstad, A., Conlon, J., Hiemstra, P. S., Haslett, C., Gray, M., Simpson, A. J., Rossi, A. G., Davidson, D. J.
(2009). Secondary necrosis of apoptotic neutrophils induced by the human cathelicidin LL-37 is not proinflammatory to phagocytosing macrophages. J. Leukoc. Biol.
86: 891-902
[Abstract][Full Text]
Mookherjee, N., Lippert, D. N. D., Hamill, P., Falsafi, R., Nijnik, A., Kindrachuk, J., Pistolic, J., Gardy, J., Miri, P., Naseer, M., Foster, L. J., Hancock, R. E. W.
(2009). Intracellular Receptor for Human Host Defense Peptide LL-37 in Monocytes. J. Immunol.
183: 2688-2696
[Abstract][Full Text]
Mader, J. S., Mookherjee, N., Hancock, R. E.W., Bleackley, R. C.
(2009). The Human Host Defense Peptide LL-37 Induces Apoptosis in a Calpain- and Apoptosis-Inducing Factor-Dependent Manner Involving Bax Activity. Mol Cancer Res
7: 689-702
[Abstract][Full Text]
Huang, J. T., Abrams, M., Tlougan, B., Rademaker, A., Paller, A. S.
(2009). Treatment of Staphylococcus aureus Colonization in Atopic Dermatitis Decreases Disease Severity. Pediatrics
123: e808-e814
[Abstract][Full Text]
Bjorstad, A., Askarieh, G., Brown, K. L., Christenson, K., Forsman, H., Onnheim, K., Li, H.-N., Teneberg, S., Maier, O., Hoekstra, D., Dahlgren, C., Davidson, D. J., Bylund, J.
(2009). The Host Defense Peptide LL-37 Selectively Permeabilizes Apoptotic Leukocytes. Antimicrob. Agents Chemother.
53: 1027-1038
[Abstract][Full Text]
Herr, C, Beisswenger, C, Hess, C, Kandler, K, Suttorp, N, Welte, T, Schroeder, J-M, Vogelmeier, C, Group, R B. f. t. C. S.
(2009). Suppression of pulmonary innate host defence in smokers. Thorax
64: 144-149
[Abstract][Full Text]
Maerki, C., Meuter, S., Liebi, M., Muhlemann, K., Frederick, M. J., Yawalkar, N., Moser, B., Wolf, M.
(2009). Potent and Broad-Spectrum Antimicrobial Activity of CXCL14 Suggests an Immediate Role in Skin Infections. J. Immunol.
182: 507-514
[Abstract][Full Text]
Peric, M., Koglin, S., Kim, S.-M., Morizane, S., Besch, R., Prinz, J. C., Ruzicka, T., Gallo, R. L., Schauber, J.
(2008). IL-17A Enhances Vitamin D3-Induced Expression of Cathelicidin Antimicrobial Peptide in Human Keratinocytes. J. Immunol.
181: 8504-8512
[Abstract][Full Text]
Guttman-Yassky, E., Lowes, M. A., Fuentes-Duculan, J., Zaba, L. C., Cardinale, I., Nograles, K. E., Khatcherian, A., Novitskaya, I., Carucci, J. A., Bergman, R., Krueger, J. G.
(2008). Low Expression of the IL-23/Th17 Pathway in Atopic Dermatitis Compared to Psoriasis. J. Immunol.
181: 7420-7427
[Abstract][Full Text]
Morioka, Y., Yamasaki, K., Leung, D., Gallo, R. L.
(2008). Cathelicidin Antimicrobial Peptides Inhibit Hyaluronan-Induced Cytokine Release and Modulate Chronic Allergic Dermatitis. J. Immunol.
181: 3915-3922
[Abstract][Full Text]
Zhang, Z., Cherryholmes, G., Shively, J. E.
(2008). Neutrophil secondary necrosis is induced by LL-37 derived from cathelicidin. J. Leukoc. Biol.
84: 780-788
[Abstract][Full Text]
Tjabringa, G., Bergers, M., van Rens, D., de Boer, R., Lamme, E., Schalkwijk, J.
(2008). Development and Validation of Human Psoriatic Skin Equivalents. Am. J. Pathol.
173: 815-823
[Abstract][Full Text]
Kobayashi, M., Yoshida, T., Takeuchi, D., Jones, V. C., Shigematsu, K., Herndon, D. N., Suzuki, F.
(2008). Gr-1+CD11b+ cells as an accelerator of sepsis stemming from Pseudomonas aeruginosa wound infection in thermally injured mice. J. Leukoc. Biol.
