Signaling Molecules in Nonfamilial Pulmonary Hypertension
Lingling Du, M.D., Christopher C. Sullivan, M.S., Danny Chu, M.D., Augustine J. Cho, B.A., Masakuni Kido, M.D., Paul L. Wolf, M.D., Jason X.-J. Yuan, M.D., Ph.D., Reena Deutsch, Ph.D., Stuart W. Jamieson, M.B., F.R.C.S., and Patricia A. Thistlethwaite, M.D., Ph.D.
Background Biochemical, genetic, and clinical evidence indicatesthat smooth-muscle proliferation around small pulmonary vesselsis an essential part of the pathogenesis of pulmonary hypertension.Mutations in the bone morphogenetic protein receptor type 2(BMPR2) have been linked to familial cases of pulmonary hypertension,but the molecular basis of the common nonfamilial forms is unknown.
Methods We evaluated the pattern of expression of angiopoietin-1,a protein involved in the recruitment of smooth-muscle cellsaround blood vessels; TIE2, the endothelial-specific receptorfor angiopoietin-1; and bone morphogenetic protein receptortype 1A (BMPR1A) and BMPR2 in lung-biopsy specimens from patientswith pulmonary hypertension and from normotensive control patients.The effect of angiopoietin-1 on the modulation of BMPR expressionwas also evaluated in subcultures of human pulmonary arteriolarendothelial cells.
Results The expression of angiopoietin-1 messenger RNA and theprotein itself and the phosphorylation of TIE2 were stronglyup-regulated in the lungs of patients with various forms ofpulmonary hypertension, correlating directly with the severityof disease. A mechanistic link between familial and acquiredpulmonary hypertension was demonstrated by the finding thatangiopoietin-1 shuts off the expression of BMPR1A, a transmembraneprotein required for BMPR2 signaling, in pulmonary arteriolarendothelial cells. Similarly, we found that the expression ofBMPR1A was severely reduced in the lungs of patients with variousforms of acquired as well as primary nonfamilial pulmonary hypertension.
Conclusions These findings suggest that all forms of pulmonaryhypertension are linked by defects in the signaling pathwayinvolving angiopoietin-1, TIE2, BMPR1A, and BMPR2 and consequentlyidentify specific molecular targets for therapeutic intervention.
The pulmonary vascular bed is a high-flow, low-pressure circuitthat has the capacity to dilate and recruit unused vasculaturein order to accommodate increases in blood flow. In pulmonaryhypertension, this capacity is lost, resulting in elevated pulmonaryarterial pressure at rest and further increases in pressurewith exercise.1 At the cellular level, this pathologic processis characterized by the proliferation of vascular smooth-musclecells and asymmetric neointimal hyperplasia in small pulmonaryarteries and arterioles.2 The molecular mechanism underlyingthe vasculopathy responsible for pulmonary hypertension is unknown.
Recently, heterozygous mutations have been characterized inthe gene for bone morphogenetic protein receptor type 2 (BMPR2)in families with inherited pulmonary hypertension.3,4 Mutationswere found to occur at highly conserved sites, predicted toperturb heterodimerization with its sister receptor, bone morphogeneticprotein receptor type 1A (BMPR1A), or to disrupt the ligand-bindingfunction of this protein.5 In addition, missense, deletion,and nonsense mutations in the activin-receptor–like kinase1 gene (ALK1) have been identified in patients with hereditaryhemorrhagic telangiectasia in whom pulmonary hypertension develops.6However, most cases of pulmonary hypertension are sporadic orare due to a variety of causes, including hypoxia, thromboembolism,left-sided heart failure, and drugs.7 One puzzling aspect ofthis disease is whether any common molecular pathway underliesthe seemingly different causes of the same pulmonary vascularpathologic process.
