FREE NEJM E-TOC    HOME   |   SUBSCRIBE   |   CURRENT ISSUE   |   PAST ISSUES   |   COLLECTIONS   |   Search Term  Advanced Search

Sign in | Get NEJM's E-Mail Table of Contents — Free | Subscribe

Previous Volume 348:403-413 January 30, 2003 Number 5 Next

Abstract PDF PDA Full Text PowerPoint Slide Set Supplementary Material Letters Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited E-mail When Letters Appear Related Article PubMed Citation

ABSTRACT

Background During continuous ambulatory peritoneal dialysis, the peritoneum is exposed to bioincompatible dialysis fluids that cause denudation of mesothelial cells and, ultimately, tissue fibrosis and failure of ultrafiltration. However, the mechanism of this process has yet to be elucidated.

Methods Mesothelial cells isolated from effluents in dialysis fluid from patients undergoing continuous ambulatory peritoneal dialysis were phenotypically characterized by flow cytometry, confocal immunofluorescence, Western blotting, and reverse-transcriptase polymerase chain reaction. These cells were compared with mesothelial cells from omentum and treated with various stimuli in vitro to mimic the transdifferentiation observed during continuous ambulatory peritoneal dialysis. Results were confirmed in vivo by immunohistochemical analysis performed on peritoneal-biopsy specimens.

Results Soon after dialysis is initiated, peritoneal mesothelial cells undergo a transition from an epithelial phenotype to a mesenchymal phenotype with a progressive loss of epithelial morphology and a decrease in the expression of cytokeratins and E-cadherin through an induction of the transcriptional repressor snail. Mesothelial cells also acquire a migratory phenotype with the up-regulation of expression of ₂ integrin. In vitro analyses point to wound repair and profibrotic and inflammatory cytokines as factors that initiate mesothelial transdifferentiation. Immunohistochemical studies of peritoneal-biopsy specimens from patients undergoing continuous ambulatory peritoneal dialysis demonstrate the expression of the mesothelial markers intercellular adhesion molecule 1 and cytokeratins in fibroblast-like cells entrapped in the stroma, suggesting that these cells stemmed from local conversion of mesothelial cells.

Conclusions Our results suggest that mesothelial cells have an active role in the structural and functional alteration of the peritoneum during peritoneal dialysis. The findings suggest potential targets for the design of new dialysis solutions and markers for the monitoring of patients.

The pathophysiology of peritoneal impairment during long-term continuous ambulatory peritoneal dialysis is not well understood. Peritoneal mesenchymal stem cells entrapped in the stroma have historically been considered to be the primary cells involved in the development of peritoneal fibrosis.⁵ However, a possible direct involvement of mesothelial cells in this phenomenon has not been examined. In this context, cultured mesothelial cells have the capacity to change their morphologic features and produce extracellular-matrix components in response to a variety of stimuli.^{6,7,8,9,10,11,12} In addition, treatment of mesothelial cells in vitro with mediums that have a high glucose concentration or with inflammatory cytokines induces the expression of transforming growth factor (TGF-)¹³ and decreases the expression of E-cadherin.¹⁴ The relevance of the profibrotic growth factor TGF-¹⁵ in the failure of ultrafiltration induced by continuous ambulatory peritoneal dialysis was recently underscored in a rat model in which the TGF- gene was transduced to the peritoneum, where it was associated with a decrease in peritoneal function.¹⁶

In the present study, we demonstrate in vivo and ex vivo that mesothelial cells undergo a transition from an epithelial phenotype to a mesenchymal phenotype — a transition also called transdifferentiation — when they are subjected to peritoneal dialysis. Transdifferentiation is a complex and generally reversible process that starts with the disruption of intercellular junctions and loss of the apical–basolateral polarity typical of epithelial cells, with the cells then transformed into fibroblast-like cells with pseudopodial protrusions and increased migratory, invasive, and fibrogenic features.¹⁷ Although transdifferentiation can be induced in most cultured epithelial cells with a wide variety of treatments, this process occurs in vivo only during embryonic development and in some pathologic processes such as wound healing and tumor progression.^17,18 The intercellular adhesion molecule E-cadherin appears to have a central role in the control of the epithelial-to-mesenchymal transition, since the loss of E-cadherin expression or function correlates with the ability of epithelial cells to adopt a mesenchymal migratory and invasive phenotype.^19,20 The transcription factor snail is a strong repressor of E-cadherin transcription and an inducer of transdifferentiation.^21,22,23 Thus, phenotypic changes of the mesothelial cells during continuous ambulatory peritoneal dialysis may be directly related to the failure of peritoneal membrane function.

Methods

Patients and Cells

Human mesothelial cells from effluent (mean [±SE] number of cells per bag, 25,569±2971) were obtained by centrifugation of dialysis fluid taken randomly from 54 clinically stable patients undergoing nocturnal exchanges with dialysis solutions containing 2.27 percent glucose and 1.25 to 1.75 mmol of calcium per liter. After 10 to 15 days, cultures reached confluence and were split (in a ratio of 1:2) two to three times. The morphologic features of cells in confluent cultures were compared and remained stable during the two to three cell passages. Eighty-five percent of the cultures were obtained before a first episode of peritonitis occurred. Of the 116 effluent cultures evaluated, 62 had cobblestone morphology, 28 contained transitional mesothelial cells, 20 contained fibroblast-like mesothelial cells, and 6 contained a mixed population of cells.

Omental mesothelial cells were obtained by digestion of samples of omentum from 30 patients who were not undergoing continuous ambulatory peritoneal dialysis but were undergoing unrelated abdominal surgery; the samples were digested with 0.05 percent trypsin and 0.02 percent EDTA. Omental fibroblasts were obtained from three different samples of omentum by extensive treatment with trypsin after the removal of mesothelial cells (three 20-minute rounds of exposure to trypsin). All cells were cultured in Earle's M199 medium, 20 percent fetal-calf serum, 50 U of penicillin per milliliter, 50 µg of streptomycin per milliliter, and 2 percent Biogro-2 (containing insulin, transferrin, ethanolamine, and putrescine) (Biological Industries). For the experiments, cells were seeded on films of 50 µg of collagen I per milliliter without Biogro-2. TGF-1 and interleukin-1 were purchased (R&D), and the doses used were in the range of those detected in peritoneal-dialysis fluids in the presence of peritonitis²⁴ and were similar to those used in previous studies.⁹ The study was approved by the ethics committee of Hospital Universitario de la Princesa in Madrid, and oral informed consent was obtained from all donors.