83: 1354-1362
[Abstract][Full Text]
Bieber, T.
(2008). Atopic Dermatitis. NEJM
358: 1483-1494
[Full Text]
Silverberg, N., Block, S.
(2008). Uncomplicated Skin and Skin Structure Infections in Children: Diagnosis and Current Treatment Options in the United States. CLIN PEDIATR
47: 211-219
Nagaoka, I., Niyonsaba, F., Tsutsumi-Ishii, Y., Tamura, H., Hirata, M.
(2008). Evaluation of the effect of human {beta}-defensins on neutrophil apoptosis. Int Immunol
20: 543-553
[Abstract][Full Text]
Wu, Q., Martin, R. J., LaFasto, S., Efaw, B. J., Rino, J. G., Harbeck, R. J., Chu, H. W.
(2008). Toll-like Receptor 2 Down-regulation in Established Mouse Allergic Lungs Contributes to Decreased Mycoplasma Clearance. Am. J. Respir. Crit. Care Med.
177: 720-729
[Abstract][Full Text]
Rivas-Santiago, B., Hernandez-Pando, R., Carranza, C., Juarez, E., Contreras, J. L., Aguilar-Leon, D., Torres, M., Sada, E.
(2008). Expression of Cathelicidin LL-37 during Mycobacterium tuberculosis Infection in Human Alveolar Macrophages, Monocytes, Neutrophils, and Epithelial Cells. Infect. Immun.
76: 935-941
[Abstract][Full Text]
Bonness, S., Szekat, C., Novak, N., Bierbaum, G.
(2008). Pulsed-Field Gel Electrophoresis of Staphylococcus aureus Isolates from Atopic Patients Revealing Presence of Similar Strains in Isolates from Children and Their Parents. J. Clin. Microbiol.
46: 456-461
[Abstract][Full Text]
Drake, D. R., Brogden, K. A., Dawson, D. V., Wertz, P. W.
(2008). Thematic Review Series: Skin Lipids. Antimicrobial lipids at the skin surface. J. Lipid Res.
49: 4-11
[Abstract][Full Text]
Harder, J., Glaser, R., Schroder, J.-M.
(2007). Review: Human antimicrobial proteins effectors of innate immunity. Innate Immunity
13: 317-338
[Abstract]
Kindrachuk, J., Paur, N., Reiman, C., Scruten, E., Napper, S.
(2007). The PhoQ-Activating Potential of Antimicrobial Peptides Contributes to Antimicrobial Efficacy and Is Predictive of the Induction of Bacterial Resistance. Antimicrob. Agents Chemother.
51: 4374-4381
[Abstract][Full Text]
Yu, J., Mookherjee, N., Wee, K., Bowdish, D. M. E., Pistolic, J., Li, Y., Rehaume, L., Hancock, R. E. W.
(2007). Host Defense Peptide LL-37, in Synergy with Inflammatory Mediator IL-1beta, Augments Immune Responses by Multiple Pathways. J. Immunol.
179: 7684-7691
[Abstract][Full Text]
Goitsuka, R., Chen, C.-l. H., Benyon, L., Asano, Y., Kitamura, D., Cooper, M. D.
(2007). Chicken cathelicidin-B1, an antimicrobial guardian at the mucosal M cell gateway. Proc. Natl. Acad. Sci. USA
104: 15063-15068
[Abstract][Full Text]
Wan, M., Sabirsh, A., Wetterholm, A., Agerberth, B., Haeggstrom, J. Z.
(2007). Leukotriene B4 triggers release of the cathelicidin LL-37 from human neutrophils: novel lipid-peptide interactions in innate immune responses. FASEB J.
21: 2897-2905
[Abstract][Full Text]
Albanesi, C., Fairchild, H. R., Madonna, S., Scarponi, C., De Pita, O., Leung, D. Y. M., Howell, M. D.
(2007). IL-4 and IL-13 Negatively Regulate TNF-{alpha}- and IFN-{gamma}-Induced beta-Defensin Expression through STAT-6, Suppressor of Cytokine Signaling (SOCS)-1, and SOCS-3. J. Immunol.
179: 984-992
[Abstract][Full Text]
Kristian, S. A., Timmer, A. M., Liu, G. Y., Lauth, X., Sal-Man, N., Rosenfeld, Y., Shai, Y., Gallo, R. L., Nizet, V.
(2007). Impairment of innate immune killing mechanisms by bacteriostatic antibiotics. FASEB J.