Angiopoietin-1 is a 70-kD angiogenic factor essential for lungvascular development. Produced by smooth-muscle cells and precursorpericytes, angiopoietin-1 stabilizes the development of bloodvessels by recruiting muscle cells, through migration and division,to endothelial tubes, creating mature arterial structures.8,9Animals lacking angiopoietin-1 die in utero, with little arterialdevelopment in the lungs and other organs.10 The receptor forangiopoietin-1, TIE2, is present only on vascular endothelium.11The ligand–receptor interaction between angiopoietin-1secreted by smooth-muscle cells and endothelium-specific TIE2during organ development induces the proliferation of musclecells around the endothelial vascular network. After developmentis completed, angiopoietin-1 is expressed at a minimally detectablelevel in the human lung.12
Since angiopoietin-1 has been linked to the proliferation ofsmooth-muscle cells during blood-vessel development, we postulatedthe following: first, that the excessive muscularization ofpulmonary arterioles seen in most forms of pulmonary hypertensioncould be the result of aberrant overexpression of angiopoietin-1in the adult lung and, second, that constitutive expressionof angiopoietin-1 could be linked mechanistically to signalingby bone morphogenetic protein receptors (BMPRs) and the developmentof pulmonary hypertension through modulation of the expressionor function of this receptor. To test our hypotheses, we studiedthe expression and localization of angiopoietin-1, TIE2, andBMPR1A gene products in the lung in various forms of acquiredand nonfamilial primary pulmonary hypertension and investigatedthe ability of angiopoietin-1 to modulate the levels of BMPRin human pulmonary endothelial cells. Our goal was to establisha molecular fingerprint that unites different forms of thisdisease.
Methods
Collection of Specimens
Between July 2000 and January 2002, lung biopsy was performedin 22 consecutive patients undergoing pulmonary thromboendarterectomyfor thromboembolic pulmonary hypertension, 8 patients undergoinglung transplantation (5 with primary pulmonary hypertensionand 3 with pulmonary hypertension from scleroderma), 3 patientsundergoing heart–lung transplantation as a result of Eisenmenger'ssyndrome, 9 patients undergoing mitral-valve replacement becauseof mitral regurgitation and pulmonary hypertension, and 19 patientswithout pulmonary hypertension who were undergoing pulmonaryresection for benign causes (i.e., noncancerous pulmonary nodules).Written informed consent was obtained from each patient. Patientswho were undergoing thromboendarterectomy, transplantation,or mitral-valve surgery (the group with pulmonary hypertension)had a mean pulmonary vascular resistance of 929 dyn ·sec · cm–5 (range, 402 to 2040) and a mean pulmonary-arterysystolic pressure of 65 mm Hg (range, 50 to 110), whereas patientsundergoing pulmonary resection (the control group) had a meanpulmonary vascular resistance of 174 dyn · sec ·cm–5 (range, 145 to 210) and a mean pulmonary-artery systolicpressure of 18 mm Hg (range, 11 to 25). The group with pulmonaryhypertension and the control group were similar (P>0.08)with respect to age (52±7.4 and 54±9.3 years,respectively), proportion of men (48 percent and 53 percent),arterial oxygen tension at a fraction of inspired oxygen of100 percent (291±33.7 and 278±60.2 mm Hg), pulmonary-capillarywedge pressure (9.5±2.6 and 8.8±2.7 mm Hg), carbonmonoxide diffusing capacity (62±6.6 and 69±7.8percent of the predicted value), forced expiratory volume inone second (67±6.0 and 65±11.5 percent of thepredicted value), and hematocrit (38±1.9 and 39±3.4percent). The study was approved by the institutional reviewboard of the University of California, San Diego.
For patients with thromboembolic pulmonary hypertension, tissuewas obtained from the lobe determined to be most affected byocclusive disease on preoperative angiography. Patients withmitral-valve abnormalities underwent lingular biopsy, patientswho received a heart–lung transplant underwent biopsyof the upper and lower lobes of both lungs, and patients whoreceived a single lung transplant and control patients underwenta biopsy of the upper and lower lobe on the affected side. Specimenswere obtained before cardiopulmonary bypass was instituted orbefore lung resection was performed, during ventilation at afraction of inspired oxygen of 100 percent.
Sequence of BMPR2 and ALK1 in Patients with Primary Pulmonary Hypertension
The complementary DNA (cDNA) of BMPR2 and ALK1 was amplifiedfrom human-lung RNA by reverse transcriptase–polymerasechain reaction (RT-PCR), subcloned, and sequenced with use ofan ABI-PRISM 3100 genetic analyzer (Applied Biosystems). Sequencedata were compared with those in the National Center for BiotechnologyInformation Entrez Nucleotide data base (accession numbers,NM_001204 for BMPR2 and Z22533 for ALK1).