Antibodies

Monoclonal antibodies against CD151 (LIA1/1), CD9 (VJ1/20), ₃ integrin (VJ1/18), ₁ integrin (TS2/16), and ₂ integrin (TEA1/41) have been described elsewhere.²⁵ We also used monoclonal antibody against intercellular adhesion molecule 1 (ICAM-1) (HU5/3, provided by Dr. F.W. Luscinskas, Brigham and Women's Hospital, Boston); rabbit polyclonal antibodies against ₂ integrin and ₃ integrin (provided by Dr. G. Tarone, University of Turin, Turin, Italy); monoclonal antibody against E-cadherin (Calbiochem); antibodies against vimentin, tubulin, and pancytokeratin (Sigma); and monoclonal antibody against ICAM-1 (Santa Cruz Biotechnology).

Flow Cytometry, Immunohistochemical Analysis, Immunofluorescence Studies, and Confocal Microscopy

Flow cytometry and immunofluorescence studies were performed as described previously.²⁵ Immunohistochemical studies were performed with a streptavidin–biotin method (Dako LSAB-2 Kit, Dako) on paraffin-embedded peritoneal-tissue samples from 17 patients undergoing continuous ambulatory peritoneal dialysis and 8 control patients. All patients who underwent biopsy gave written informed consent. Diaminobenzidine and fast red were used as chromogens for visualization.

Western Blotting

Monolayers of mesothelial cells were lysed in RIPA buffer, and equivalent amounts of protein were resolved by sodium dodecyl sulfate–polyacrylamide-gel electrophoresis and Western blotting as described previously.²⁵ Imaging was performed with an LAS-1000 CCD camera (Fujifilm), and signals were quantified with Image Gauge software (version 3.46, Fujifilm).

Reverse-Transcriptase Polymerase Chain Reaction

Mesothelial RNA was extracted with the use of a reagent (RNAwiz, Ambion). The complementary DNA was obtained from 1 µg of total RNA with the use of a kit (Applied Biosystems). Amplification of snail was performed for 40 cycles (40 seconds at 95°C, 30 seconds at 53°C, and 1 minute at 72°C) with the use of primer 1 (5'CACATCCTTCTCACTGCCATG3') and primer 2 (5'GCATCTAAACTCTAGTCTGC3'). For nested reverse-transcriptase–polymerase-chain-reaction (RT-PCR) analysis of snail, a 30-cycle reaction was performed under the same conditions, and a 1:50 dilution of the product of the reaction was amplified for 20 cycles (40 seconds at 95°C, 30 seconds at 60°C, and 1 minute at 70°C) with primer 1 and primer 3 (5'CCTGAGTGGGGTGGGAGCTTCC3').²² PCR analysis of E-cadherin was carried out for 32 cycles as described previously.²²

Migration Assays

Assays of chemotaxis and haptotaxis (migration toward matrix proteins) were performed in polycarbonate transwell inserts (5-µm pore [Costar]), some of which were coated at the bottom with 10 µg of collagen I or laminin-5 per milliliter,²⁶ as previously described.²⁷

Time-Lapse Videomicroscopy

Videomicroscopical analysis was performed with the use of an inverted microscope equipped with a video camera (SSC-M350CE CCD, Sony) coupled to a time-lapse videocassette recorder (SVT-5000P, Sony). Mesothelial cells from omentum were subjected to mechanical injury with an adapted cell scraper approximately 1500 µm in width and recorded for two to three days until the "wound" closed in an incubator that maintained the sample at 37°C in an environment containing 5 percent carbon dioxide. Digitalization of the images was performed with the use of Optimas software (version 5.2, Bioscan).

Results

Morphologic Changes in Mesothelial Cells during Peritoneal Dialysis

Mesothelial-cell cultures from effluents from patients undergoing continuous ambulatory peritoneal dialysis had markedly varied morphologic features, ranging from a cobblestone-like appearance similar to that of mesothelium derived from omentum to fibroblast-like cells or mixed cell populations (Figure 1A). The prevalence of nonepithelioid cells appeared to be related both to the duration of continuous ambulatory peritoneal dialysis in each patient (Figure 1B) and to whether and when hemoperitoneum or peritonitis had occurred. Fibroblast-like mesothelial cells appeared sporadically in samples in which hemorrhage or infiltrating lymphoid cells were present in the effluent, and a reversion to cobblestone or transitional phenotype was evident (in eight of eight cases) when cultures from the same patient were analyzed after the episode of peritonitis or hemoperitoneum had resolved (Figure 1C).

View larger version (45K): [in this window] [in a new window]   Figure 1. Morphologic Changes in Mesothelial Cells during Peritoneal Dialysis. Panel A shows photomicrographs (x200) of confluent monolayers of the various cell preparations used in the study. Below the photomicrographs are flow-cytometric histograms of the various types of cells stained with monoclonal antibodies against cytokeratin or intercellular adhesion molecule 1 (ICAM-1). The gray lines represent negative controls. Panel B shows the relation between morphologic changes in mesothelial cultures and the duration of peritoneal dialysis. The mean (±SE) duration of peritoneal dialysis was 7±1 months among patients with cobblestone-like cultures and 13±2 months among those with nonepithelioid cultures (P=0.01 by Student's t-test). In addition, a test of linear tendency gave a 2 value of 6.193, with P=0.01 for the association of morphology with duration of dialysis. Panel C shows photomicrographs (x200) of mesothelial cells from effluent from the same patient during the course of an episode of hemoperitoneum (left-hand panel) and two months after remission of the pathologic process (right-hand panel).

 
To determine the nature of cells derived from effluent, the expression of cytokeratins, as typical epithelial markers, and of ICAM-1, which is constitutively expressed on mesothelial cells,²⁸ was analyzed. A high level of expression of cytokeratins was observed in omental mesothelial cells and effluent cells with cobblestone-like appearance (Figure 1A). Cells derived from effluent showed a progressive reduction in the expression of cytokeratins, although even in cultures of fibroblast-like cells, a small population of positive cells was maintained (Figure 2). Two peaks of keratin expression were observed in mixed cultures, whereas keratin expression was absent from fibroblasts from omentum. However, all cells from effluent, even in mixed cultures, had a high level of homogeneous expression of ICAM-1 that was independent of their morphologic features. In contrast, ICAM-1 expression was negligible on fibroblasts taken directly from both omentum and skin (Figure 1A), supporting the theory that fibroblastoid cells in effluent have a mesothelial origin and their presence is not the result of contamination by fibroblasts.

