Response to Imatinib Mesylate in Patients with Chronic Myeloproliferative Diseases with Rearrangements of the Platelet-Derived Growth Factor Receptor Beta
Jane F. Apperley, M.D., Martine Gardembas, M.D., Junia V. Melo, M.D., Robin Russell-Jones, M.D., Barbara J. Bain, M.D., E. Joanna Baxter, Ph.D., Andrew Chase, Ph.D., Judith M. Chessells, M.D., Marie Colombat, Ph.D., Claire E. Dearden, M.D., Sasa Dimitrijevic, Ph.D., François-X. Mahon, M.D., David Marin, M.D., Zariana Nikolova, M.D., Eduardo Olavarria, M.D., Sandra Silberman, M.D., Beate Schultheis, M.D., Nicholas C.P. Cross, Ph.D., and John M. Goldman, D.M.
Background A small proportion of patients with chronic myeloproliferativediseases have constitutive activation of the gene for platelet-derivedgrowth factor receptor beta (PDGFRB), which encodes a receptortyrosine kinase. The gene is located on chromosome 5q33, andthe activation is usually caused by a t(5;12)(q33;p13) translocationassociated with an ETV6-PDGFRB fusion gene. The tyrosine kinaseinhibitor imatinib mesylate specifically inhibits ABL, PDGFR,and KIT kinases and has impressive clinical efficacy in BCR-ABL–positivechronic myeloid leukemia.
Methods We treated four patients who had chronic myeloproliferativediseases and chromosomal translocations involving 5q33 withimatinib mesylate (400 mg daily). Three of the four patientspresented with leukocytosis and eosinophilia; their leukemiacells carried the ETV6-PDGFRB fusion gene. The fourth patienthad leukocytosis, eosinophilia, and a t(5;12) translocationinvolving PDGFRB and an unknown partner gene; he also had extensiveraised, ulcerated skin lesions that had been present for a longtime.
Results In all four patients, a normal blood count was achievedwithin four weeks after treatment began. In the patient withskin disease, the lesions began to resolve shortly after treatmentbegan. The t(5;12) translocation was undetectable by 12 weeksin three patients and by 36 weeks in the fourth patient. Inthe three patients with the ETV6-PDGFRB fusion gene, the transcriptlevel decreased, and in one patient, it became undetectableby 36 weeks. All responses were durable at 9 to 12 months offollow-up.
Conclusions Imatinib mesylate induces durable responses in patientswith chronic myeloproliferative diseases associated with activationof PDGFRB.
The association of leukemia, eosinophilia, and abnormalitiesof chromosome 12p13 was originally reported by Keene et al.in 19871; two of the four patients included in that report alsohad translocations involving chromosome 5q3. Subsequently, Golubet al.2 showed that the previously described t(5;12)(q31–q33;p13)chromosomal abnormality, characteristic of some cases of chronicmyelomonocytic leukemia, was associated with a fusion gene linkingTEL (now known as ETV6) with platelet-derived growth factorreceptor beta (PDGFRB). At least 34 cases of chronic myeloproliferativedisease associated with a t(5;12)(q31–q33;p13) translocationhave now been reported,3 and the PDGFRB gene is known to berearranged in some of these cases. There are also additionalcases involving translocations of the PDGFRB-containing regionof chromosome 5 — that is, 5q31–q35 — andchromosomal partners other than 12p13.4,5,6 All these leukemias,although heterogeneous, have some common features — mostnotably, the frequent presence of eosinophilia in peripheralblood and bone marrow.
Imatinib mesylate (formerly STI571; now Gleevec in the UnitedStates and Glivec in Europe [Novartis]) is a 2-phenylaminopyrimidinecompound based on a candidate molecule designed specificallyto interact with the ATP-binding site of protein tyrosine kinases.Imatinib specifically inhibits the kinase activity of ABL (includingBCR-ABL), PDGFRB, and c-KIT. Recently, this compound has shownefficacy in the treatment of chronic myeloid leukemia7,8,9 andgastrointestinal stromal tumors.10
We report here the results of imatinib treatment in four patientswith chronic myeloproliferative diseases characterized by leukocytosis,peripheral-blood eosinophilia, and molecular rearrangementsinvolving the PDGFRB gene. Normal peripheral-blood counts andnormal appearances of bone marrow were restored in all patients,and the cytogenetic abnormalities resolved.
Case Reports
Patients 1, 2, and 3
Patients 1, 2, and 3 were men 32, 50, and 68 years of age, respectively,who presented with leukocytosis, mild anemia, and eosinophilia(Table 1). Bone marrow aspirates and trephine biopsies showedhypercellularity with left-shifted myeloid series and an increasein the numbers of immature and mature eosinophils. Patient 1was initially treated with hydroxyurea for 16 months until thedisease progressed, as evidenced by a rising white-cell countand increasing splenomegaly. Pipobroman and interferon alfafailed to control the white-cell count and induced thrombocytopenia.Treatment with imatinib at a dose of 400 mg daily was begun48 months after diagnosis. Patients 2 and 3 received no treatmentuntil they began treatment with imatinib (400 mg daily) 9 and12 months after diagnosis, respectively.
Table 1. Clinical and Hematologic Characteristics of Four Patients with PDGFRB-Positive Leukemias.
Patient 4
Patient 4 was a six-year-old boy who presented in 1987 witha generalized erythematous rash and eosinophilia. Skin biopsyshowed a dermal infiltrate of eosinophils and atypical histiocytesthat varied in size and nuclear morphology, with sparing ofthe epidermis and cutaneous appendages. There were no Birbeckgranules, and a diagnosis of non-X histiocytosis was made. Overthe course of the next two years, the skin condition progressedand raised, infiltrative lesions developed. The appearance ofthe bone marrow was consistent with a myeloproliferative disease,with hypercellularity and an increased number of eosinophilsbut without the atypical histiocytes that were present in theskin. Cytogenetic analysis revealed a t(5;12)(q33;q13) translocationin 25 percent of the cells in metaphase. The skin conditionand hematologic abnormalities failed to respond to corticosteroidsor hydroxyurea, and two years of therapy with interferon alfaprovided only minimal benefit. By October 2000, when the patientwas 19 years old, 90 percent of the surface of the skin wasinvolved, with disfiguring plaques, nodules, and tumors (Figure 1A).Extensive areas of ulceration developed on the trunk andlimbs. Hydroxyurea was recommenced in December 2000, withoutbenefit. Repeated hospitalizations became necessary for controlof pain and skin infection and for surgical débridement.Skin biopsies again showed an infiltrate of atypical histiocytesand numerous eosinophils, with surface ulceration. In March2001 the patient began receiving imatinib at a dose of 400 mgdaily.
Figure 1. Patient 4 at the Beginning of Imatinib Therapy (Panel A) and after Eight Months of Therapy (Panel B).
Methods
Study Design
The Novartis STIB2225 study was designed by the investigatorsand representatives of the study sponsor, Novartis. It was aphase 2 study of STI571 (now called imatinib mesylate) in patientswith life-threatening diseases known to be associated with oneor more STI571-sensitive tyrosine kinases. The two patientsdescribed here are the only two patients with 5q33 abnormalities.The data presented here were collected, interpreted, and analyzedby the academic investigators, who also wrote the article incollaboration with representatives of Novartis.
Cytogenetic Analysis and Fluorescence in Situ Hybridization
Cytogenetic analysis of bone marrow cells was performed by conventionalG-banding. Two-color fluorescence in situ hybridization forthe PDGFRB rearrangement was performed in Patients 2 and 4 withtwo flanking cosmid probes for chromosome 5, 9-4 and 4-1, aspreviously described.5 A total of 100 cells in interphase werescored.