21: 1107-1116
[Abstract][Full Text]
Ardern-Jones, M. R., Black, A. P., Bateman, E. A., Ogg, G. S.
(2007). Bacterial superantigen facilitates epithelial presentation of allergen to T helper 2 cells. Proc. Natl. Acad. Sci. USA
104: 5557-5562
[Abstract][Full Text]
Di Nardo, A., Braff, M. H., Taylor, K. R., Na, C., Granstein, R. D., McInturff, J. E., Krutzik, S., Modlin, R. L., Gallo, R. L.
(2007). Cathelicidin Antimicrobial Peptides Block Dendritic Cell TLR4 Activation and Allergic Contact Sensitization. J. Immunol.
178: 1829-1834
[Abstract][Full Text]
Cohen, B.
(2007). Review of Pimecrolimus Cream 1% in Children for the Treatment of Mild to Moderate Atopic Dermatitis. CLIN PEDIATR
46: 7-15
Seneviratne, S.L., Black, A.P., Jones, L., Bailey, A.S., Ogg, G.S.
(2007). The role of skin-homing T cells in extrinsic atopic dermatitis. QJM
100: 19-27
[Abstract][Full Text]
Menzies, B. E., Kenoyer, A.
(2006). Signal Transduction and Nuclear Responses in Staphylococcus aureus- Induced Expression of Human {beta}-Defensin 3 in Skin Keratinocytes. Infect. Immun.
74: 6847-6854
[Abstract][Full Text]
Bachrach, G., Chaushu, G., Zigmond, M., Yefenof, E., Stabholz, A., Shapira, J., Merrick, J., Chaushu, S.
(2006). Salivary LL-37 Secretion in Individuals with Down Syndrome is Normal. JDR
85: 933-936
[Abstract][Full Text]
Yamasaki, K., Schauber, J., Coda, A., Lin, H., Dorschner, R. A., Schechter, N. M., Bonnart, C., Descargues, P., Hovnanian, A., Gallo, R. L.
(2006). Kallikrein-mediated proteolysis regulates the antimicrobial effects of cathelicidins in skin. FASEB J.
20: 2068-2080
[Abstract][Full Text]
de Haar, S. F., Hiemstra, P. S., van Steenbergen, M. T. J. M., Everts, V., Beertsen, W.
(2006). Role of Polymorphonuclear Leukocyte-Derived Serine Proteinases in Defense against Actinobacillus actinomycetemcomitans. Infect. Immun.
74: 5284-5291
[Abstract][Full Text]
Barlow, P. G., Li, Y., Wilkinson, T. S., Bowdish, D. M. E., Lau, Y. E., Cosseau, C., Haslett, C., Simpson, A. J., Hancock, R. E. W., Davidson, D. J.
(2006). The human cationic host defense peptide LL-37 mediates contrasting effects on apoptotic pathways in different primary cells of the innate immune system. J. Leukoc. Biol.
80: 509-520
[Abstract][Full Text]
Beisswenger, C., Kandler, K., Hess, C., Garn, H., Felgentreff, K., Wegmann, M., Renz, H., Vogelmeier, C., Bals, R.
(2006). Allergic Airway Inflammation Inhibits Pulmonary Antibacterial Host Defense. J. Immunol.
177: 1833-1837
[Abstract][Full Text]
Thwaite, J. E., Hibbs, S., Titball, R. W., Atkins, T. P.
(2006). Proteolytic Degradation of Human Antimicrobial Peptide LL-37 by Bacillus anthracis May Contribute to Virulence.. Antimicrob. Agents Chemother.
50: 2316-2322
[Abstract][Full Text]
Edfeldt, K., Agerberth, B., Rottenberg, M. E., Gudmundsson, G. H., Wang, X.-B., Mandal, K., Xu, Q., Yan, Z.-q.
(2006). Involvement of the Antimicrobial Peptide LL-37 in Human Atherosclerosis. Arterioscler. Thromb. Vasc. Bio.
26: 1551-1557
[Abstract][Full Text]
Huang, L. C., Petkova, T. D., Reins, R. Y., Proske, R. J., McDermott, A. M.
(2006). Multifunctional Roles of Human Cathelicidin (LL-37) at the Ocular Surface.. IOVS
47: 2369-2380
[Abstract][Full Text]
Lau, Y. E., Bowdish, D. M. E., Cosseau, C., Hancock, R. E. W., Davidson, D. J.
(2006). Apoptosis of Airway Epithelial Cells: Human Serum Sensitive Induction by the Cathelicidin LL-37. Am. J. Respir. Cell Mol. Bio.