View larger version (50K): [in this window] [in a new window]   Figure 2. Epithelial-to-Mesenchymal Transition of Mesothelial Cells during Peritoneal Dialysis. Total cell lysates of the various preparations of mesothelial cells were sequentially subjected to Western blotting (Panel A) with monoclonal antibodies against E-cadherin, cytokeratins, and vimentin. The chemiluminescence signal was quantified and normalized with respect to tubulin expression. The graph in Panel A shows the mean (±SE) levels of expression in four different samples. Panel B shows projections (x630) of confocal stacks of confluent monolayers of mesothelial cells derived from omentum or fibroblastic cells from effluent, stained with monoclonal antibodies against E-cadherin, cytokeratins, or vimentin, or with phalloidin. The phenotypic changes typical of an epithelial-to-mesenchymal transition are apparent. Panel C shows vertical sections (x630) of confluent monolayers of mesothelial cells derived from omentum, cobblestone-like mesothelial cells, and fibroblast-like mesothelial cells; the samples have been stained with monoclonal antibodies against CD9 (VJ1/20), highlighting the three-dimensional structure of the cells.

 
Epithelial-to-Mesenchymal Transition in Vivo

The morphologic changes and down-regulation of keratin in mesothelial cells derived from effluent could be indicative of an epithelial-to-mesenchymal transition.¹⁷ We analyzed the expression of E-cadherin and the intermediate filament proteins cytokeratin and vimentin by Western blotting, as markers of transdifferentiation. There was a markedly lower level of E-cadherin expression in cobblestone and nonepithelioid mesothelial cultures than in omental cultures (Figure 2A). The expression of cytokeratins (Figure 2A) paralleled that of E-cadherin, whereas there was greater vimentin expression in nonepithelioid mesothelial cultures.

Confocal immunofluorescence microscopy demonstrated the loss of intercellular E-cadherin and the reorganization of the actin cytoskeleton from the cortical band typical of epithelial cells to fibroblastic stress fibers (Figure 2B). Cytokeratin was replaced by vimentin, although some fibroblastoid mesothelial cells were still positive for keratin. Preparations stained for CD9 (Figure 2C), which is expressed at apical microvilli and intercellular contacts,²⁹ showed a gradual loss of cuboid epithelial morphologic features, which was already evident in cobblestone-like mesothelial cells that were half as high as omental mesothelium in confocal vertical sections. Fibroblast-like mesothelial cells lost contact inhibition and frequently piled up on one another.

Effects of Mechanical Injury, TGF-1, and Interleukin-1

The behavior of mesothelial cells during in vitro wound healing was dynamically assessed after the mechanical denudation of confluent monolayers of cells derived from omentum. Mechanical stimulus was sufficient to induce migration of mesothelial cells, and migrating cells underwent a transitional transdifferentiation in which a mesenchymal morphology reverted to an epithelial aspect only after the monolayer was restored (Figure 3A, Figure 3B, Figure 3C, Figure 3D, Figure 3E, and Figure 3F). This effect was confined to cells at the edge of the wound and neighboring areas, whereas cells at a distance from the wound were not modified, reinforcing the theory that the mechanical stimulus was sufficient to induce transdifferentiation. Complete time-lapse video sequences appear in Supplementary Appendix 1 (available with the full text of this article at http://www.nejm.org).

View larger version (64K): [in this window] [in a new window]   Figure 3. Mesothelial Transdifferentiation in Vitro, Induced by Mechanical Injury, Transforming Growth Factor 1 and Interleukin-1. Confluent monolayers of mesothelial cells from omentum were mechanically wounded and allowed to migrate for two to three days. Representative photomicrographs of the video sequences from two independent experiments are shown (one in Panels A, B, and C; the other in Panels D, E, and F; all x200). Mesothelial cells with fibroblastic appearance are observed both in the front layer of migrating cells and behind, in the monolayer (arrows). This transition is only local, and cells distant from the wound maintain their epithelioid morphologic features (Panel C). Transdifferentiation is also reversed once the wound is repaired (Panel F). Panel G shows photomicrographs (x200) of mesothelial cells derived from omentum, some of which were left untreated and some of which were treated with 0.5 ng of transforming growth factor 1 (TGF-1) per milliliter, in some cases in combination with 2 ng of interleukin-1 per milliliter, for 48 hours. Total cell lysates of the various preparations of mesothelial cells, some of which were treated for 48 hours with 0.5 ng of TGF-1 per milliliter and 2 ng of interleukin-1 per milliliter, were sequentially subjected to Western blotting (Panel H) with monoclonal antibodies against E-cadherin, cytokeratins, vimentin, and tubulin. The chemiluminescence signal was quantified and normalized with respect to tubulin expression and was related to the levels of expression of untreated omental cells in an experiment that was representative of the three that were performed.

 
To determine whether TGF-1 and interleukin-1, two cytokines detected in effluents from patients undergoing continuous ambulatory peritoneal dialysis primarily during episodes of peritonitis,²⁴ could reproduce the phenotypic changes observed ex vivo, cultured mesothelial cells derived from omentum were treated with TGF-1 alone or in combination with interleukin-1. An additive morphologic effect of both stimuli could be observed (Figure 3G). E-cadherin expression was almost completely abolished (Figure 3H), and its localization at intercellular junctions could hardly be detected by immunofluorescence. Cytokeratin expression was also diminished, and an additive effect with interleukin-1 was observed. In contrast, these treatments were associated with an increment in vimentin expression.

Expression of snail in Mesothelial Cells Undergoing Epithelial-to-Mesenchymal Transition

Recently, a transcription factor called snail has been described as a potent repressor of E-cadherin expression and an inducer of epithelial-to-mesenchymal transition.^21,22,23 To determine whether snail expression was associated with the phenotypic changes observed in the cells of the peritoneal membrane in patients undergoing continuous ambulatory peritoneal dialysis, RT-PCR analysis was used to estimate the expression of this transcription factor, as well as that of E-cadherin, in mesothelial cells derived from effluent and omentum (Figure 4A). No snail messenger RNA (mRNA) signal was detected in omental cells, whereas a progressive increase in the expression of snail mRNA was observed in effluent preparations as the process of transdifferentiation progressed. A dramatic down-regulation of expression of E-cadherin mRNA was already apparent in effluent cells that had a cobblestone appearance, a finding consistent with the decrease in expression of E-cadherin protein (Figure 2A).

View larger version (41K): [in this window] [in a new window]   Figure 4. Transdifferentiation of Mesothelial Cells and Early Expression of the snail Transcription Factor. Cells obtained from human omentum and effluents from peritoneal dialysis (two samples per type of transdifferentiated cell) were analyzed for snail and E-cadherin messenger RNA (mRNA) expression (Panel A) by RT-PCR. Omental cells were stimulated with 0.5 ng of transforming growth factor 1 (TGF-1) per milliliter and 2 ng of interleukin-1 per milliliter at different times, and snail and E-cadherin mRNA expression was analyzed by RT-PCR (Panel B). Monolayers of omental cells were wounded and allowed to migrate, and the expression of snail and E-cadherin mRNA was analyzed by PCR at different times (Panel C).