Purification of Angiopoietin-1 and Treatment of Endothelial Cells
An epitope tag, a C-terminal polyhistidine, was added to murineangiopoietin-1 cDNA, the cDNA was subcloned into a plasmid,and recombinant angiopoietin-1 protein was produced in BL21bacteria. The protein was purified with use of an affinity column(Ni-NTA, Stratagene). The size and the purity of recombinantangiopoietin-1 were verified by staining with Coomassie blueand immunoblotting, and the biologic activity of the proteinwas confirmed by the induction of TIE2-receptor phosphorylationin vitro.13
Primary pulmonary endothelial cells were isolated from arteriolesthat were 500 to 1500 µm in diameter from the lung tissueof normotensive subjects and grown to 60 percent confluence.Subcultures of these cells were incubated for two hours in serum-freemedium and treated with recombinant angiopoietin-1 protein (50ng per milliliter). Aliquots of cells were serially removedfor the quantitation of TIE2 phosphorylation and the expressionof BMPR1A.
Immunoprecipitation and Western Blotting
Western blotting was performed as previously described12 withgoat polyclonal anti-TIE2, mouse monoclonal anti-BMPR2 (R&DSystems), and goat polyclonal anti–angiopoietin-1, anti–angiopoietin-2,anti-BMPR1A, and anti-actin (Santa Cruz Biotechnology). TIE2phosphorylation was assessed by first incubating protein extractswith anti-TIE2 antibody prebound to protein G–coated agarosebeads (Roche). The immunoprecipitated proteins were then separatedby sodium dodecyl sulfate–polyacrylamide-gel electrophoresisand transferred to nitrocellulose. Quantitative TIE2 phosphorylationimmunoblotting was performed with anti-phosphotyrosine antibody(Cell Signaling Technology). The blots were washed and probedagain with goat anti-TIE2 to verify equal levels of TIE2.
RT-PCR and Northern Blotting
RT-PCR was performed as previously described,14 with the useof the following primers: angiopoietin-1, 5'GGCAACTGTCGTGAGAGTACGA3'and 5'CATTTAGATTGGAGGGGCCACA3'; BMPR1A, 5'GGTAAAGGCCGATATGGAGAAG3'and 5'TAGGCCGAAGCTGTAGATGTCA3'; BMPR2, 5'ATGAGCCTTTACTGAGACGAGAG3'and 5'CGCCACCGCTTAAGAGAATAG3'; and glyceraldehyde-3-phosphatedehydrogenase, 5'CCTGCTTCACCACCTTCTTG3' and 5'CATCATCTCTGCCCCCTCTG3'.For Northern blotting, 20 µg of RNA was separated on 1.2percent formaldehyde–agarose gels and then transferredto Nytran Supercharge membranes (Schleicher and Schuell). Membraneswere hybridized with the use of probes labeled with phosphorus-32.Bands were visualized by autoradiography.
Histologic and Immunohistochemical Analyses
Six lung sections from each patient were stained with hematoxylinand eosin and examined by means of digital photomicroscopy atvarious magnifications to determine the severity of pulmonaryhypertension. A pulmonary pathologist who was unaware of thepatients' diagnoses reviewed the photomicrograph slides anddetermined, for vessels measuring 100 to 1000 µm in diameter,the percentage of vessels with medial hyperplasia or hypertrophy,the number of myocytes per vessel wall, the percentage of occludedvessels, and the percentage of vessels with plexiform lesions.
Immunohistochemical analyses were performed as previously described,14with the same antibodies that were used in the immunoblottingexperiments and with biotinylated anti-goat IgG as a secondaryantibody (Vector). Each specimen had two negative controls:one section without primary antibody and one section with nonspecificgoat IgG.
Statistical Analysis
The preoperative characteristics of patients with pulmonaryhypertension and control patients were compared with use ofStudent's independent-group t-test for normally distributedvariables and the Wilcoxon rank-sum test for measures that werenot normally distributed. The normality of distribution wasevaluated with use of the Shapiro–Wilks test. Sex wascompared with use of Pearson's chi-square test. A P value ofless than 0.05 was considered to indicate statistical significance,and all tests were two-sided. The relation between pulmonaryvascular resistance and the level of TIE2 phosphorylation andangiopoietin-1 protein was characterized with the use of linearregression.