34: 399-409
[Abstract][Full Text]
Baechle, D., Flad, T., Cansier, A., Steffen, H., Schittek, B., Tolson, J., Herrmann, T., Dihazi, H., Beck, A., Mueller, G. A., Mueller, M., Stevanovic, S., Garbe, C., Mueller, C. A., Kalbacher, H.
(2006). Cathepsin D Is Present in Human Eccrine Sweat and Involved in the Postsecretory Processing of the Antimicrobial Peptide DCD-1L. J. Biol. Chem.
281: 5406-5415
[Abstract][Full Text]
Xiao, Y., Cai, Y., Bommineni, Y. R., Fernando, S. C., Prakash, O., Gilliland, S. E., Zhang, G.
(2006). Identification and Functional Characterization of Three Chicken Cathelicidins with Potent Antimicrobial Activity. J. Biol. Chem.
281: 2858-2867
[Abstract][Full Text]
Voss, E., Wehkamp, J., Wehkamp, K., Stange, E. F., Schroder, J. M., Harder, J.
(2006). NOD2/CARD15 Mediates Induction of the Antimicrobial Peptide Human Beta-defensin-2. J. Biol. Chem.
281: 2005-2011
[Abstract][Full Text]
Dorschner, R. A., Lopez-Garcia, B., Peschel, A., Kraus, D., Morikawa, K., Nizet, V., Gallo, R. L.
(2006). The mammalian ionic environment dictates microbial susceptibility to antimicrobial defense peptides. FASEB J.
20: 35-42
[Abstract][Full Text]
Savinko, T., Lauerma, A., Lehtimaki, S., Gombert, M., Majuri, M.-L., Fyhrquist-Vanni, N., Dieu-Nosjean, M.-C., Kemeny, L., Wolff, H., Homey, B., Alenius, H.
(2005). Topical Superantigen Exposure Induces Epidermal Accumulation of CD8+ T Cells, a Mixed Th1/Th2-Type Dermatitis and Vigorous Production of IgE Antibodies in the Murine Model of Atopic Dermatitis. J. Immunol.
175: 8320-8326
[Abstract][Full Text]
Wang, H., Gupta, D., Li, X., Dziarski, R.
(2005). Peptidoglycan Recognition Protein 2 (N-Acetylmuramoyl-L-Ala Amidase) Is Induced in Keratinocytes by Bacteria through the p38 Kinase Pathway. Infect. Immun.
73: 7216-7225
[Abstract][Full Text]
Takahashi, N., Akahoshi, M., Matsuda, A., Ebe, K., Inomata, N., Obara, K., Hirota, T., Nakashima, K., Shimizu, M., Tamari, M., Doi, S., Miyatake, A., Enomoto, T., Nakashima, H., Ikezawa, Z., Shirakawa, T.
(2005). Association of the IL12RB1 promoter polymorphisms with increased risk of atopic dermatitis and other allergic phenotypes. Hum Mol Genet
14: 3149-3159
[Abstract][Full Text]
Braff, M. H., Zaiou, M., Fierer, J., Nizet, V., Gallo, R. L.
(2005). Keratinocyte Production of Cathelicidin Provides Direct Activity against Bacterial Skin Pathogens. Infect. Immun.
73: 6771-6781
[Abstract][Full Text]
Tokumaru, S., Sayama, K., Shirakata, Y., Komatsuzawa, H., Ouhara, K., Hanakawa, Y., Yahata, Y., Dai, X., Tohyama, M., Nagai, H., Yang, L., Higashiyama, S., Yoshimura, A., Sugai, M., Hashimoto, K.
(2005). Induction of Keratinocyte Migration via Transactivation of the Epidermal Growth Factor Receptor by the Antimicrobial Peptide LL-37. J. Immunol.
175: 4662-4668
[Abstract][Full Text]
Niyonsaba, F., Ushio, H., Nagaoka, I., Okumura, K., Ogawa, H.
(2005). The Human {beta}-Defensins (-1, -2, -3, -4) and Cathelicidin LL-37 Induce IL-18 Secretion through p38 and ERK MAPK Activation in Primary Human Keratinocytes. J. Immunol.
175: 1776-1784
[Abstract][Full Text]
Gombart, A. F., Borregaard, N., Koeffler, H. P.
(2005). Human cathelicidin antimicrobial peptide (CAMP) gene is a direct target of the vitamin D receptor and is strongly up-regulated in myeloid cells by 1,25-dihydroxyvitamin D3. FASEB J.