 
Stimulation of cultured mesothelial cells with TGF-1 plus interleukin-1 revealed a rapid and transient induction of snail mRNA. E-cadherin mRNA was decreased by the time of the first observation and remained almost undetectable even after snail transcription had declined (Figure 4B). Similarly, after in vitro wound healing, a transient induction of snail mRNA was observed, which probably corresponded to the transitional process in the cells next to the wound. Since the majority of the cells were not involved in the wound-healing process, no down-regulation of E-cadherin was observed in the total population (Figure 4C).

Up-Regulation of ₂ Integrin and Acquisition of a Migratory Phenotype

Failure of ultrafiltration in patients undergoing continuous ambulatory peritoneal dialysis is accompanied by peritoneal fibrosis. Therefore, we analyzed the characteristics of matrix-adhesion receptors in mesothelial preparations. A rapid up-regulation of ₂ integrin expression was already evident in cobblestone-like mesothelium derived from effluent (Figure 5A and Figure 5B). In contrast, expression of ₃ integrin was augmented in cobblestone-like cells and diminished in late stages of epithelial-to-mesenchymal transition (transitional and fibroblastic mesothelial preparations). Similarly, expression of the integrin-associated tetraspanins CD9 and CD151 was down-regulated as the transdifferentiation progressed. TGF-1 plus interleukin-1 induced an increase in ₂ integrin in all the mesothelial preparations, whereas ₃ integrin was increased in omental samples and decreased in transdifferentiated transitional cells (Figure 5C). Interleukin-1 potentiated the effects of TGF-1, even though it did not affect integrin expression on its own.

View larger version (35K): [in this window] [in a new window]   Figure 5. Up-Regulation of 2 Integrin Expression and Down-Regulation of Expression of Tetraspanins through the Process of Mesothelial Transdifferentiation. Total cell lysates of the various preparations of mesothelial cells were sequentially subjected to Western blotting with antibodies against 2 integrin or 3 integrin and monoclonal antibodies against tubulin (Panel A). The chemiluminescence signal was quantified, normalized with respect to tubulin expression, and related to the levels of expression in omental cells. The graph shows the mean (±SE) levels of expression in four different samples. Panel B shows flow-cytometric histograms of the various preparations of cells stained for 1 integrin, 2 integrin, 3 integrin, CD9, or CD151. Total cell lysates of the various preparations of mesothelial cells, some of which were treated for 48 hours with 0.5 ng of transforming growth factor 1 (TGF-1) per milliliter and 2 ng of interleukin-1 per milliliter, were sequentially subjected to Western blotting with antibodies against 2 integrin or 3 integrin and monoclonal antibodies against tubulin (Panel C). The chemiluminescence signal was quantified and normalized with respect to tubulin expression in an experiment that was representative of the four that were performed.

 
Tetraspanins are functionally associated with cell migration.³⁰ The changes in the integrin repertoire and the switch from a keratin-based to a vimentin-based cytoskeleton could also affect the migratory capacity of mesothelial cells. We have observed that the transdifferentiation process was accompanied by a higher overall migratory capacity of mesothelial cells. Treatment with TGF-1 plus interleukin-1 enhanced the haptotaxis to collagen, the main ligand for ₂₁ integrin. Migration toward laminin-5 followed the changes in the expression of its receptor, ₃₁ integrin; it was enhanced in epithelioid cultures and reduced in transitional and fibroblastic cells (data not shown).

Evidence of Epithelial-to-Mesenchymal Transition of Mesothelial Cells in Peritoneal Tissue

Our data suggest that mesothelial cells undergo an epithelial-to-mesenchymal transition in the course of continuous ambulatory peritoneal dialysis. To confirm this hypothesis in vivo, we used immunohistochemical staining of peritoneal-biopsy specimens from nine patients who had been undergoing continuous ambulatory peritoneal dialysis for up to nine months and confirmed the loss of epithelial morphologic features on the monolayer of mesothelial cells in the early stages of this type of dialysis (Figure 6B). In biopsy specimens from eight patients who had undergone such dialysis for 8 to 77 months, the monolayer of mesothelial cells disappeared, and elongated mesothelial cells positive for cytokeratin and ICAM-1 were found embedded in the fibrotic tissue (Figure 6C and Figure 6D); these specimens corresponded to cultures of nonepithelioid mesothelial cells from effluent.

View larger version (83K): [in this window] [in a new window]   Figure 6. Evidence of Epithelial-to-Mesenchymal Transition of Mesothelial Cells in Peritoneal Tissue of Patients Undergoing Continuous Ambulatory Peritoneal Dialysis. Images show immunohistochemical analysis of peritoneal-tissue samples stained with anticytokeratin antibodies (Panels A, B, and C, x150) or with intercellular adhesion molecule 1 (ICAM-1) (Panel D, x180), developed with peroxidase or fast red. Panel A represents control peritoneal tissue from a patient undergoing unrelated abdominal surgery (this sample is representative of eight tissue samples examined). In Panel B, a patient who had been undergoing dialysis for only six months already has a loss of mesothelial-cell polarity (this sample is representative of nine samples from patients who had been undergoing dialysis for nine months or less). Panel C (8 months of dialysis) and the inset (34 months of dialysis) represent the late stages of the transdifferentiation process in patients who have been undergoing dialysis for a long time; at this stage, fibroblast-like mesothelial cells are detected invading the fibrotic tissue (these samples are representative of eight samples obtained from patients who had been undergoing dialysis for 8 to 77 months). Panel D shows the staining with ICAM-1 of the biopsy specimen shown in Panel C.

 
Discussion

Peritoneal dialysis is an increasingly common alternative to hemodialysis. However, the procedure subjects mesothelial cells to high osmotic pressure and bioincompatible substances. Studies using standard histologic techniques on peritoneum from patients undergoing continuous ambulatory peritoneal dialysis show a complete loss of the monolayer of mesothelial cells and fibrosis, which might be responsible for the ultimate functional failure of the peritoneal membrane.¹ Our data show that mesothelial cells undergo a transition from an epithelial phenotype to a mesenchymal phenotype during peritoneal dialysis, with the induction of snail expression and a dramatic down-regulation of E-cadherin expression. Moreover, these findings are evidence of a direct and active role of mesothelial cells in the tissue fibrosis and failure of ultrafiltration in this process, generating new fibroblastic cells and leading to peritoneal fibrosis.