Identification of ETV6-PDGFRB Fusion Transcript
RNA was reverse-transcribed and tested for the ETV6-PDGFRB fusionby single-step reverse-transcriptase polymerase chain reaction(RT-PCR) (limit of detection, 10–2) and hemi-nested RT-PCR(limit of detection, 10–5). Single-step PCR was performedfor 30 cycles at an annealing temperature of 60°C with theuse of primers ETV6-J (TTCACCATTCTTCCACCCTGGA) and PD-F (TTGACGGCCACTTTCATCGT).For hemi-nested PCR, the products of this reaction were amplifiedwith primers ETV6-J and PD-C (TGGCTTCTTCTGCCAAAGCA) for 30 cyclesat an annealing temperature of 64°C.
In Vitro Studies of Sensitivity to Imatinib
Peripheral-blood specimens were obtained from Patients 2 and4; cells from leukaphereses performed in five patients withPhiladelphia (Ph) chromosome–positive chronic myelogenousleukemia in chronic phase and cells from leukaphereses or bonemarrow from three healthy donors were used as controls. Allspecimens were obtained with the written or oral informed consentof the donors. Mononuclear cells were cultured in RPMI 1640medium supplemented with 10 percent fetal-calf serum, 2 percentL-glutamine, and 2 percent penicillin–streptomycin. Underthese conditions (without additional cytokines), there is noproliferation or differentiation of either normal or leukemiccells. Specimens were cultured (1 million cells per milliliter)in the presence or absence of 1 µm of imatinib and weremonitored by trypan blue staining for cell viability every twodays.
Results
Cytogenetic Analysis and Fluorescence in Situ Hybridization
All the bone marrow cells in metaphase that we examined fromPatients 1, 2, and 3 contained the t(5;12)(q33;p13) translocation.Before treatment with imatinib, 5 of 10 cells in metaphase fromPatient 4 (50 percent) contained t(5;12)(q33;q13). Two-colorfluorescence in situ hybridization performed on cells from Patients2 and 4 showed one fused signal and separate red and green signalsin more than 80 percent of the cells from each patient, indicatingdisruption of PDGFRB (Figure 2). More than 95 percent of thenormal control cells had two fused signals.
Figure 2. Two-Color Fluorescence in Situ Hybridization of Cells from Patient 2, with Schematic Representation of Chromosomes 5 and 12 Indicating the Break Points of t(5;12)(q33;p13).
Cells in interphase were probed with two flanking cosmid probes for chromosome 5, 9-4 and 4-1.5 More than 80 percent of cells showed one fused signal and separate red and green signals, indicating disruption of the PDGFRB gene. Arrows indicate break points.
Identification of the ETV6-PDGFRB Fusion Transcript
RT-PCR to detect the ETV6-PDGFRB fusion gene was performed onbone marrow, blood, or both from all patients. Before treatment,products of the expected size were detected in RNA from Patients1, 2, and 3 by both single-step (395-bp) and hemi-nested (174-bp)RT-PCR techniques (data not shown). These products were notdetected in the RNA of Patient 4, in whom an unknown gene at12q13 is presumably fused to PDGFRB.
Analysis of in Vitro Sensitivity to Imatinib
Mononuclear cells from Patients 2 and 4 were shown to be sensitiveto in vitro treatment with imatinib. The survival of normalmononuclear cells was virtually unaffected by culture with 1µm of imatinib for at least 2 weeks, whereas only 40 percentof cells from Patient 4 were viable by that time, and 100 percentof cells from Patient 2 were dead by the 12th day of culture.The average sensitivity to imatinib of cells from a patientwith Ph-positive chronic myelogenous leukemia was intermediatebetween those of the two patients with PDGFRB abnormalities(Figure 3).
Figure 3. Viability of Mononuclear Cells on Exposure to Imatinib.
The viability of cells from Patients 2 and 4 and from five patients with chronic myelogenous leukemia (CML) and three healthy persons on exposure to 1 mM of imatinib was compared with viability in paired, nonexposed control cultures.
Clinical Outcome
Patients 1, 2, and 3 began treatment with imatinib at a doseof 400 mg daily; Patient 2 was treated within the Novartis STIB2225study. In Patients 2 and 3, the blood count normalized (withresolution of eosinophilia) within one week. After 12 weeks,30 of 30 cells in metaphase from Patient 2 and 50 of 50 cellsin metaphase from Patient 3 were cytogenetically normal. Asof this writing, and after 15 months of therapy in Patient 2and 12 months of therapy in Patient 3, the appearance of bonemarrow aspirate is normal, with eosinophils and their precursorscomprising less than 5 percent of nucleated cells. Fluorescencein situ hybridization of bone marrow cells obtained from Patient2 after nine months of therapy showed that 27 of 200 cells (14percent) had one fused signal. Peripheral-blood cells obtainedafter six months of therapy (from both patients) and after ninemonths of therapy (from Patient 2) tested negative by single-stepRT-PCR and positive by the heminested technique. Cells fromPatient 2 were negative by both techniques at 12 months.
In Patient 1, the white-cell count normalized within four weeksafter the start of treatment, although the platelet count waslow, at 68,000 per cubic millimeter. The blood count and bonemarrow morphology were normal by 12 weeks. The proportion ofcells in metaphase containing a t(5;12)(q31–q33;p13) translocationgradually decreased, and cells from Patient 1 became cytogeneticallynormal at nine months. He continues to receive imatinib at adose of 400 mg daily without side effects 13 months after thestart of therapy.
Within five days after imatinib treatment began in Patient 4in the Novartis STIB2225 study, the white-cell count and theeosinophil count had normalized. The skin lesions became flatterand less erythematous, and the ulcerated areas began to granulate;autologous and cadaveric skin grafts were applied to the rightwrist, right lower leg, anterior chest wall, and back in orderto speed recovery. After four weeks of treatment, cytogeneticanalysis of 50 cells in metaphase showed that 100 percent hadthe 46,XY karyotype, with no evidence of the t(5;12) abnormality.However, the thrombocytosis persisted, and bone marrow aspirateobtained after eight weeks of therapy remained hypercellular,although the eosinophilic component had decreased to 6 percent.The dose of imatinib was therefore gradually increased to 800mg daily, and the appearance of the bone marrow at 20 weekswas normal. Skin biopsies after 20 weeks of treatment showedxanthomatized cells within the middle dermis. There were noatypical histiocytes or eosinophils. After 15 months of imatinibtreatment, the patient is well and free of side effects (Figure 1B).Fluorescence in situ hybridization analysis of bone marrowcells obtained at 12 months showed two fused signals in morethan 95 percent of cells — equivalent to the proportionin normal control cells.
Discussion
We have used imatinib mesylate to treat four patients with chromosomalrearrangements involving PDGFRB. All had prompt responses, withnormalization of the blood count, disappearance of eosinophilia,resolution of cytogenetic abnormalities, a decrease in or disappearanceof fusion transcripts, and in one case, healing of long-standingskin lesions.
The platelet-derived growth factor (PDGF) family includes atleast five dimeric forms (PDGF AA, PDGF AB, PDGF BB, PDGF CC,and PDGF DD).11,12,13,14 The PDGF dimers activate the receptorsspecific for PDGF- (PDGFRA) and PDGF- (PDGFRB), thereby stimulatingthe proliferation and migration of mesenchymal cells. PDGFRAand PDGFRB belong to type III–receptor tyrosine kinasefamilies and are characterized by five immunoglobulin-like domainsin the extracellular region, a transmembrane domain, an ATP-bindingsite, and a hydrophilic kinase insert domain in the intracellularportion.15,16 Ligand binding to these receptors results in dimerizationof the subunits of the receptor, followed by the activationof the tyrosine kinase domain and autophosphorylation. The resultingphosphotyrosines act as docking sites for intracellular signalingproteins,11,17 and signaling through PDGFRB plays an importantpart in mitogenesis, cytoskeletal rearrangements, and chemotaxis.
The PDGFRB fusion proteins that result from the various chromosomaltranslocations can no longer be activated by PDGF, since theydo not contain the ligand-binding domain. Instead, the fusionproteins are constitutively active and can transform interleukin-3–dependentcell lines into growth factor–independent cell lines.Furthermore, the ETV6-PDGFRB and RAB5-PDGFRB fusion proteinsinduce myeloproliferative diseases in mice.6,18,19 It is likelythat the partner genes encode a specific dimerization motifthat enables the fusion protein to self-associate, mimickingthe normal process of receptor activation after ligand binding.