Results
Angiopoietin-1 Expression in Different Forms of Pulmonary Hypertension
The expression of angiopoietin-1 in lung tissue was measuredby RT-PCR and immunoblot analysis (Figure 1A). Before molecularanalysis was performed, lung sections from each patient wereexamined under a light microscope to quantitate the pulmonaryhypertensive changes according to the Heath–Edwards classification15(Table 1). Specimens from patients with pulmonary hypertensiondemonstrated Heath–Edwards stage 2, 3, 4, or 5 disease,with diffuse medial arteriolar hypertrophy or hyperplasia andstenosis of at least one third of all arterioles examined. Therewas a direct correlation between preoperative pulmonary arterialsystolic pressure and pulmonary vascular resistance and thepathological grading of affected specimens.
Figure 1. Angiopoietin-1 Expression in the Lung as a Molecular Marker for the Severity of Disease in Different Forms of Pulmonary Hypertension, as Assessed by Reverse Transcriptase–Polymerase Chain Reaction (RT-PCR) and Western Blotting (Panel A), Northern and Western Blotting (Panel B), and Linear-Regression Analysis (Panel C).
Panel A shows the results of RT-PCR and Western blotting analysis of the expression of angiopoietin-1 (Ang-1), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and actin in lung samples from patients with pulmonary hypertension due to thromboembolic disease (lane 1), Eisenmenger's syndrome (lane 2), idiopathic causes (i.e., primary pulmonary hypertension) (lane 3), scleroderma (lane 4), or mitral-valve regurgitation (lane 5) and two normotensive control patients (Controls 1 and 2 in lanes 6 and 7, respectively). Panel B shows the results of Northern blot analysis of angiopoietin-1 and actin messenger RNA, performed with human angiopoietin-1 and actin complementary DNA probes, and of Western blot analysis of angiopoietin-1 and actin proteins with the use of anti–angiopoietin-1 and anti-actin antibodies on lung tissue from patients and controls with various degrees of pulmonary vascular resistance. Control patients had pulmonary vascular resistance in the normal range of less than 220 dyn · sec · cm–5. Panel C shows the results of linear regression analysis of the correlation between the level of angiopoietin-1 protein in the lung and the degree of preoperative pulmonary vascular resistance in all 61 patients. For each sample, the densities of the angiopoietin-1 bands on Western blotting are normalized to the density of the corresponding actin band.
Table 1. Semiquantitative Morphometric Analysis of Pulmonary Vascular Lesions.
Patients in the pulmonary hypertension group had higher steady-statelevels of angiopoietin-1 mRNA and protein in their biopsy specimens(Figure 1A) than did control patients. Angiopoietin-1 transcriptswere not detected and angiopoietin-1 protein was barely detectablein biopsy specimens from control patients.
Correlation of Angiopoietin-1 Expression and TIE2 Phosphorylation with Disease Severity
Patients with pulmonary hypertension had greater amounts ofsteady-state angiopoietin-1 mRNA and protein in the lung thandid control patients (Figure 1B). The level of angiopoietin-1correlated directly with the severity of pulmonary hypertensionas measured by the preoperative pulmonary vascular resistanceand pulmonary arterial systolic pressure (Figure 1C). We foundthis correlation between gene expression and phenotype (elevatedpulmonary vascular resistance) in all samples from the patients,irrespective of the cause of the disease. Angiopoietin-1 wasnot detected by immunoblotting in the serum or wall of the mainpulmonary artery of patients with pulmonary hypertension, suggestingthat this protein and its effect are confined to the lung.
We also examined the expression of angiopoietin-2, a competitiveinhibitor of angiopoietin-1 in vasculogenesis,16 in lung tissuefrom patients with pulmonary hypertension and in lung tissuefrom those without it. In contrast to angiopoietin-1, the steady-statelevels of angiopoietin-2 mRNA or protein did not differ significantlybetween lung tissue from normotensive patients and lung tissuefrom patients with pulmonary hypertension (data not shown).