Previous studies have characterized the cobblestone-like mesothelial cells from peritoneal effluents as indistinguishable from mesothelial cells derived from omentum.¹⁰ However, even early in continuous ambulatory peritoneal dialysis, a loss of cuboid morphology is observed both in vivo and ex vivo, accompanied by an induction of snail expression that down-regulates E-cadherin expression, even when cells retain an epithelioid appearance. If peritoneal dialysis is continued, long-term exposure to mechanical denudation, profibrotic factors such as TGF-, and inflammatory cytokines may induce a complete transition of mesothelial cells, which could be responsible for tissue fibrosis and failure of ultrafiltration. Patients with recurrent episodes of peritonitis have high levels of expression of TGF-²⁴ and have accelerated failure of ultrafiltration.⁴

The fact that mesothelial cells undergo epithelial-to-mesenchymal transition during continuous ambulatory peritoneal dialysis may change our view of the pathophysiology of ultrafiltration failure. Our data reveal a series of markers such as snail, E-cadherin, and ₂ integrin that are already modified in the early phases of the transdifferentiation process. In addition, ICAM-1 appears to be a potential marker that discriminates between mesothelial cells and fibroblasts. All these markers may be useful in the follow-up of patients undergoing peritoneal dialysis and in the development of new solutions for peritoneal dialysis. Furthermore, these data suggest new therapeutic targets that might ultimately prevent the fibrosis associated with continuous ambulatory peritoneal dialysis.

Supported by Fresenius Medical Care; by grants (01/0063-02 to Dr. Selgas and 00/0602 to Dr. López-Cabrera) from the Fondo de Investigaciones Sanitarias; and by a grant (02-00536 to Dr. Sánchez-Madrid) from the Programa de Biología Molecular y Celular.

We are indebted to Angela Nieto for critical discussion and to Francisco Rodríguez for statistical analysis of the data.

Source Information

From the Servicio de Inmunología (M.Y.-M., M.R.-H., C.D.-J., F.S.-M.), Biología Molecular (E.L.-P., C.G., M.L.-C.), and Nefrología (R.S., A.A., J.A.S.-T., V.A., A.C.), Hospital Universitario de la Princesa, Universidad Autónoma de Madrid; the Servicio de Nefrología, Hospital Universitario La Paz (M.A.B., M.A.C., G.P.); and the Instituto Reina Sofía de Investigaciones Nefrológicas (M.Y.-M., E.L.-P., R.S., M.R.-H., C.D.-J., J.A.J.-H., A.A., J.A.S.-T., M.A.B., V.A., M.A.C., G.P., A.C., C.G., F.S.-M., M.L.-C.) — all in Madrid; the Servicio de Anatomía Patológica, Hospital Universitario de Guadalajara, Guadalajara, Spain (J.A.J.-H.).

Drs. Yáñez-Mó and Lara-Pezzi contributed equally to the article.

Address reprint requests to Dr. López-Cabrera at the Departamento de Biología Molecular, Hospital Universitario de la Princesa, C/Diego de León no. 62, 28006 Madrid, Spain, or at mlopez{at}hlpr.insalud.es.

References

1. Krediet RT. The peritoneal membrane in chronic peritoneal dialysis patients. Kidney Int 1999;55:341-356. [CrossRef][Web of Science][Medline]
2. Brulez HF, Verbrugh HA. First-line defense mechanisms in the peritoneal cavity during peritoneal dialysis. Perit Dial Int 1995;15:Suppl:S24-S33. [Free Full Text]
3. Chaimovitz C. Peritoneal dialysis. Kidney Int 1994;45:1226-1240. [Erratum, Kidney Int 1994;46:285.] [Medline]
4. Selgas R, Fernández-Reyes MJ, Bosque E, et al. Functional longevity of the human peritoneum: how long is continuous peritoneal dialysis possible? Results of a prospective medium long-term study. Am J Kidney Dis 1994;23:64-73. [Web of Science][Medline]
5. Dobbie JW. Pathogenesis of peritoneal fibrosing syndromes (sclerosing peritonitis) in peritoneal dialysis. Perit Dial Int 1992;12:14-27. [Web of Science][Medline]
6. Fang CC, Yen C-J, Chen Y-M, et al. Pentoxifylline inhibits human peritoneal mesothelial cell growth and collagen synthesis: effects of TGF-. Kidney Int 2000;57:2626-2633. [CrossRef][Web of Science][Medline]
7. Medcalf JF, Walls J, Pawluczyk IZ, Harris KPG. Effects of glucose dialysate on extracellular matrix production by human peritoneal mesothelial cells (HPMC): the role of TGF-. Nephrol Dial Transplant 2001;16:1885-1892. [Free Full Text]
8. Rampino T, Cancarini G, Gregorini M, et al. Hepatocyte growth factor/scatter factor released during peritonitis is active on mesothelial cells. Am J Pathol 2001;159:1275-1285. [Free Full Text]
9. Yang WS, Kim BS, Lee SK, Park JS, Kim SB. Interleukin-1 stimulates the production of extracellular matrix in cultured human peritoneal mesothelial cells. Perit Dial Int 1999;19:211-220. [Free Full Text]
10. Leavesley DI, Stanley JM, Faull RJ. Epidermal growth factor modifies the expression and function of extracellular matrix adhesion receptors expressed by peritoneal mesothelial cells from patients on CAPD. Nephrol Dial Transplant 1999;14:1208-1216. [Free Full Text]
11. Connell ND, Rheinwald JG. Regulation of the cytoskeleton in mesothelial cells: reversible loss of keratin and increase in vimentin during rapid growth in culture. Cell 1983;34:245-253. [CrossRef][Web of Science][Medline]
12. Faull RJ, Stanley JM, Fraser S, Power DA, Leavesley DI. HB-EGF is produced in the peritoneal cavity and enhances mesothelial cell adhesion and migration. Kidney Int 2001;59:614-624. [CrossRef][Web of Science][Medline]
13. Ha H, Yu MR, Lee HB. High glucose-induced PKC activation mediates TGF-1 and fibronectin synthesis by peritoneal mesothelial cells. Kidney Int 2001;59:463-470. [CrossRef][Web of Science][Medline]
14. Ito T, Yorioka N, Yamamoto M, Kataoka K, Yamakido M. Effect of glucose on intercellular junctions of cultured human peritoneal mesothelial cells. J Am Soc Nephrol 2000;11:1969-1979. [Free Full Text]
15. Massagué J. TGF- signal transduction. Annu Rev Biochem 1998;67:753-791. [CrossRef][Web of Science][Medline]
16. Margetts PJ, Kolb M, Galt T, Hoff CM, Shockley TR, Gauldie J. Gene transfer of transforming growth factor-1 to the rat peritoneum: effects on membrane function. J Am Soc Nephrol 2001;12:2029-2039. [Free Full Text]
17. Hay ED. An overview of epithelio-mesenchymal transformation. Acta Anat (Basel) 1995;154:8-20. [Web of Science][Medline]
18. Birchmeier C, Birchmeier W, Brand-Saberi B. Epithelial-mesenchymal transitions in cancer progression. Acta Anat (Basel) 1996;156:217-226. [Web of Science][Medline]
19. Perl AK, Wilgenbus P, Dahl U, Semb H, Christofori G. A causal role for E-cadherin in the transition from adenoma to carcinoma. Nature 1998;392:190-193. [CrossRef][Medline]
20. Takeichi M. Morphogenetic roles of classic cadherins. Curr Opin Cell Biol 1995;7:619-627. [CrossRef][Web of Science][Medline]
21. Batlle E, Sancho E, Franci C, et al. The transcription factor snail is a repressor of E-cadherin gene expression in epithelial tumour cells. Nat Cell Biol 2000;2:84-89. [CrossRef][Web of Science][Medline]
22. Cano A, Pérez-Moreno MA, Rodrigo I, et al. The transcription factor snail controls epithelial-mesenchymal transitions by repressing E-cadherin expression. Nat Cell Biol 2000;2:76-83. [CrossRef][Web of Science][Medline]
23. Carver EA, Jiang R, Lan Y, Oram KF, Gridley T. The mouse snail gene encodes a key regulator of the epithelial-mesenchymal transition. Mol Cell Biol 2001;21:8184-8188. [Free Full Text]
24. Lai KN, Lai KB, Lam CW, Chan TM, Li FK, Leung JC. Changes of cytokine profiles during peritonitis in patients on continuous ambulatory peritoneal dialysis. Am J Kidney Dis 2000;35:644-652. [Web of Science][Medline]
25. Yáñez-Mó M, Alfranca A, Cabañas C, et al. Regulation of endothelial cell motility by complexes of tetraspan molecules CD81/TAPA-1 and CD151/PETA-3 with 31 integrin localized at endothelial lateral junctions. J Cell Biol 1998;141:791-804. [Free Full Text]
26. Rousselle P, Golbik R, van der Rest M, Aumailley M. Structural requirement for cell adhesion to kalinin (laminin-5). J Biol Chem 1995;270:13766-13770. [Free Full Text]
27. Lara-Pezzi E, Serrador JM, Montoya MC, et al. The hepatitis B virus X protein (HBx) induces a migratory phenotype in a CD44-dependent manner: possible role of HBx in invasion and metastasis. Hepatology 2001;33:1270-1281. [CrossRef][Medline]
28. Suassuna JH, Neves FCD, Hartley RB, Ogg CS, Cameron JS. Immunohistochemical studies of the peritoneal membrane and infiltrating cells in normal subjects and in patients on CAPD. Kidney Int 1994;46:443-454. [Web of Science][Medline]
29. Yáñez-Mó M, Tejedor R, Rousselle P, Sánchez-Madrid F. Tetraspanins in intercellular adhesion of polarized epithelial cells: spatial and functional relationship to integrins and cadherins. J Cell Sci 2001;114:577-587. [Abstract]
30. Hemler ME. Integrin associated proteins. Curr Opin Cell Biol 1998;10:578-585. [CrossRef][Web of Science][Medline]