Imatinib is a tyrosine kinase inhibitor that shows specificityat the submicromolar level for ABL, PDGFR, and KIT kinases.It inhibits ligand-stimulated PDGFR tyrosine phosphorylationat a 50 percent inhibitory concentration (IC50) of 0.3 µmolper liter, which is similar to the IC50 for ABL.20 The IC50of imatinib for the proliferation of cell lines expressing ETV6-ABLis 0.35 µmol per liter, and the IC50 for the proliferationof cell lines expressing ETV6-PDGFRB is 0.15 µmol perliter, indicating that the potency of the drug against ABL andPDGFRB is equivalent.21 Furthermore, the ability of imatinibto inhibit the growth of cell lines transformed by RAB5-PDGFRBand to reverse the leukemic phenotype in a mouse model of ETV6-PDGFRBtransformation suggested that this agent might be effectivein the treatment of patients with PDGFRB rearrangements.22,23
The four patients with myeloproliferative diseases describedhere all had a t(5;12) translocation and involvement of thePDGFRB gene. The phenotypes of their diseases were similar insome ways but also had important differences. Patients 1, 2,and 3 presented with peripheral-blood leukocytosis, eosinophilia,an appearance of bone marrow compatible with myeloproliferativediseases, and the well-described ETV6-PDGFRB fusion gene. Patient4 was more unusual, in that he presented at the age of six yearswith cutaneous involvement, peripheral-blood eosinophilia, myelodysplasia,and myeloproliferation. This patient was described previously,when the eosinophilia was thought to be reactive because theeosinophils apparently lacked the t(5;12) translocation.24 Overthe course of the next 14 years, disfiguring skin disease thatwas unresponsive to hydroxyurea and interferon alfa was thepredominant feature in Patient 4. We remain uncertain whetherthe cutaneous infiltrates were reactive or were in fact a manifestationof the myeloproliferative disease. However, the strong and rapidresponse to imatinib suggests a direct relation between thePDGFRB oncoprotein and the mechanism responsible for the cutaneousinfiltration. Although Patient 4 has no ETV6 rearrangement andthe PDGFRB partner gene has not been identified, it is likelythat an activated PDGFRB oncoprotein is responsible for theclinical phenotype.
We have recently reviewed the clinical features of Ph-negativemyeloproliferative diseases with translocations of 5q31–35.3The literature includes 34 patients with the classic t(5;12)(q31–33;p13)translocation, although in some cases, involvement of PDGFRB,ETV6 (TEL), or both was not demonstrated. The majority of patientswere male and had peripheral-blood eosinophilia, monocytosis,and splenomegaly. A number of patients had progression to blastictransformation, and the two-year survival rate among the 18patients who could be evaluated was only 55 percent. An additional20 patients with reciprocal translocations involving 5q31–q35but not 12p13 were also described. The phenotypes in this groupwere more diverse, but certain similarities persisted; all 11patients who could be evaluated had peripheral-blood eosinophilia.In our series, Patients 1, 2, and 3 had the typical featuresof the t(5;12) myeloproliferative diseases.
Eosinophilia is a prominent but not invariable feature of transformationinduced by the PDGFRB oncoprotein. A number of genes that areimportant in the proliferation and differentiation of eosinophilsare found in the same 5q31–q35 chromosomal region, includinginterleukin-3, interleukin-4, interleukin-5, and interleukin-13and granulocyte–macrophage colony-stimulating factor.It is possible that these genes are dysregulated in the translocationprocess. Furthermore, studies of linkage disequilibrium in afamily with familial eosinophilia confirmed the importance of5q31–q35 in this rare condition25; there were no mutationsin the genes for interleukin-3, interleukin-5, and granulocyte–macrophagecolony-stimulating factor, but the PDGFRB gene was not studied.Thus, activation of PDGFRB could underlie the eosinophilia inthe patients described here, but the precise mechanism remainsunknown. Recently, Gleich et al. reported that four of fivepatients with hypereosinophilic syndrome and normal findingson cytogenetic analysis had a prompt response to imatinib withresolution of peripheral-blood eosinophilia.26 The PDGFRB genewas not studied. The absence of a response in the fifth patientwas associated with an elevated interleukin-5 level, perhapssuggesting an alternative mechanism of eosinophilia in thispatient. Interleukin-5 levels were considerably elevated inPatient 4 in our series (data not shown), but this elevationdid not interfere with the response to imatinib.
Supported by Novartis Pharmaceuticals, Basel, Switzerland, andby the Leukaemia Research Fund, United Kingdom.
We are indebted to Dr. Bridget Wilkins for performing immunophenotypingstudies in Patient 4 and to Dr. Elisabeth Buchdunger (NovartisPharma, Basel, Switzerland) for providing imatinib for the laboratorystudies.
Source Information
From the Department of Haematology, Faculty of Medicine, Imperial College, London (J.F.A., J.V.M., B.J.B., D.M., E.O., B.S., J.M.G.); the Department of Hematology, Centre Hospitalier Universitaire Angers, Angers, France (M.G.); the Skin Tumour Unit, St. John's Institute of Dermatology, St. Thomas' Hospital, London (R.R.-J.); Wessex Regional Genetics Laboratory, Salisbury District Hospital, Salisbury, United Kingdom (E.J.B., A.C., N.C.P.C.); the Department of Haematology, Great Ormond Street Hospital for Children, London (J.M.C.); the Department of Hematology, Centre Hospitalier Universitaire Bordeaux, Pessac, France (M.C., F.-X.M.); the Department of Haematology, St. George's Hospital, London (C.E.D.); and Novartis Oncology, Basel, Switzerland (S.D., Z.N., S.S.).
Address reprint requests to Prof. Apperley at the Department of Haematology, Faculty of Medicine, Imperial College of Science, Technology and Medicine, Hammersmith Hospital, Du Cane Rd., London W12 0NN, United Kingdom, or at j.apperley{at}ic.ac.uk.