19: 1067-1077
[Abstract][Full Text]
Rieg, S., Steffen, H., Seeber, S., Humeny, A., Kalbacher, H., Dietz, K., Garbe, C., Schittek, B.
(2005). Deficiency of Dermcidin-Derived Antimicrobial Peptides in Sweat of Patients with Atopic Dermatitis Correlates with an Impaired Innate Defense of Human Skin In Vivo. J. Immunol.
174: 8003-8010
[Abstract][Full Text]
Nagai, A., Sato, T., Akimoto, N., Ito, A., Sumida, M.
(2005). Isolation and Identification of Histone H3 Protein Enriched in Microvesicles Secreted from Cultured Sebocytes. Endocrinology
146: 2593-2601
[Abstract][Full Text]
Miller, L. S., Sorensen, O. E., Liu, P. T., Jalian, H. R., Eshtiaghpour, D., Behmanesh, B. E., Chung, W., Starner, T. D., Kim, J., Sieling, P. A., Ganz, T., Modlin, R. L.
(2005). TGF-{alpha} Regulates TLR Expression and Function on Epidermal Keratinocytes. J. Immunol.
174: 6137-6143
[Abstract][Full Text]
Bowdish, D. M. E., Davidson, D. J., Scott, M. G., Hancock, R. E. W.
(2005). Immunomodulatory Activities of Small Host Defense Peptides. Antimicrob. Agents Chemother.
49: 1727-1732
[Abstract][Full Text]
Sorensen, O. E., Thapa, D. R., Rosenthal, A., Liu, L., Roberts, A. A., Ganz, T.
(2005). Differential Regulation of {beta}-Defensin Expression in Human Skin by Microbial Stimuli. J. Immunol.
174: 4870-4879
[Abstract][Full Text]
Iimura, M., Gallo, R. L., Hase, K., Miyamoto, Y., Eckmann, L., Kagnoff, M. F.
(2005). Cathelicidin Mediates Innate Intestinal Defense against Colonization with Epithelial Adherent Bacterial Pathogens. J. Immunol.
174: 4901-4907
[Abstract][Full Text]
Bowdish, D. M. E., Davidson, D. J., Lau, Y. E., Lee, K., Scott, M. G., Hancock, R. E. W.
(2005). Impact of LL-37 on anti-infective immunity. J. Leukoc. Biol.
77: 451-459
[Abstract][Full Text]
Sahl, H.-G., Pag, U., Bonness, S., Wagner, S., Antcheva, N., Tossi, A.
(2005). Mammalian defensins: structures and mechanism of antibiotic activity. J. Leukoc. Biol.
77: 466-475
[Abstract][Full Text]
van Wetering, S., Tjabringa, G. S., Hiemstra, P. S.
(2005). Interactions between neutrophil-derived antimicrobial peptides and airway epithelial cells. J. Leukoc. Biol.
77: 444-450
[Abstract][Full Text]
Harder, J., Schroder, J.-M.
(2005). Psoriatic scales: a promising source for the isolation of human skin-derived antimicrobial proteins. J. Leukoc. Biol.
77: 476-486
[Abstract][Full Text]
Braff, M. H., Hawkins, M. A., Nardo, A. D., Lopez-Garcia, B., Howell, M. D., Wong, C., Lin, K., Streib, J. E., Dorschner, R., Leung, D. Y. M., Gallo, R. L.
(2005). Structure-Function Relationships among Human Cathelicidin Peptides: Dissociation of Antimicrobial Properties from Host Immunostimulatory Activities. J. Immunol.
174: 4271-4278
[Abstract][Full Text]
Lee, P. H. A., Ohtake, T., Zaiou, M., Murakami, M., Rudisill, J. A., Lin, K. H., Gallo, R. L.
(2005). From The Cover: Expression of an additional cathelicidin antimicrobial peptide protects against bacterial skin infection. Proc. Natl. Acad. Sci. USA
102: 3750-3755
[Abstract][Full Text]
Sieprawska-Lupa, M., Mydel, P., Krawczyk, K., Wojcik, K., Puklo, M., Lupa, B., Suder, P., Silberring, J., Reed, M., Pohl, J., Shafer, W., McAleese, F., Foster, T., Travis, J., Potempa, J.
(2004). Degradation of Human Antimicrobial Peptide LL-37 by Staphylococcus aureus-Derived Proteinases. Antimicrob. Agents Chemother.