Abstract PDF PDA Full Text PowerPoint Slide Set Supplementary Material Letters Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited E-mail When Letters Appear Related Article PubMed Citation

Related Letters:

Peritoneal Dialysis and Epithelial-to-Mesenchymal Transition
Stein J. A., Mannello F., Rampino T., Dal Canton A., Yáñez-Mó M., Lara-Pezzi E., López-Cabrera M.
Extract | Full Text | PDF  
N Engl J Med 2003; 348:2037-2039, May 15, 2003. Correspondence

This article has been cited by other articles:

• Guest, S. (2009). HYPOTHESIS: GENDER AND ENCAPSULATING PERITONEAL SCLEROSIS. pdi 29: 489-491 [Full Text]  
• Nasreen, N., Mohammed, K. A., Mubarak, K. K., Baz, M. A., Akindipe, O. A., Fernandez-Bussy, S., Antony, V. B. (2009). Pleural mesothelial cell transformation into myofibroblasts and haptotactic migration in response to TGF-{beta}1 in vitro. Am. J. Physiol. Lung Cell. Mol. Physiol. 297: L115-L124 [Abstract] [Full Text]  
• Guest, S. (2009). TAMOXIFEN THERAPY FOR ENCAPSULATING PERITONEAL SCLEROSIS: MECHANISM OF ACTION AND UPDATE ON CLINICAL EXPERIENCES. pdi 29: 252-255 [Full Text]  
• Horiuchi, T., Matsunaga, K., Banno, M., Nakano, Y., Nishimura, K., Hanzawa, C., Miyamoto, K.-i., Nomura, S., Ohta, Y. (2009). HPMCs INDUCE GREATER INTERCELLULAR DELOCALIZATION OF TIGHT JUNCTION-ASSOCIATED PROTEINS DUE TO A HIGHER SUSCEPTIBILITY TO H2O2 COMPARED WITH HUVECs. pdi 29: 217-226 [Abstract] [Full Text]  
• Gonzalez-Mateo, G. T., Loureiro, J., Jimenez-Hefferman, J. A., Bajo, M.-A., Selgas, R., Lopez-Cabrera, M., Aroeira, L. S. (2009). Chronic Exposure of Mouse Peritoneum to Peritoneal Dialysis Fluid: Structural and Functional Alterations of the Peritoneal Membrane. pdi 29: 227-230 [Full Text]  
• Aroeira, L. S., Lara-Pezzi, E., Loureiro, J., Aguilera, A., Ramirez-Huesca, M., Gonzalez-Mateo, G., Perez-Lozano, M. L., Albar-Vizcaino, P., Bajo, M-A., del Peso, G., Sanchez-Tomero, J. A., Jimenez-Heffernan, J. A., Selgas, R., Lopez-Cabrera, M. (2009). Cyclooxygenase-2 Mediates Dialysate-Induced Alterations of the Peritoneal Membrane. J. Am. Soc. Nephrol. 20: 582-592 [Abstract] [Full Text]  
• Yu, M.-A, Shin, K.-S., Kim, J. H., Kim, Y.-I., Chung, S. S., Park, S.-H., Kim, Y.-L., Kang, D.-H. (2009). HGF and BMP-7 Ameliorate High Glucose-Induced Epithelial-to-Mesenchymal Transition of Peritoneal Mesothelium. J. Am. Soc. Nephrol. 20: 567-581 [Abstract] [Full Text]  
• Cina, D., Patel, P., Bethune, J. C., Thoma, J., Rodriguez-Lecompte, J. C., Hoff, C. M., Liu, L., Margetts, P. J. (2009). Peritoneal morphological and functional changes associated with platelet-derived growth factor B. Nephrol Dial Transplant 24: 448-457 [Abstract] [Full Text]  
• Hirahara, I., Ishibashi, Y., Kaname, S., Kusano, E., Fujita, T. (2009). Methylglyoxal induces peritoneal thickening by mesenchymal-like mesothelial cells in rats. Nephrol Dial Transplant 24: 437-447 [Abstract] [Full Text]  
• Yung, S., Chan, T. M. (2009). INTRINSIC CELLS: MESOTHELIAL CELLS -- CENTRAL PLAYERS IN REGULATING INFLAMMATION AND RESOLUTION. pdi 29: S21-S27 [Abstract] [Full Text]  
• Santamaria, B., Ucero, A. C., Benito-Martin, A., Selgas, R., Ruiz-Ortega, M., Sanz, A. B., Egido, J., Ortiz, A. (2009). TAMING APOPTOSIS IN PERITONEAL DIALYSIS. pdi 29: S45-S48 [Abstract] [Full Text]  
• Cueto-Manzano, A. M. (2009). RAPID SOLUTE TRANSPORT IN THE PERITONEUM: PHYSIOLOGIC AND CLINICAL CONSEQUENCES. pdi 29: S90-S95 [Abstract] [Full Text]  
• Kim, Y.-L. (2009). UPDATE ON MECHANISMS OF ULTRAFILTRATION FAILURE. pdi 29: S123-S127 [Abstract] [Full Text]  
• Schilte, M. N., Loureiro, J., Keuning, E. D., Wee, P. M. t., Celie, J. W.A.M., Beelen, R. H.J., van den Born, J. (2009). LONG-TERM INTERVENTION WITH HEPARINS IN A RAT MODEL OF PERITONEAL DIALYSIS. pdi 29: 26-35 [Abstract] [Full Text]  
• Vargha, R., Bender, T. O., Riesenhuber, A., Endemann, M., Kratochwill, K., Aufricht, C. (2008). Effects of epithelial-to-mesenchymal transition on acute stress response in human peritoneal mesothelial cells. Nephrol Dial Transplant 23: 3494-3500 [Abstract] [Full Text]  
• Kihm, L. P., Wibisono, D., Muller-Krebs, S., Pfisterer, F., Morath, C., Gross, M. L., Morcos, M., Seregin, Y., Bierhaus, A., Nawroth, P. P., Zeier, M., Schwenger, V. (2008). RAGE expression in the human peritoneal membrane. Nephrol Dial Transplant 23: 3302-3306 [Abstract] [Full Text]  