Since angiopoietin-1 has been shown in other angiogenesis systemsto bind and induce tyrosine phosphorylation of TIE2,17 we examinedwhether activation of TIE2 in the lung was a marker for theseverity of pulmonary hypertension. Steady-state levels of TIE2protein were similar in lung-biopsy specimens from patientswith pulmonary hypertension and control patients (Figure 2A).However, using quantitative phosphotyrosine immunoblotting,we found that the degree of TIE2 phosphorylation was directlyproportional to the clinical severity of pulmonary hypertension(as measured by pulmonary arterial systolic pressure and pulmonaryvascular resistance) in the group with pulmonary hypertension(Figure 2B and Figure 2C). In normotensive patients, minimallevels of phosphorylated TIE2 protein were detected.
Figure 2. Correlation between Phosphorylation of the Endothelial-Specific TIE2 Receptor in the Lung and Disease Severity as Indicated by Western Blotting (Panel A), Immunoprecipitation with Immunoblotting (Panel B), and Linear Regression Analysis (Panel C).
Panel A shows that by Western blot analysis, TIE2 is expressed at the protein level in similar concentrations in lung tissue from patients with pulmonary hypertension and lung tissue from control patients. In Panel B, quantitative immunoprecipitation with immunoblotting shows that TIE2 tyrosine phosphorylation increases as a function of pulmonary vascular resistance. Panel C shows the results of linear regression analysis of the correlation between TIE2 tyrosine phosphorylation in the lung to the degree of preoperative pulmonary vascular resistance in all 61 patients. For each sample, the densities of the phosphorylated TIE2 bands are normalized to the density of the TIE2 Western band.
BMPR2 and ALK1 Genes in Patients with Primary Pulmonary Hypertension
We sequenced the BMPR2 and ALK1 genes in the five patients withprimary pulmonary hypertension in this study to confirm theabsence of familial disease. None of the patients had deletion,missense, or nonsense mutations in the BMPR2 or ALK1 genes.None had a polymorphism in the BMPR2 gene at position 354 inexon 3, as has previously been reported in such patients.18These results illustrate that not all cases of primary pulmonaryhypertension are defined by mutations in these two genes.
Down-Regulation of BMPR1A in the Lungs in Various Forms of Pulmonary Hypertension
Using RT-PCR and immunoblot analysis, we found that BMPR1A andBMPR2 mRNA and protein were expressed in lung samples from normotensivepatients. In contrast, despite the high sensitivity of our assays,almost no BMPR1A mRNA or protein was detected in lung tissuefrom patients with primary pulmonary hypertension and patientswith four different acquired forms of the disease (Figure 3).These results suggest that, although familial forms of pulmonaryhypertension are defined by mutations in the BMPR2 gene, nonfamilialforms of pulmonary hypertension are characterized by severelydiminished or absent steady-state levels of the BMPR2 coreceptor,BMPR1A, in the lung.
Figure 3. Diminution of Expression of Bone Morphogenetic Protein Receptor Type 1A (BMPR1A) in Different Forms of Acquired and Nonfamilial Primary Pulmonary Hypertension as Assessed by Reverse Transcriptase–Polymerase Chain Reaction (Panel A) and Western Blotting (Panel B).
In Panel A, reverse transcriptase–polymerase-chain-reaction analysis of BMPR1A, bone morphogenetic protein receptor type 2 (BMPR2), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and actin in lung samples from patients with pulmonary hypertension due to thromboembolic disease, Eisenmenger's syndrome, idiopathic causes (primary pulmonary hypertension), scleroderma, or mitral-valve regurgitation and two normotensive control patients demonstrates attenuation of BMPR1A messenger RNA in patients with pulmonary hypertension. In Panel B, Western blot analysis of BMPR1A, BMPR2, and actin in the same lung-biopsy samples shows the attenuation of BMPR1A protein in patients with pulmonary hypertension.