References
Keene P, Mendelow B, Pinto MR, et al. Abnormalities of chromosome 12p13 and malignant proliferation of eosinophils: a nonrandom association. Br J Haematol 1987;67:25-31. [Medline]
Golub TR, Barker GF, Lovett M, Gilliland DG. Fusion of PDGF receptor beta to a novel ets-like gene, tel, in chronic myelomonocytic leukemia with t(5;12) chromosomal translocation. Cell 1994;77:307-316. [CrossRef][Web of Science][Medline]
Steer EJ, Cross NCP. Myeloproliferative disorders with translocations of chromosome 5q31-35: role of the platelet-derived growth factor receptor beta. Acta Haematol 2002;107:113-122. [CrossRef][Web of Science][Medline]
Ross TS, Bernard OA, Berger R, Gilliland DG. Fusion of Huntingtin interacting protein 1 to platelet-derived growth factor beta receptor (PDGFbetaR) in chronic myelomonocytic leukemia with t(5;7)(q33;q11.2). Blood 1998;91:4419-4426. [Free Full Text]
Kulkarni S, Heath C, Parker S, et al. Fusion of H4/D10S170 to the platelet-derived growth factor receptor beta in BCR-ABL-negative myeloproliferative disorders with a t(5;10)(q33;q21). Cancer Res 2000;60:3592-3598. [Free Full Text]
Magnusson MK, Meade KE, Brown KE, et al. Rabaptin-5 is a novel fusion partner to platelet-derived growth factor receptor in chronic myelomonocytic leukemia. Blood 2001;98:2518-2525. [Free Full Text]
Druker BJ, Tamura S, Buchdunger E, et al. Effects of a selective inhibitor of the Abl tyrosine kinase on the growth of Bcr-Abl positive cells. Nat Med 1996;2:561-566. [CrossRef][Web of Science][Medline]
Druker BJ, Talpaz M, Resta DJ, et al. Efficacy and safety of a specific inhibitor of the BCR-ABL tyrosine kinase in chronic myeloid leukemia. N Engl J Med 2001;344:1031-1037. [Free Full Text]
Druker BJ, Sawyers CL, Kantarjian H, et al. Activity of a specific inhibitor of the BCR-ABL tyrosine kinase in the blast crisis of chronic myeloid leukemia and acute lymphoblastic leukemia with the Philadelphia chromosome. N Engl J Med 2001;344:1038-1042. [Erratum, N Engl J Med 2001;345:232.] [Free Full Text]
Joensuu H, Roberts PJ, Sarlomo-Rikala M, et al. Effect of the tyrosine kinase inhibitor STI571 in a patient with a metastatic gastrointestinal stromal tumor. N Engl J Med 2001;344:1052-1056. [Free Full Text]
Claesson-Welsh L. Platelet-derived growth factor receptor signals. J Biol Chem 1994;269:32023-32026. [Free Full Text]
Li X, Ponten A, Aase K, et al. PDGF-C is a new protease-activated ligand for the PDGF alpha-receptor. Nat Cell Biol 2000;2:302-309. [CrossRef][Web of Science][Medline]
Bergsten E, Uutela M, Li X, et al. PDGF-D is a specific, protease-activated ligand for the PDGF beta-receptor. Nat Cell Biol 2001;3:512-516. [CrossRef][Web of Science][Medline]
LaRochelle WJ, Jeffers M, McDonald WF, et al. PDGF-D, a new protease-activated growth factor. Nat Cell Biol 2001;3:517-521. [CrossRef][Web of Science][Medline]
Irusta PM, DiMaio D. A single amino acid substitution in a WW-like domain of diverse members of the PDGF receptor subfamily of tyrosine kinases causes constitutive receptor activation. EMBO J 1998;17:6912-6923. [CrossRef][Medline]
Reilly JT. Class III receptor tyrosine kinases: role in leukaemogenesis. Br J Haematol 2002;116:744-757. [CrossRef][Web of Science][Medline]
Heldin CH, Ostman A, Ronnstrand L. Signal transduction via platelet-derived growth factor receptors. Biochim Biophys Acta 1998;1378:F79-F113. [Medline]
Ritchie KA, Aprikyan AA, Bowen-Pope DF, et al. The Tel-PDGFRbeta fusion gene produces a chronic myeloproliferative syndrome in transgenic mice. Leukemia 1999;13:1790-1803. [CrossRef][Medline]
Tomasson MH, Sternberg DW, Williams IR, et al. Fatal myeloproliferation, induced in mice by TEL/PDGFbetaR expression, depends on PDGFbetaR tyrosines 579/581. J Clin Invest 2000;105:423-432. [Web of Science][Medline]
Buchdunger E, Cioffi CL, Law N, et al. Abl protein-tyrosine kinase inhibitor STI571 inhibits in vitro signal transduction mediated by c-kit and platelet-derived growth factor receptors. J Pharmacol Exp Ther 2000;295:139-145. [Free Full Text]
Carroll M, Ohno-Jones S, Tamura S, et al. CGP 57148, a tyrosine kinase inhibitor, inhibits the growth of cells expressing BCR-ABL, TEL-ABL, and TEL-PDGFR fusion proteins. Blood 1997;90:4947-4952. [Free Full Text]
Magnusson MK, Meade KE, Nakamura R, Barrett J, Dunbar CE. Molecular evidence for efficacy of STI-571 in chronic myelomonocytic leukemia (CMML) with a platelet-derived growth factor-receptor (PDGFR) fusion oncogene. Blood 2001;98:631a-631a. abstract.
Tomasson MH, Williams IR, Hasserjian R, et al. TEL/PDGFbetaR induces hematologic malignancies in mice that respond to a specific tyrosine kinase inhibitor. Blood 1999;93:1707-1714. [Free Full Text]
Jani K, Kempski HM, Reeves BR. A case of myelodysplasia with eosinophilia having a translocation t(5;12)(q31;q13) restricted to myeloid cells but not involving eosinophils. Br J Haematol 1994;87:57-60. [Web of Science][Medline]
Rioux JD, Stone VA, Daly MJ, et al. Familial eosinophilia maps to the cytokine gene cluster on human chromosomal region 5q31-q33. Am J Hum Genet 1998;63:1086-1094. [CrossRef][Web of Science][Medline]
Gleich GJ, Leiferman KM, Pardanani A, Tefferi A, Butterfield JH. Treatment of hypereosinophilic syndrome with imatinib mesylate. Lancet 2002;359:1577-1579. [CrossRef][Web of Science][Medline]
Thiele, J.
(2009). Philadelphia Chromosome-Negative Chronic Myeloproliferative Disease. Am J Clin Pathol
132: 261-280
[Abstract][Full Text]
Paulsson, J., Sjoblom, T., Micke, P., Ponten, F., Landberg, G., Heldin, C.-H., Bergh, J., Brennan, D. J., Jirstrom, K., Ostman, A.
(2009). Prognostic Significance of Stromal Platelet-Derived Growth Factor {beta}-Receptor Expression in Human Breast Cancer. Am. J. Pathol.
175: 334-341
[Abstract][Full Text]
Stone, R. M.
(2009). How I treat patients with myelodysplastic syndromes. Blood
113: 6296-6303
[Full Text]
Mukherjee, J., Kamnasaran, D., Balasubramaniam, A., Radovanovic, I., Zadeh, G., Kiehl, T.-R., Guha, A.
(2009). Human Schwannomas Express Activated Platelet-Derived Growth Factor Receptors and c-kit and Are Growth Inhibited by Gleevec (Imatinib Mesylate). Cancer Res.
69: 5099-5107
[Abstract][Full Text]
Ishii, T., Wang, J., Zhang, W., Mascarenhas, J., Hoffman, R., Dai, Y., Wisch, N., Xu, M.
(2009). Pivotal role of mast cells in pruritogenesis in patients with myeloproliferative disorders. Blood
113: 5942-5950
[Abstract][Full Text]
Menard, C., Blay, J.-Y., Borg, C., Michiels, S., Ghiringhelli, F., Robert, C., Nonn, C., Chaput, N., Taieb, J., Delahaye, N. F., Flament, C., Emile, J.-F., Le Cesne, A., Zitvogel, L.
(2009). Natural Killer Cell IFN-{gamma} Levels Predict Long-term Survival with Imatinib Mesylate Therapy in Gastrointestinal Stromal Tumor-Bearing Patients. Cancer Res.
69: 3563-3569
[Abstract][Full Text]
Druker, B. J.
(2008). Translation of the Philadelphia chromosome into therapy for CML. Blood
112: 4808-4817
[Abstract][Full Text]
Frohling, S., Dohner, H.
(2008). Chromosomal Abnormalities in Cancer. NEJM
359: 722-734
[Full Text]
Hexner, E. O., Serdikoff, C., Jan, M., Swider, C. R., Robinson, C., Yang, S., Angeles, T., Emerson, S. G., Carroll, M., Ruggeri, B., Dobrzanski, P.
(2008). Lestaurtinib (CEP701) is a JAK2 inhibitor that suppresses JAK2/STAT5 signaling and the proliferation of primary erythroid cells from patients with myeloproliferative disorders. Blood
111: 5663-5671
[Abstract][Full Text]
Andrae, J., Gallini, R., Betsholtz, C.
(2008). Role of platelet-derived growth factors in physiology and medicine. Genes Dev.
22: 1276-1312
[Abstract][Full Text]
Heinrich, M. C., Joensuu, H., Demetri, G. D., Corless, C. L., Apperley, J., Fletcher, J. A., Soulieres, D., Dirnhofer, S., Harlow, A., Town, A., McKinley, A., Supple, S. G., Seymour, J., Di Scala, L., van Oosterom, A., Herrmann, R., Nikolova, Z., McArthur, a. G., for the Imatinib Target Exploration Consortium Stu,
(2008). Phase II, Open-Label Study Evaluating the Activity of Imatinib in Treating Life-Threatening Malignancies Known to Be Associated with Imatinib-Sensitive Tyrosine Kinases. Clin. Cancer Res.