• Santamaria, B., Ucero, A. C., Reyero, A., Selgas, R., Ruiz-Ortega, M., Catalan, M., Egido, J., Ortiz, A. (2008). 3,4-Dideoxyglucosone-3-ene as a mediator of peritoneal demesothelization. Nephrol Dial Transplant 23: 3307-3315 [Abstract] [Full Text]  
• Yagi, H., Yotsumoto, F., Miyamoto, S. (2008). Heparin-binding epidermal growth factor-like growth factor promotes transcoelomic metastasis in ovarian cancer through epithelial-mesenchymal transition. Molecular Cancer Therapeutics 7: 3441-3451 [Abstract] [Full Text]  
• Struijk, D. G. (2008). Monitoring of the peritoneal membrane. NDT Plus 1: iv29-iv35 [Abstract] [Full Text]  
• Szeto, C.-C., Chow, K.-M., Kwan, B. C.-H., Lai, K.-B., Chung, K.-Y., Leung, C.-B., Li, P. K.-T. (2008). The relationship between bone morphogenic protein-7 and peritoneal transport characteristics. Nephrol Dial Transplant 23: 2989-2994 [Abstract] [Full Text]  
• Wali, R. K., Kunte, D. P., Koetsier, J. L., Bissonnette, M., Roy, H. K. (2008). Polyethylene glycol-mediated colorectal cancer chemoprevention: roles of epidermal growth factor receptor and Snail. Molecular Cancer Therapeutics 7: 3103-3111 [Abstract] [Full Text]  
• Flessner, M. F. (2008). Distributed model of peritoneal transport: implications of the endothelial glycocalyx. Nephrol Dial Transplant 23: 2142-2146 [Full Text]  
• Decologne, N., Kolb, M., Margetts, P. J., Menetrier, F., Artur, Y., Garrido, C., Gauldie, J., Camus, P., Bonniaud, P. (2007). TGF-beta1 Induces Progressive Pleural Scarring and Subpleural Fibrosis. J. Immunol. 179: 6043-6051 [Abstract] [Full Text]  
• Flessner, M. F., Credit, K., Henderson, K., Vanpelt, H. M., Potter, R., He, Z., Henegar, J., Robert, B. (2007). Peritoneal Changes after Exposure to Sterile Solutions by Catheter. J. Am. Soc. Nephrol. 18: 2294-2302 [Abstract] [Full Text]  
• Aroeira, L. S., Aguilera, A., Sanchez-Tomero, J. A., Bajo, M. A., del Peso, G., Jimenez-Heffernan, J. A., Selgas, R., Lopez-Cabrera, M. (2007). Epithelial to Mesenchymal Transition and Peritoneal Membrane Failure in Peritoneal Dialysis Patients: Pathologic Significance and Potential Therapeutic Interventions. J. Am. Soc. Nephrol. 18: 2004-2013 [Abstract] [Full Text]  
• Lai, K. N., Tang, S. C.W., Leung, J. C.K. (2007). MEDIATORS OF INFLAMMATION AND FIBROSIS. pdi 27: S65-S71 [Abstract] [Full Text]  
• Hung, K.-Y., Wu, K.-D., Tsai, T.-J. (2007). IN VITRO STUDY OF PERITONEAL FIBROSIS. pdi 27: S72-S75 [Abstract] [Full Text]  
• Yung, S., Chan, T. M. (2007). MESOTHELIAL CELLS. pdi 27: S110-S115 [Abstract] [Full Text]  
• Bargman, J. M. (2007). New Technologies in Peritoneal Dialysis. CJASN 2: 576-580 [Abstract] [Full Text]  
• Yang, A.-H., Huang, S.-W., Chen, J.-Y., Lin, J.-K., Chen, C.-Y. (2007). Leptin augments myofibroblastic conversion and fibrogenic activity of human peritoneal mesothelial cells: A functional implication for peritoneal fibrosis. Nephrol Dial Transplant 22: 756-762 [Abstract] [Full Text]  
• Hirahara, I., Inoue, M., Okuda, K., Ando, Y., Muto, S., Kusano, E. (2007). The potential of matrix metalloproteinase-2 as a marker of peritoneal injury, increased solute transport, or progression to encapsulating peritoneal sclerosis during peritoneal dialysis--a multicentre study in Japan. Nephrol Dial Transplant 22: 560-567 [Abstract] [Full Text]  
• Vargha, R., Endemann, M., Kratochwill, K., Riesenhuber, A., Wick, N., Krachler, A.-M., Malaga-Dieguez, L., Aufricht, C. (2006). Ex vivo reversal of in vivo transdifferentiation in mesothelial cells grown from peritoneal dialysate effluents. Nephrol Dial Transplant 21: 2943-2947 [Abstract] [Full Text]  
• De Vriese, A. S., Tilton, R. G., Mortier, S., Lameire, N. H. (2006). Myofibroblast transdifferentiation of mesothelial cells is mediated by RAGE and contributes to peritoneal fibrosis in uraemia. Nephrol Dial Transplant 21: 2549-2555 [Abstract] [Full Text]  
• Roy, H. K., Kunte, D. P., Koetsier, J. L., Hart, J., Kim, Y. L., Liu, Y., Bissonnette, M., Goldberg, M., Backman, V., Wali, R. K. (2006). Chemoprevention of colon carcinogenesis by polyethylene glycol: suppression of epithelial proliferation via modulation of SNAIL/{beta}-catenin signaling.. Molecular Cancer Therapeutics 5: 2060-2069 [Abstract] [Full Text]  