Down-Regulation of BMPR1A in Pulmonary Arteriolar Endothelial Cells Incubated with Angiopoietin-1
Our findings suggested a link between constitutive angiopoietin-1levels in the lung, the transcriptional down-regulation of BMPR1A(either by decreased transcription or enhanced degradation)in pulmonary endothelium, and the genesis of pulmonary hypertension.On the basis of these results, we hypothesized that angiopoietin-1signaling in pulmonary arteriolar endothelial cells down-regulatesBMPR1A transcription. To test this hypothesis, we examined whetherangiopoietin-1 could directly modulate the expression of BMPR1A.Purified recombinant angiopoietin-1 protein was added to humanprimary pulmonary endothelial cells in culture. On Northernblotting, subcultured human primary pulmonary endothelial cellsexposed to recombinant angiopoietin-1 had undetectable steady-statelevels of BMPR1A mRNA, whereas untreated endothelial cells stronglyexpressed BMPR1A (Figure 4B). We found that in subcultured humanprimary pulmonary endothelial cells that were exposed to recombinantangiopoietin-1, levels of TIE2 tyrosine phosphorylation increased(Figure 4A) and were followed by a rapid diminution in the steady-statelevels of BMPR1A mRNA (Figure 4C). These results suggest that,in vascular endothelial cells, angiopoietin-1–ligand bindingresults in both TIE2 phosphorylation and subsequent down-regulationof the BMPR1A gene product. The diminished BMPR1A mRNA levelspersisted for 36 hours in human primary pulmonary endothelialcells after exposure to recombinant angiopoietin-1.
Figure 4. Increased Phosphorylation of TIE2-Receptors and Down-Regulation of Bone Morphogenetic Protein Receptor Type 1A (BMPR1A) Protein in Pulmonary Endothelial Cells Treated with Angiopoietin-1 (Ang-1), as Assessed by Immunoprecipitation and Immunoblotting (Panel A), Northern Blotting (Panel B), and Serial Time-Point Analysis (Panel C).
In Panel A, immunoblot analysis shows that treatment of human pulmonary arteriolar endothelial cells with angiopoietin-1 results in the induction of TIE2-receptor phosphorylation but does not cause the modulation of TIE2 protein levels. In Panel B, Northern blot analysis of BMPR1A and actin in human pulmonary endothelial cells treated with angiopoietin-1 shows down-regulation of steady-state levels of BMPR1A messenger RNA (mRNA) by angiopoietin-1. Panel C shows the effect of exposure to angiopoietin-1 on levels of BMPR1A mRNA and TIE2-receptor tyrosine phosphorylation in human pulmonary arteriolar endothelial cells over time. BMPR1A mRNA levels were normalized to actin mRNA levels and are presented as the mean of four independent experiments at each time point. TIE2 phosphorylation is presented as the mean of four independent measurements at each time point.
Cellular Localization of Signaling Molecules in Lung Tissue
Staining of sectioned specimens from patients with pulmonaryhypertension with anti–angiopoietin-1 antibody revealedthat angiopoietin-1 was confined to the cytoplasm of smooth-musclecells in the media of pulmonary arterioles and small arteriesmeasuring less than 800 µm in diameter (Figure 5A). Angiopoietin-1was not detected in the lungs of control patients with normalpulmonary vascular resistance (Figure 5B). Angiopoietin-2 immunoreactivitywas detected in the cytoplasm of vascular smooth-muscle cellsin large and small vessels in the lung and was present in samplesfrom patients with clinical pulmonary hypertension and fromthose without it (Figure 5C and Figure 5D).
Figure 5. Immunohistochemical Analysis of Representative Lung Samples from Patients with Pulmonary Hypertension (Panels A, C, E, and G) and Normotensive Control Patients (Panels B, D, F, and H) (x200).
Angiopoietin-1 (Ang-1) is present in vascular smooth-muscle cells in arterioles less than 800 µm in diameter in lung tissue from a patient with pulmonary hypertension (Panel A) but not lung tissue from a control patient (Panel B). Angiopoietin-2 (Ang-2) is present in vascular smooth-muscle cells in vessels of all sizes in lung tissue from a patient with pulmonary hypertension (Panel C) and a normotensive patient (Panel D). TIE2 is present in endothelial cells lining vessels of all sizes in a patient with pulmonary hypertension (Panel E) and a control patient (Panel F). Bone morphogenetic protein receptor type 1A (BMPR1A) is absent in endothelial cells in vessels less than 800 µm in diameter in lung tissue from a patient with pulmonary hypertension (Panel G) and present in lung tissue from a normotensive patient (Panel H). The scale bar represents 100 µm.
