Abstract

Full Text

Supplement to Moreno JC et al. Inactivating Mutations in the Gene for Thyroid Oxidase 2 (THOX2) and Congenital Hypothyroidism. N Engl J Med 2002;347:95-102.

Supplementary Appendix I: Detection of Mutations in the THOX2 Gene

Oligonucleotide Sequences

Primer sequences are given in the 5' to 3' direction. For sequencing purposes, the M13 forward sequence (tgtaaaacgacggccagt) and the M13 reverse sequence (caggaaacagctatgacc) were respectively attached to the following forward and reverse primers: exon 1: forward primer, tggcgtttggatgaaggt, and reverse primer, agggatcctggggaacac; exon 2: forward primer, gtagctgggagcgtagtgct, and reverse primer, gtgttccccgcagattcc; exon 3: forward primer, aggcttagggagaggtttgg, and reverse primer, cagatcaaccccactggtct; exon 4: forward primer, tacggacggtttgtcacg, and reverse primer, cgcctctcccctccag; exon 5: forward primer, ctcgacccgggctcac, and reverse primer, gtggcctcaccgtacagc; exon 6: forward primer, cagaaccccctgctcatgt, and reverse primer, gagtctcccgtgggcttg; exons 7 and 8: forward primer, gggctcagacccttccag, and reverse primer, gcagctcattctgcaccttt; exons 9 and 10: forward primer, actgagtccctcagcccact, and reverse primer, gcttcctggtcccttaccat; exon 11: forward primer, gtagccaggagggaagaa, and reverse primer, tgtcatcagtaaaatggggaaa; exon 12: forward primer, gagggatggggcaacagt, and reverse primer, aggctgaggagcagtctgag; exon 13: forward primer, cttcccatcccagtgacttc, and reverse primer, gcaccctcaatcttgatcct; exons 14 and 15: forward primer, aagaggtctggccacatagc, and reverse primer, ttctcccagactcctgtctctc; exon 16: forward primer, ctggggacatctgctgaact, and reverse primer, gtggcctcgcttgtgataat; exon 17: forward primer, caacccaagatccattgagg, and reverse primer, ttctatgcagcccaggtttc; exons 18 and 19: forward primer, gcttccagcataggcttcac, and reverse primer, ctggacctgttttcctgtttg; exon 20: forward primer, acctacccaagcctgacctt, and reverse primer, cccaccaggaactctcattt; exon 21: forward primer, ggaagccagtcctgcctctt, and reverse primer, gccagtcctactcccttcatt; exon 22: forward primer, gttctcctggctgcaaagac, and reverse primer, gatatgtgggtggggccta; exon 23: forward primer, atggagtggcattaagggaag, and reverse primer, tcttaggatcagagggctttcc; exon 24: forward primer, cctgtgccaagctgatgtaa, and reverse primer, gctgcagcaaagaggaagaa; exon 25: forward primer, agtctgtcctggttggcatc, and reverse primer, caccctatgagtcccaggag; exon 26: forward primer, gctggagcccctcct, and reverse primer, gaccccatggccagtataga; exons 27 and 28: forward primer, cccaagctgaagtcctgaga, and reverse primer, tgaagatttggcctctgtcg; exon 29: forward primer, gagcacgccttctcatctgt, and reverse primer, atagggaagggcagagatcc; exon 30: forward primer, cagggtcaggctcatttcat, and reverse primer, gtcacaattcggccacctat; exons 31 and 32: forward primer, gaactgagctgggtcctgat, and reverse primer, gcaggagaaggccagagtc; exon 33: forward primer, aggctcaggaagcagctttt, and reverse primer, gcacagaagagaaggcagga.

Polymerase Chain Reaction

We used Amplitaq Gold (Perkin–Elmer) to amplify exons from genomic DNA, according to the manufacturer's instructions and using the following program: 39 cycles of predenaturation at 95°C for 8 minutes, denaturation at 95°C for 1 minute, annealing at 60°C for 1 minute, and extension at 72°C for 1 minute, followed by an additional period of extension for 10 minutes at 72°C.

Denatured High-Performance Liquid Chromatography Conditions

We used the Melt3 program (Stanford University) to calculate melting conditions. We used two melting temperatures for most polymerase-chain-reaction products: the one recommended by the Melt3 program and one that was 1° or 2°C higher.


	Abstract
	Full Text

Comments and questions? Please contact us.