14: 2717-2725
[Abstract][Full Text]
Puttini, M., Redaelli, S., Moretti, L., Brussolo, S., Gunby, R. H, Mologni, L., Marchesi, E., Cleris, L., Donella-Deana, A., Drueckes, P., Sala, E., Lucchini, V., Kubbutat, M., Formelli, F., Zambon, A., Scapozza, L., Gambacorti-Passerini, C.
(2008). Characterization of compound 584, an Abl kinase inhibitor with lasting effects. haematol
93: 653-661
[Abstract][Full Text]
Zota, V., Miron, P. M., Woda, B. A., Raza, A., Wang, S. A.
(2008). Eosinophilia With FIP1L1-PDGFRA Fusion in a Patient With Chronic Myelomonocytic Leukemia. JCO
26: 2040-2041
[Full Text]
Fitter, S., Dewar, A. L., Kostakis, P., To, L. B., Hughes, T. P., Roberts, M. M., Lynch, K., Vernon-Roberts, B., Zannettino, A. C. W.
(2008). Long-term imatinib therapy promotes bone formation in CML patients. Blood
111: 2538-2547
[Abstract][Full Text]
Gibbons, J., Egorin, M. J., Ramanathan, R. K., Fu, P., Mulkerin, D. L., Shibata, S., Takimoto, C. H.M., Mani, S., LoRusso, P. A., Grem, J. L., Pavlick, A., Lenz, H.-J., Flick, S. M., Reynolds, S., Lagattuta, T. F., Parise, R. A., Wang, Y., Murgo, A. J., Ivy, S. P., Remick, S. C.
(2008). Phase I and Pharmacokinetic Study of Imatinib Mesylate in Patients With Advanced Malignancies and Varying Degrees of Renal Dysfunction: A Study by the National Cancer Institute Organ Dysfunction Working Group. JCO
26: 570-576
[Abstract][Full Text]
Azuma, M., Nishioka, Y., Aono, Y., Inayama, M., Makino, H., Kishi, J., Shono, M., Kinoshita, K., Uehara, H., Ogushi, F., Izumi, K., Sone, S.
(2007). Role of {alpha}1-Acid Glycoprotein in Therapeutic Antifibrotic Effects of Imatinib with Macrolides in Mice. Am. J. Respir. Crit. Care Med.
176: 1243-1250
[Abstract][Full Text]
Ali, Y., Lin, Y., Gharibo, M. M., Gounder, M. K., Stein, M. N., Lagattuta, T. F., Egorin, M. J., Rubin, E. H., Poplin, E. A.
(2007). Phase I and Pharmacokinetic Study of Imatinib Mesylate (Gleevec) and Gemcitabine in Patients with Refractory Solid Tumors. Clin. Cancer Res.
13: 5876-5882
[Abstract][Full Text]
Reiter, A., Grimwade, D., Cross, N. C.P.
(2007). Diagnostic and therapeutic management of eosinophilia-associated chronic myeloproliferative disorders. haematol
92: 1153-1158
[Full Text]
Baccarani, M., Cilloni, D., Rondoni, M., Ottaviani, E., Messa, F., Merante, S., Tiribelli, M., Buccisano, F., Testoni, N., Gottardi, E., de Vivo, A., Giugliano, E., Iacobucci, I., Paolini, S., Soverini, S., Rosti, G., Rancati, F., Astolfi, C., Pane, F., Saglio, G., Martinelli, G.
(2007). The efficacy of imatinib mesylate in patients with FIP1L1-PDGFR{alpha}-positive hypereosinophilic syndrome. Results of a multicenter prospective study. haematol
92: 1173-1179
[Abstract][Full Text]
Fletcher, S., Bain, B.
(2007). Eosinophilic leukaemia. Br Med Bull
0: ldm008v1-13
[Abstract][Full Text]
Pollack, I. F., Jakacki, R. I., Blaney, S. M., Hancock, M. L., Kieran, M. W., Phillips, P., Kun, L. E., Friedman, H., Packer, R., Banerjee, A., Geyer, J. R., Goldman, S., Poussaint, T. Y., Krasin, M. J., Wang, Y., Hayes, M., Murgo, A., Weiner, S., Boyett, J. M.
(2007). Phase I trial of imatinib in children with newly diagnosed brainstem and recurrent malignant gliomas: A Pediatric Brain Tumor Consortium report. Neuro Oncol Duke
9: 145-160
[Abstract][Full Text]
Sinai, P., Berg, R. E., Haynie, J. M., Egorin, M. J., Ilaria, R. L. Jr, Forman, J.
(2007). Imatinib Mesylate Inhibits Antigen-Specific Memory CD8 T Cell Responses In Vivo. J. Immunol.
178: 2028-2037
[Abstract][Full Text]
Lierman, E., Cools, J.
(2007). ETV6 and PDGFRB: a license to fuse. haematol
92: 145-147
[Full Text]
Diehl, K. M., Keller, E. T., Woods Ignatoski, K. M.
(2007). Why should we still care about oncogenes?. Molecular Cancer Therapeutics
6: 418-427
[Abstract][Full Text]
Lierman, E., Lahortiga, I., Van Miegroet, H., Mentens, N., Marynen, P., Cools, J.
(2007). The ability of sorafenib to inhibit oncogenic PDGFR{beta} and FLT3 mutants and overcome resistance to other small molecule inhibitors. haematol
92: 27-34
[Abstract][Full Text]
Thomas, D. A.
(2007). Philadelphia Chromosome Positive Acute Lymphocytic Leukemia: A New Era of Challenges. ASH Education Book
2007: 435-443
[Abstract][Full Text]
David, M., Cross, N. C. P., Burgstaller, S., Chase, A., Curtis, C., Dang, R., Gardembas, M., Goldman, J. M., Grand, F., Hughes, G., Huguet, F., Lavender, L., McArthur, G. A., Mahon, F. X., Massimini, G., Melo, J., Rousselot, P., Russell-Jones, R. J., Seymour, J. F., Smith, G., Stark, A., Waghorn, K., Nikolova, Z., Apperley, J. F.
(2007). Durable responses to imatinib in patients with PDGFRB fusion gene-positive and BCR-ABL-negative chronic myeloproliferative disorders. Blood
109: 61-64
[Abstract][Full Text]
Xu, X., Zhang, Q., Luo, J., Xing, S., Li, Q., Krantz, S. B., Fu, X., Zhao, Z. J.
(2007). JAK2V617F: prevalence in a large Chinese hospital population. Blood
109: 339-342
[Abstract][Full Text]
Kantarjian, H. M., Talpaz, M., Giles, F., O'Brien, S., Cortes, J.
(2006). New Insights into the Pathophysiology of Chronic Myeloid Leukemia and Imatinib Resistance. ANN INTERN MED
145: 913-923
[Abstract][Full Text]
Mumprecht, S., Matter, M., Pavelic, V., Ochsenbein, A. F.
(2006). Imatinib mesylate selectively impairs expansion of memory cytotoxic T cells without affecting the control of primary viral infections. Blood
108: 3406-3413
[Abstract][Full Text]
Alvarez, R. H., Kantarjian, H. M., Cortes, J. E.
(2006). Biology of Platelet-Derived Growth Factor and Its Involvement in Disease. Mayo Clin Proc.
81: 1241-1257
[Abstract][Full Text]
Stone, R. M.
(2006). Is Intravenous Arsenic Trioxide a Useful Therapy in Myelodysplastic Syndromes?. JCO
24: 2414-2416
[Full Text]
Tefferi, A., Elliott, M. A., Pardanani, A.
(2006). Atypical Myeloproliferative Disorders: Diagnosis and Management. Mayo Clin Proc.