TIE2 protein was limited to the cytoplasm and the surface ofendothelial cells lining pulmonary vessels of all sizes frompatients with pulmonary hypertension and normotensive patients(Figure 5E and Figure 5F), a finding consistent with previousreports that TIE2 is restricted to the endothelial-cell lineage.19,20
BMPR1A immunoreactivity was detected in endothelium lining pulmonaryarterioles measuring less than 800 µm in diameter in biopsyspecimens from normotensive patients (Figure 5H). In contrast,we were unable to find staining for BMPR1A using an anti-BMPR1Aantibody in any lung sample from patients with pulmonary hypertension(Figure 5G).
Discussion
Most cases of pulmonary hypertension result from diverse causes,including chronic hypoxia, congenital heart defects, autoimmunedisease, thromboembolism, left-sided heart failure, ingestionof anorexigens, or idiopathic causes. Whether a common molecularmechanism underlies all these different causes of pulmonaryhypertension is unknown. The goal of our research was to determinethe genetic steps responsible for this disease and to understandthe molecular "cross-talk" between endothelial and smooth-musclecells in the arteriolar wall that ultimately defines pulmonaryvascular structure. We found that pulmonary hypertensive vasculopathyis characterized by high steady-state levels of angiopoietin-1in smooth-muscle cells lining small pulmonary vessels, tyrosinephosphorylation of the TIE2 receptor in pulmonary vascular endothelium,and nearly complete down-regulation of steady-state levels ofBMPR1A mRNA and protein in pulmonary vascular endothelium. Wefurther demonstrated that the level of angiopoietin-1 proteinand the degree of phosphorylation of its receptor TIE2 are sensitivemolecular markers of the severity of pulmonary hypertensionin patients with nonfamilial forms of the disease. These resultsestablish a link between the expression of angiopoietin-1, thephosphorylation of TIE2, and the magnitude of pulmonary vascularresistance. Finally, we found that angiopoietin-1 down-regulatessteady-state levels of BMPR1A mRNA and protein in subculturedhuman pulmonary arteriolar endothelial cells. These resultsunite nonfamilial primary pulmonary hypertension and multipleforms of secondary pulmonary hypertension by demonstrating thatthey have a similar pattern of aberrant gene expression andsuggest that pulmonary hypertension may occur through a molecularcascade whereby angiopoietin-1 ultimately down-regulates steady-statelevels of BMPR1A.
Our results link two seemingly unrelated observations in pulmonaryhypertension research. First, experiments in our laboratoryhave shown that targeted overexpression of angiopoietin-1 inthe lungs of rodents induces clinical and pathological pulmonaryhypertension, specifically the hyperplasia of vascular smooth-musclecells that is characteristic of the disease. This experimentconfirmed that the expression of angiopoietin-1 in the adultlung is causal of pulmonary hypertension rather than secondaryto it and parallels results in other laboratories that suggestthat angiopoietin-1 induces muscularization of nascent arteriesin utero.21 Second, familial pulmonary hypertension, a diseasepathologically identical to many forms of secondary pulmonaryhypertension, is characterized by haploid mutations in the BMPR2gene, resulting in dose-dependent modulation of BMPR2 oligomerizationwith BMPR1A.22 Bone morphogenetic protein ligands exert theireffects through the activation and heterodimerization of BMPR1and BMPR2 on the cell surface, leading to Smad intracellularsignaling.23 The effect of the activation of BMPR1A and BMPR2depends on the type of cell and can result in either promotionor inhibition of transcription.24,25 Although BMPR2 mutationshave been seen in patients with sporadic primary pulmonary hypertension,26they have not been identified in most forms of the disease.Since we found that BMPR1A mRNA levels are controlled by angiopoietin-1in pulmonary endothelium and that steady-state levels of BMPR1Aare markedly diminished in the lung tissue of patients withpulmonary hypertension, we suspect that nonfamilial forms ofpulmonary hypertension occur through an angiopoietin-1–BMPR1Apathway. Thus, dose-dependent inactivation of the BMPR complexeither by a mutation (in BMPR2 in familial disease) or by regulationof steady-state levels of transcripts (BMPR1A, as we have shownhere) is a hallmark of this disease.