48: 4673-4679
[Abstract][Full Text]
Nordahl, E. A., Rydengard, V., Nyberg, P., Nitsche, D. P., Morgelin, M., Malmsten, M., Bjorck, L., Schmidtchen, A.
(2004). Activation of the complement system generates antibacterial peptides. Proc. Natl. Acad. Sci. USA
101: 16879-16884
[Abstract][Full Text]
Levy, O.
(2004). Antimicrobial proteins and peptides: anti-infective molecules of mammalian leukocytes. J. Leukoc. Biol.
76: 909-925
[Abstract][Full Text]
Werthen, M., Davoudi, M., Sonesson, A., Nitsche, D. P., Morgelin, M., Blom, K., Schmidtchen, A.
(2004). Pseudomonas aeruginosa-induced infection and degradation of human wound fluid and skin proteins ex vivo are eradicated by a synthetic cationic polymer. J Antimicrob Chemother
54: 772-779
[Abstract][Full Text]
DeBoer, D. J.
(2004). Canine Atopic Dermatitis: New Targets, New Therapies. J. Nutr.
134: 2056S-2061S
[Abstract][Full Text]
Yan, A. C.
(2004). Innate Skin Defenses: Antimicrobial Peptides May Protect the Nail Unit from Infection. AAP Grand Rounds
12: 10-11
[Full Text]
Murakami, M., Lopez-Garcia, B., Braff, M., Dorschner, R. A., Gallo, R. L.
(2004). Postsecretory Processing Generates Multiple Cathelicidins for Enhanced Topical Antimicrobial Defense. J. Immunol.
172: 3070-3077
[Abstract][Full Text]
Rosenberger, C. M., Gallo, R. L., Finlay, B. B.
(2004). Interplay between antibacterial effectors: A macrophage antimicrobial peptide impairs intracellular Salmonella replication. Proc. Natl. Acad. Sci. USA
101: 2422-2427
[Abstract][Full Text]
Howell, M. D., Jones, J. F., Kisich, K. O., Streib, J. E., Gallo, R. L., Leung, D. Y. M.
(2004). Selective Killing of Vaccinia Virus by LL-37: Implications for Eczema Vaccinatum. J. Immunol.
172: 1763-1767
[Abstract][Full Text]
Davidson, D. J., Currie, A. J., Reid, G. S. D., Bowdish, D. M. E., MacDonald, K. L., Ma, R. C., Hancock, R. E. W., Speert, D. P.
(2004). The Cationic Antimicrobial Peptide LL-37 Modulates Dendritic Cell Differentiation and Dendritic Cell-Induced T Cell Polarization. J. Immunol.
172: 1146-1156
[Abstract][Full Text]
Zanetti, M.
(2004). Cathelicidins, multifunctional peptides of the innate immunity. J. Leukoc. Biol.
75: 39-48
[Abstract][Full Text]
Tjabringa, G. S., Aarbiou, J., Ninaber, D. K., Drijfhout, J. W., Sorensen, O. E., Borregaard, N., Rabe, K. F., Hiemstra, P. S.
(2003). The Antimicrobial Peptide LL-37 Activates Innate Immunity at the Airway Epithelial Surface by Transactivation of the Epidermal Growth Factor Receptor. J. Immunol.
171: 6690-6696
[Abstract][Full Text]
Nomura, I., Goleva, E., Howell, M. D., Hamid, Q. A., Ong, P. Y., Hall, C. F., Darst, M. A., Gao, B., Boguniewicz, M., Travers, J. B., Leung, D. Y. M.
(2003). Cytokine Milieu of Atopic Dermatitis, as Compared to Psoriasis, Skin Prevents Induction of Innate Immune Response Genes. J. Immunol.
171: 3262-3269
[Abstract][Full Text]
Di Nardo, A., Vitiello, A., Gallo, R. L.
(2003). Cutting Edge: Mast Cell Antimicrobial Activity Is Mediated by Expression of Cathelicidin Antimicrobial Peptide. J. Immunol.
170: 2274-2278
[Abstract][Full Text]
Fellermann, K., Wehkamp, J., Stange, E. F., Gallo, R. L., Leung, D. Y.M., Zasloff, M.
(2003). Antimicrobial Peptides in the Skin. NEJM
348: 361-363
[Full Text]
Liu, L., Roberts, A. A., Ganz, T.
(2003). By IL-1 Signaling, Monocyte-Derived Cells Dramatically Enhance the Epidermal Antimicrobial Response to Lipopolysaccharide. J. Immunol.
170: 575-580
[Abstract][Full Text]