81: 553-563
[Abstract][Full Text]
Heinrich, M. C., McArthur, G. A., Demetri, G. D., Joensuu, H., Bono, P., Herrmann, R., Hirte, H., Cresta, S., Koslin, D. B., Corless, C. L., Dirnhofer, S., van Oosterom, A. T., Nikolova, Z., Dimitrijevic, S., Fletcher, J. A.
(2006). Clinical and Molecular Studies of the Effect of Imatinib on Advanced Aggressive Fibromatosis (desmoid tumor). JCO
24: 1195-1203
[Abstract][Full Text]
Smolen, G. A., Sordella, R., Muir, B., Mohapatra, G., Barmettler, A., Archibald, H., Kim, W. J., Okimoto, R. A., Bell, D. W., Sgroi, D. C., Christensen, J. G., Settleman, J., Haber, D. A.
(2006). Amplification of MET may identify a subset of cancers with extreme sensitivity to the selective tyrosine kinase inhibitor PHA-665752. Proc. Natl. Acad. Sci. USA
103: 2316-2321
[Abstract][Full Text]
Young, M. A., Shah, N. P., Chao, L. H., Seeliger, M., Milanov, Z. V., Biggs, W. H. III, Treiber, D. K., Patel, H. K., Zarrinkar, P. P., Lockhart, D. J., Sawyers, C. L., Kuriyan, J.
(2006). Structure of the Kinase Domain of an Imatinib-Resistant Abl Mutant in Complex with the Aurora Kinase Inhibitor VX-680. Cancer Res.
66: 1007-1014
[Abstract][Full Text]
Levine, R. L., Wernig, G.
(2006). Role of JAK-STAT Signaling in the Pathogenesis of Myeloproliferative Disorders. ASH Education Book
2006: 233-239
[Abstract][Full Text]
Steensma, D. P., Bennett, J. M.
(2006). The Myelodysplastic Syndromes: Diagnosis and Treatment. Mayo Clin Proc.
81: 104-130
[Abstract][Full Text]
Reardon, D. A., Egorin, M. J., Quinn, J. A., Rich, J. N. Sr, Gururangan, I., Vredenburgh, J. J., Desjardins, A., Sathornsumetee, S., Provenzale, J. M., Herndon, J. E. II, Dowell, J. M., Badruddoja, M. A., McLendon, R. E., Lagattuta, T. F., Kicielinski, K. P., Dresemann, G., Sampson, J. H., Friedman, A. H., Salvado, A. J., Friedman, H. S.
(2005). Phase II Study of Imatinib Mesylate Plus Hydroxyurea in Adults With Recurrent Glioblastoma Multiforme. JCO
23: 9359-9368
[Abstract][Full Text]
Levine, R. L., Loriaux, M., Huntly, B. J. P., Loh, M. L., Beran, M., Stoffregen, E., Berger, R., Clark, J. J., Willis, S. G., Nguyen, K. T., Flores, N. J., Estey, E., Gattermann, N., Armstrong, S., Look, A. T., Griffin, J. D., Bernard, O. A., Heinrich, M. C., Gilliland, D. G., Druker, B., Deininger, M. W. N.
(2005). The JAK2V617F activating mutation occurs in chronic myelomonocytic leukemia and acute myeloid leukemia, but not in acute lymphoblastic leukemia or chronic lymphocytic leukemia. Blood
106: 3377-3379
[Abstract][Full Text]
Stover, E. H., Chen, J., Lee, B. H., Cools, J., McDowell, E., Adelsperger, J., Cullen, D., Coburn, A., Moore, S. A., Okabe, R., Fabbro, D., Manley, P. W., Griffin, J. D., Gilliland, D. G.
(2005). The small molecule tyrosine kinase inhibitor AMN107 inhibits TEL-PDGFR{beta} and FIP1L1-PDGFR{alpha} in vitro and in vivo. Blood
106: 3206-3213
[Abstract][Full Text]
Frohling, S., Scholl, C., Gilliland, D. G., Levine, R. L.
(2005). Genetics of Myeloid Malignancies: Pathogenetic and Clinical Implications. JCO
23: 6285-6295
[Abstract][Full Text]
Steensma, D. P., Dewald, G. W., Lasho, T. L., Powell, H. L., McClure, R. F., Levine, R. L., Gilliland, D. G., Tefferi, A.
(2005). The JAK2 V617F activating tyrosine kinase mutation is an infrequent event in both "atypical" myeloproliferative disorders and myelodysplastic syndromes. Blood
106: 1207-1209
[Abstract][Full Text]
Krause, D. S., Van Etten, R. A.
(2005). Tyrosine Kinases as Targets for Cancer Therapy. NEJM
353: 172-187
[Full Text]
Tefferi, A., Gilliland, D. G.
(2005). The JAK2V617F Tyrosine Kinase Mutation in Myeloproliferative Disorders: Status Report and Immediate Implications for Disease Classification and Diagnosis. Mayo Clin Proc.
80: 947-958
[Abstract]
Steensma, D. P., List, A. F.
(2005). Genetic Testing in the Myelodysplastic Syndromes: Molecular Insights Into Hematologic Diversity. Mayo Clin Proc.
80: 681-698
[Abstract]
Reiter, A., Walz, C., Watmore, A., Schoch, C., Blau, I., Schlegelberger, B., Berger, U., Telford, N., Aruliah, S., Yin, J. A., Vanstraelen, D., Barker, H. F., Taylor, P. C., O'Driscoll, A., Benedetti, F., Rudolph, C., Kolb, H.-J., Hochhaus, A., Hehlmann, R., Chase, A., Cross, N. C.P.
(2005). The t(8;9)(p22;p24) Is a Recurrent Abnormality in Chronic and Acute Leukemia that Fuses PCM1 to JAK2. Cancer Res.
65: 2662-2667
[Abstract][Full Text]
Deininger, M., Buchdunger, E., Druker, B. J.
(2005). The development of imatinib as a therapeutic agent for chronic myeloid leukemia. Blood
105: 2640-2653
[Abstract][Full Text]
Seggewiss, R., Lore, K., Greiner, E., Magnusson, M. K., Price, D. A., Douek, D. C., Dunbar, C. E., Wiestner, A.
(2005). Imatinib inhibits T-cell receptor-mediated T-cell proliferation and activation in a dose-dependent manner. Blood
105: 2473-2479
[Abstract][Full Text]
Appel, S., Rupf, A., Weck, M. M., Schoor, O., Brummendorf, T. H., Weinschenk, T., Grunebach, F., Brossart, P.
(2005). Effects of Imatinib on Monocyte-Derived Dendritic Cells Are Mediated by Inhibition of Nuclear Factor-{kappa}B and Akt Signaling Pathways. Clin. Cancer Res.
11: 1928-1940
[Abstract][Full Text]
Unwin, R. D., Sternberg, D. W., Lu, Y., Pierce, A., Gilliland, D. G., Whetton, A. D.
(2005). Global Effects of BCR/ABL and TEL/PDGFR{beta} Expression on the Proteome and Phosphoproteome: IDENTIFICATION OF THE RHO PATHWAY AS A TARGET OF BCR/ABL. J. Biol. Chem.
280: 6316-6326
[Abstract][Full Text]
Malagola, M., Martinelli, G., Rondoni, M., Paolini, S., Gaitani, S., Arpinati, M., Piccaluga, P. P., Amabile, M., Basi, C., Ottaviani, E., Candoni, A., Gottardi, E., Cilloni, D., Bocchia, M., Saglio, G., Lauria, F., Fanin, R., Visani, G., Marre, M. C., Maderna, M., Rancati, F., Vinaccia, V., Russo, D., Baccarani, M., Kindler, T., Heidel, F., Fischer, T.
(2005). Imatinib mesylate in the treatment of c-kit-positive acute myeloid leukemia: is this the real target?. Blood
105: 904-905
[Full Text]
Sihto, H., Sarlomo-Rikala, M., Tynninen, O., Tanner, M., Andersson, L. C., Franssila, K., Nupponen, N. N., Joensuu, H.