• Fang, C.-C., Yen, C.-J., Chen, Y.-M., Chu, T.-S., Lin, M.-T., Yang, J.-Y., Tsai, T.-J. (2006). Diltiazem suppresses collagen synthesis and IL-1{beta}-induced TGF-{beta}1 production on human peritoneal mesothelial cells. Nephrol Dial Transplant 21: 1340-1347 [Abstract] [Full Text]  
• Peiro, S., Escriva, M., Puig, I., Barbera, M. J., Dave, N., Herranz, N., Larriba, M. J., Takkunen, M., Franci, C., Munoz, A., Virtanen, I., Baulida, J., de Herreros, A. G. (2006). Snail1 transcriptional repressor binds to its own promoter and controls its expression.. Nucleic Acids Res 34: 2077-2084 [Abstract] [Full Text]  
• Ward, C, Forrest, I A, Murphy, D M, Johnson, G E, Robertson, H, Cawston, T E, Fisher, A J, Dark, J H, Lordan, J L, Kirby, J A, Corris, P A (2005). Phenotype of airway epithelial cells suggests epithelial to mesenchymal cell transition in clinically stable lung transplant recipients. Thorax 60: 865-871 [Abstract] [Full Text]  
• Barrallo-Gimeno, A., Nieto, M. A. (2005). The Snail genes as inducers of cell movement and survival: implications in development and cancer. Development 132: 3151-3161 [Abstract] [Full Text]  
• Yamasaki, H., Sekimoto, T., Ohkubo, T., Douchi, T., Nagata, Y., Ozawa, M., Yoneda, Y. (2005). Zinc finger domain of Snail functions as a nuclear localization signal for importin {beta}-mediated nuclear import pathway. GENES CELLS 10: 455-464 [Abstract] [Full Text]  
• Flessner, M. F. (2005). The transport barrier in intraperitoneal therapy. Am. J. Physiol. Renal Physiol. 288: F433-F442 [Abstract] [Full Text]  
• Margetts, P. J., Bonniaud, P., Liu, L., Hoff, C. M., Holmes, C. J., West-Mays, J. A., Kelly, M. M. (2005). Transient Overexpression of TGF-{beta}1 Induces Epithelial Mesenchymal Transition in the Rodent Peritoneum. J. Am. Soc. Nephrol. 16: 425-436 [Abstract] [Full Text]  
• Peinado, H., Marin, F., Cubillo, E., Stark, H.-J., Fusenig, N., Nieto, M. A., Cano, A. (2004). Snail and E47 repressors of E-cadherin induce distinct invasive and angiogenic properties in vivo. J. Cell Sci. 117: 2827-2839 [Abstract] [Full Text]  
• Vega, S., Morales, A. V., Ocana, O. H., Valdes, F., Fabregat, I., Nieto, M. A. (2004). Snail blocks the cell cycle and confers resistance to cell death. Genes Dev. 18: 1131-1143 [Abstract] [Full Text]  
• Gillerot, G., Debaix, H., Devuyst, O. (2004). Genotyping: a new application for the spent dialysate in peritoneal dialysis. Nephrol Dial Transplant 19: 1298-1301 [Abstract] [Full Text]  
• Witowski, J., Korybalska, K., Ksiazek, K., Wisniewska-Elnur, J., Jorres, A., Lage, C., Schaub, T. P., Passlick-Deetjen, J., Breborowicz, A., Grzegorzewska, A., Ksiazek, A., Liberek, T., Lichodziejewska-Niemierko, M., Majdan, M., Rutkowski, B., Stompor, T., Sulowicz, W. (2004). Peritoneal dialysis with solutions low in glucose degradation products is associated with improved biocompatibility profile towards peritoneal mesothelial cells. Nephrol Dial Transplant 19: 917-924 [Abstract] [Full Text]  
• Sun, X., Gulyas, M., Hjerpe, A. (2004). Mesothelial Differentiation as Reflected by Differential Gene Expression. Am. J. Respir. Cell Mol. Bio. 30: 510-518 [Abstract] [Full Text]  
• Buemi, M., Aloisi, C., Cutroneo, G., Nostro, L., Favaloro, A. (2004). Flowing time on the peritoneal membrane. Nephrol Dial Transplant 19: 26-29 [Full Text]  
• Demir, A.Y., Groothuis, P.G., Nap, A.W., Punyadeera, C., Goeij, A.F.P.M.d., Evers, J.L.H., Dunselman, G.A.J. (2004). Menstrual effluent induces epithelial-mesenchymal transitions in mesothelial cells. Hum Reprod 19: 21-29 [Abstract] [Full Text]  
• Lee, Y.C.G., Lane, K.B., Zoia, O., Thompson, P.J., Light, R.W., Blackwell, T.S. (2003). Transforming growth factor-{beta} induces collagen synthesis without inducing IL-8 production in mesothelial cells. Eur Respir J 22: 197-202 [Abstract] [Full Text]  
• Peinado, H., Quintanilla, M., Cano, A. (2003). Transforming Growth Factor {beta}-1 Induces Snail Transcription Factor in Epithelial Cell Lines: MECHANISMS FOR EPITHELIAL MESENCHYMAL TRANSITIONS. J. Biol. Chem. 278: 21113-21123 [Abstract] [Full Text]  
• Stein, J. A., Mannello, F., Rampino, T., Dal Canton, A., Yanez-Mo, M., Lara-Pezzi, E., Lopez-Cabrera, M. (2003). Peritoneal Dialysis and Epithelial-to-Mesenchymal Transition. NEJM 348: 2037-2039 [Full Text]