(2005). KIT and Platelet-Derived Growth Factor Receptor Alpha Tyrosine Kinase Gene Mutations and KIT Amplifications in Human Solid Tumors. JCO
23: 49-57
[Abstract][Full Text]
Hellstrom-Lindberg, E.
(2005). Update on Supportive Care and New Therapies: Immunomodulatory Drugs, Growth Factors and Epigenetic-Acting Agents. ASH Education Book
2005: 161-166
[Abstract][Full Text]
Tefferi, A.
(2005). Blood Eosinophilia: A New Paradigm in Disease Classification, Diagnosis, and Treatment. Mayo Clin Proc.
80: 75-83
[Abstract]
Wadleigh, M., DeAngelo, D. J., Griffin, J. D., Stone, R. M.
(2005). After chronic myelogenous leukemia: tyrosine kinase inhibitors in other hematologic malignancies. Blood
105: 22-30
[Abstract][Full Text]
Bain, B. J., Gotlib, J., Cools, J., Malone, J. M., Schrier, S. L., Gilliland, D. G., Coutre, S. E.
(2004). Eosinophilic leukemia and idiopathic hypereosinophilic syndrome are mutually exclusive diagnoses. Blood
104: 3836-3837
[Full Text]
Pardanani, A., Brockman, S. R., Paternoster, S. F., Flynn, H. C., Ketterling, R. P., Lasho, T. L., Ho, C.-L., Li, C.-Y., Dewald, G. W., Tefferi, A.
(2004). FIP1L1-PDGFRA fusion: prevalence and clinicopathologic correlates in 89 consecutive patients with moderate to severe eosinophilia. Blood
104: 3038-3045
[Abstract][Full Text]
O'Hare, T., Pollock, R., Stoffregen, E. P., Keats, J. A., Abdullah, O. M., Moseson, E. M., Rivera, V. M., Tang, H., Metcalf, C. A. III, Bohacek, R. S., Wang, Y., Sundaramoorthi, R., Shakespeare, W. C., Dalgarno, D., Clackson, T., Sawyer, T. K., Deininger, M. W., Druker, B. J.
(2004). Inhibition of wild-type and mutant Bcr-Abl by AP23464, a potent ATP-based oncogenic protein kinase inhibitor: implications for CML. Blood
104: 2532-2539
[Abstract][Full Text]
Chen, J., DeAngelo, D. J., Kutok, J. L., Williams, I. R., Lee, B. H., Wadleigh, M., Duclos, N., Cohen, S., Adelsperger, J., Okabe, R., Coburn, A., Galinsky, I., Huntly, B., Cohen, P. S., Meyer, T., Fabbro, D., Roesel, J., Banerji, L., Griffin, J. D., Xiao, S., Fletcher, J. A., Stone, R. M., Gilliland, D. G.
(2004). PKC412 inhibits the zinc finger 198-fibroblast growth factor receptor 1 fusion tyrosine kinase and is active in treatment of stem cell myeloproliferative disorder. Proc. Natl. Acad. Sci. USA
101: 14479-14484
[Abstract][Full Text]
Carvalho, S, Silva, A O e, Milanezi, F, Ricardo, S, Leitao, D, Amendoeira, I, Schmitt, F C
(2004). c-KIT and PDGFRA in breast phyllodes tumours: overexpression without mutations?. J. Clin. Pathol.
57: 1075-1079
[Abstract][Full Text]
Pardanani, A., Tefferi, A.
(2004). Imatinib targets other than bcr/abl and their clinical relevance in myeloid disorders. Blood
104: 1931-1939
[Abstract][Full Text]
Cain, J. A., Grisolano, J. L., Laird, A. D., Tomasson, M. H.
(2004). Complete remission of TEL-PDGFRB-induced myeloproliferative disease in mice by receptor tyrosine kinase inhibitor SU11657. Blood
104: 561-564
[Abstract][Full Text]
Wolff, N. C., Randle, D. E., Egorin, M. J., Minna, J. D., Ilaria, R. L. Jr.
(2004). Imatinib Mesylate Efficiently Achieves Therapeutic Intratumor Concentrations in Vivo but Has Limited Activity in a Xenograft Model of Small Cell Lung Cancer. Clin. Cancer Res.
10: 3528-3534
[Abstract][Full Text]
Morerio, C., Acquila, M., Rosanda, C., Rapella, A., Dufour, C., Locatelli, F., Maserati, E., Pasquali, F., Panarello, C.
(2004). HCMOGT-1 Is a Novel Fusion Partner to PDGFRB in Juvenile Myelomonocytic Leukemia with t(5;17)(q33;p11.2). Cancer Res.
64: 2649-2651
[Abstract][Full Text]
Vizmanos, J. L., Novo, F. J., Roman, J. P., Baxter, E. J., Lahortiga, I., Larrayoz, M. J., Odero, M. D., Giraldo, P., Calasanz, M. J., Cross, N. C. P.
(2004). NIN, a Gene Encoding a CEP110-Like Centrosomal Protein, Is Fused to PDGFRB in a Patient with a t(5;14)(q33;q24) and an Imatinib-Responsive Myeloproliferative Disorder1. Cancer Res.
64: 2673-2676
[Abstract][Full Text]
Gotlib, J., Cools, J., Malone, J. M. III, Schrier, S. L., Gilliland, D. G., Coutre, S. E.
(2004). The FIP1L1-PDGFR{alpha} fusion tyrosine kinase in hypereosinophilic syndrome and chronic eosinophilic leukemia: implications for diagnosis, classification, and management. Blood
103: 2879-2891
[Abstract][Full Text]
Bono, P., Krause, A., von Mehren, M., Heinrich, M. C., Blanke, C. D., Dimitrijevic, S., Demetri, G. D., Joensuu, H.
(2004). Serum KIT and KIT ligand levels in patients with gastrointestinal stromal tumors treated with imatinib. Blood
103: 2929-2935
[Abstract][Full Text]
Mohi, M. G., Boulton, C., Gu, T.-L., Sternberg, D. W., Neuberg, D., Griffin, J. D., Gilliland, D. G., Neel, B. G.
(2004). Combination of rapamycin and protein tyrosine kinase (PTK) inhibitors for the treatment of leukemias caused by oncogenic PTKs. Proc. Natl. Acad. Sci. USA
101: 3130-3135
[Abstract][Full Text]
Matei, D., Chang, D. D., Jeng, M.-H.
(2004). Imatinib Mesylate (Gleevec) Inhibits Ovarian Cancer Cell Growth through a Mechanism Dependent on Platelet-Derived Growth Factor Receptor {alpha} and Akt Inactivation. Clin. Cancer Res.
10: 681-690
[Abstract][Full Text]
Bartolovic, K., Balabanov, S., Hartmann, U., Komor, M., Boehmler, A. M., Buhring, H.-J., Mohle, R., Hoelzer, D., Kanz, L., Hofmann, W.-K., Brummendorf, T. H.
(2004). Inhibitory effect of imatinib on normal progenitor cells in vitro. Blood
103: 523-529
[Abstract][Full Text]
Appel, S., Boehmler, A. M., Grunebach, F., Muller, M. R., Rupf, A., Weck, M. M., Hartmann, U., Reichardt, V. L., Kanz, L., Brummendorf, T. H., Brossart, P.
(2004). Imatinib mesylate affects the development and function of dendritic cells generated from CD34+ peripheral blood progenitor cells. Blood
103: 538-544
[Abstract][Full Text]
List, A. F., Vardiman, J., Issa, J.-P. J., DeWitte, T. M.
(2004). Myelodysplastic Syndromes. ASH Education Book
2004: 297-317
[Abstract][Full Text]
Sawyers, C. L.
(2003). Opportunities and challenges in the development of kinase inhibitor therapy for cancer. Genes Dev.
17: 2998-3010
[Full Text]
Heinrich, M. C., Corless, C. L., Demetri, G. D., Blanke, C. D., von Mehren, M., Joensuu, H., McGreevey, L. S., Chen, C.-J., Van den Abbeele, A. D., Druker, B. J., Kiese, B., Eisenberg, B., Roberts, P. J., Singer, S., Fletcher, C. D.M., Silberman, S., Dimitrijevic, S., Fletcher, J. A.
(2003). Kinase Mutations and Imatinib Response in Patients With Metastatic Gastrointestinal Stromal Tumor. JCO
21: 4342-4349
[Abstract][Full Text]
Johnson, B. E., Fischer, T., Fischer, B., Dunlop, D., Rischin, D., Silberman, S., Kowalski, M. O., Sayles, D., Dimitrijevic, S., Fletcher, C., Hornick, J., Salgia, R., Le Chevalier, T.
(2003). Phase II Study of Imatinib in Patients with Small Cell Lung Cancer. Clin. Cancer Res.
9: 5880-5887
[Abstract][Full Text]
Druker, B. J.
(2003). Imatinib As a Paradigm of Targeted Therapies. JCO
21: 239s-245
[Full Text]
Wilkinson, K., Velloso, E. R. P., Lopes, L. F., Lee, C., Aster, J. C., Shipp, M. A., Aguiar, R. C. T.
(2003). Cloning of the t(1;5)(q23;q33) in a myeloproliferative disorder associated with eosinophilia: involvement of PDGFRB and response to imatinib. Blood
102: 4187-4190
[Abstract][Full Text]
Mauro, M. J.
(2003). HES and SMCD-eos: birds of a FIP1L1-PDGFRA feather. Blood
102: 3082-3082
[Full Text]
Pardanani, A., Ketterling, R. P., Brockman, S. R., Flynn, H. C., Paternoster, S. F., Shearer, B. M., Reeder, T. L., Li, C.-Y., Cross, N. C. P., Cools, J., Gilliland, D. G., Dewald, G. W., Tefferi, A.
(2003). CHIC2 deletion, a surrogate for FIP1L1-PDGFRA fusion, occurs in systemic mastocytosis associated with eosinophilia and predicts response to imatinib mesylate therapy. Blood
102: 3093-3096
[Abstract][Full Text]
Heinrich, M. C., Corless, C. L.
(2003). In Reply:. JCO
21: 3886-3887
[Full Text]
Oehler, L., Jaeger, E., Eser, A., Sillaber, C., Gisslinger, H., Geissler, K.
(2003). Imatinib mesylate inhibits autonomous erythropoiesis in patients with polycythemia vera in vitro. Blood
102: 2240-2242
[Abstract][Full Text]
Pietras, K., Stumm, M., Hubert, M., Buchdunger, E., Rubin, K., Heldin, C.-H., McSheehy, P., Wartmann, M., Ostman, A.
(2003). STI571 Enhances the Therapeutic Index of Epothilone B by a Tumor-selective Increase of Drug Uptake. Clin. Cancer Res.
9: 3779-3787
[Abstract][Full Text]
Deininger, M. W. N., Druker, B. J.
(2003). Specific Targeted Therapy of Chronic Myelogenous Leukemia with Imatinib. Pharmacol. Rev.
55: 401-423
[Abstract][Full Text]
Antin, J. H.
(2003). A 41-Year-Old Woman With Chronic Myelogenous Leukemia. JAMA
290: 1083-1090
[Full Text]
Griffin, J. H., Leung, J., Bruner, R. J., Caligiuri, M. A., Briesewitz, R.
(2003). Discovery of a fusion kinase in EOL-1 cells and idiopathic hypereosinophilic syndrome. Proc. Natl. Acad. Sci. USA
100: 7830-7835
[Abstract][Full Text]
Kurzrock, R., Kantarjian, H. M., Druker, B. J., Talpaz, M.
(2003). Philadelphia Chromosome-Positive Leukemias: From Basic Mechanisms to Molecular Therapeutics. ANN INTERN MED
138: 819-830
[Abstract][Full Text]
Pardanani, A., Reeder, T., Porrata, L. F., Li, C.-Y., Tazelaar, H. D., Baxter, E. J., Witzig, T. E., Cross, N. C. P., Tefferi, A.
(2003). Imatinib therapy for hypereosinophilic syndrome and other eosinophilic disorders. Blood
101: 3391-3397
[Abstract][Full Text]
Sohal, J., Phan, V. T., Chan, P. V., Davis, E. M., Patel, B., Kelly, L. M., Abrams, T. J., O'Farrell, A. M., Gilliland, D. G., Le Beau, M. M., Kogan, S. C.
(2003). A model of APL with FLT3 mutation is responsive to retinoic acid and a receptor tyrosine kinase inhibitor, SU11657. Blood
101: 3188-3197
[Abstract][Full Text]
Hirai, H.
(2003). Molecular Mechanisms of Myelodysplastic Syndrome. Jpn J Clin Oncol
33: 153-160
[Abstract][Full Text]
Cools, J., DeAngelo, D. J., Gotlib, J., Stover, E. H., Legare, R. D., Cortes, J., Kutok, J., Clark, J., Galinsky, I., Griffin, J. D., Cross, N. C.P., Tefferi, A., Malone, J., Alam, R., Schrier, S. L., Schmid, J., Rose, M., Vandenberghe, P., Verhoef, G., Boogaerts, M., Wlodarska, I., Kantarjian, H., Marynen, P., Coutre, S. E., Stone, R., Gilliland, D. G.
(2003). A Tyrosine Kinase Created by Fusion of the PDGFRA and FIP1L1 Genes as a Therapeutic Target of Imatinib in Idiopathic Hypereosinophilic Syndrome. NEJM
348: 1201-1214
[Abstract][Full Text]
O'Brien, S. G., Guilhot, F., Larson, R. A., Gathmann, I., Baccarani, M., Cervantes, F., Cornelissen, J. J., Fischer, T., Hochhaus, A., Hughes, T., Lechner, K., Nielsen, J. L., Rousselot, P., Reiffers, J., Saglio, G., Shepherd, J., Simonsson, B., Gratwohl, A., Goldman, J. M., Kantarjian, H., Taylor, K., Verhoef, G., Bolton, A. E., Capdeville, R., Druker, B. J., the IRIS Investigators,
(2003). Imatinib Compared with Interferon and Low-Dose Cytarabine for Newly Diagnosed Chronic-Phase Chronic Myeloid Leukemia. NEJM
348: 994-1004
[Abstract][Full Text]
Nahta, R., Hortobagyi, G. N., Esteva, F. J.
(2003). Growth Factor Receptors in Breast Cancer: Potential for Therapeutic Intervention. The Oncologist
8: 5-17
[Abstract][Full Text]
Mufti, G., List, A. F., Gore, S. D., Ho, A. Y.L.
(2003). Myelodysplastic Syndrome. ASH Education Book
2003: 176-199
[Abstract][Full Text]
Ebos, J. M.L., Tran, J., Master, Z., Dumont, D., Melo, J. V., Buchdunger, E., Kerbel, R. S.
(2002). Imatinib Mesylate (STI-571) Reduces Bcr-Abl-Mediated Vascular Endothelial Growth Factor Secretion in Chronic Myelogenous Leukemia. Mol Cancer Res
1: 89-95
[Abstract][Full Text]
Arceci, R. J., Longley, B. J., Emanuel, P. D.
(2002). Atypical Cellular Disorders. ASH Education Book
2002: 297-314
[Abstract][Full Text]
(PDGFRA) and PDGF-
(PDGFRB), thereby stimulating the proliferation and migration of mesenchymal cells. PDGFRA and PDGFRB belong to type III–receptor tyrosine kinase families and are characterized by five immunoglobulin-like domains in the extracellular region, a transmembrane domain, an ATP-binding site, and a hydrophilic kinase insert domain in the intracellular portion.15,16 Ligand binding to these receptors results in dimerization of the subunits of the receptor, followed by the activation of the tyrosine kinase domain and autophosphorylation. The resulting phosphotyrosines act as docking sites for intracellular signaling proteins,11,17 and signaling through PDGFRB plays an important part in mitogenesis, cytoskeletal rearrangements, and chemotaxis. 
Previous