In summary, we identified a partial molecular pathway for thegeneration of nonfamilial forms of pulmonary hypertension, representinga specific pattern of gene expression common to many forms ofthis disease. Further studies of the way in which angiopoietin-1–inducedchanges in the stoichiometry between BMPR1A and BMPR2 in vascularendothelium result in signals that stimulate the proliferationof vascular smooth-muscle cells should shed light on the fundamentalmechanism of the patterns of endothelial and smooth-muscle cellgrowth in an organ in which these vessels are critical for gasexchange and survival.
Supported by the Charles B. Wang Foundation and by grants (1R01HL70852-01, to Dr. Thistlethwaite, and M01 RR00827, to Dr. Deutsch)from the National Institutes of Health.
We are indebted to Feliz Garcia Bannach, Ph.D., Gordon Yung,M.D., and Huntington Potter, Ph.D., for helpful discussionsregarding the manuscript.
Source Information
From the Divisions of Cardiothoracic Surgery (L.D., C.C.S., D.C., A.J.C., M.K., S.W.J., P.A.T.), Pulmonary and Critical Care Medicine (J.X.-J.Y.), and Biostatistics (R.D.), University of California, San Diego, San Diego; and the Department of Pathology, Veterans Affairs Medical Center, La Jolla, Calif., and the University of California, San Diego, San Diego (P.L.W.).
Address reprint requests to Dr. Thistlethwaite at the Division of Cardiothoracic Surgery, University of California, San Diego, 200 West Arbor Dr., San Diego, CA 92103-8892, or at pthistlethwaite{at}ucsd.edu.
References
Rubin LJ. Pathology and pathophysiology of primary pulmonary hypertension. Am J Cardiol 1995;75:51A-54A. [CrossRef][Medline]
Pietra GG, Edwards WD, Kay JM, et al. Histopathology of primary pulmonary hypertension: a qualitative and quantitative study of pulmonary blood vessels from 58 patients in the National Heart, Lung, and Blood Institute, Primary Pulmonary Hypertension Registry. Circulation 1989;80:1198-1206. [Free Full Text]
Deng Z, Morse JH, Slager SL, et al. Familial primary pulmonary hypertension (gene PPH1) is caused by mutations in the bone morphogenetic protein receptor-II gene. Am J Hum Genet 2000;67:737-744. [CrossRef][ISI][Medline]
Lane KB, Machado RD, Pauciulo MW, et al. Heterozygous germline mutations in BMPR2, encoding a TGF-beta receptor, cause familial primary pulmonary hypertension. Nat Genet 2000;26:81-84. [CrossRef][ISI][Medline]
Machado RD, Pauciulo MW, Thomson JR, et al. BMPR2 haploinsufficiency as the inherited molecular mechanism for primary pulmonary hypertension. Am J Hum Genet 2001;68:92-102. [CrossRef][ISI][Medline]
Trembath RC, Thomson JR, Machado RD, et al. Clinical and molecular genetic features of pulmonary hypertension in patients with hereditary hemorrhagic telangiectasia. N Engl J Med 2001;345:325-334. [Free Full Text]
Papapetropoulos A, Garcia-Cardena G, Dengler TJ, Maisonpierre PC, Yancopoulos GD, Sessa WC. Direct actions of angiopoietin-1 on human endothelium: evidence for network stabilization, cell survival, and interaction with other angiogenic growth factors. Lab Invest 1999;79:213-223. [ISI][Medline]
Folkman J, D'Amore PA. Blood vessel formation: what is its molecular basis? Cell 1996;87:1153-1155. [CrossRef][ISI][Medline]
Suri C, Jones PF, Patan S, et al. Requisite role of angiopoietin-1, a ligand for the TIE2 receptor, during embryonic angiogenesis. Cell 1996;87:1171-1180. [CrossRef][ISI][Medline]
Davis S, Aldrich TH, Jones PF, et al. Isolation of angiopoietin-1, a ligand for the TIE2 receptor, by secretion-trap expression cloning. Cell 1996;87:1161-1169. [CrossRef][ISI][Medline]
Thistlethwaite PA, Lee SH, Du LL, et al. Human angiopoietin gene expression is a marker for severity of pulmonary hypertension in patients undergoing pulmonary thromboendarterectomy. J Thorac Cardiovasc Surg 2001;122:65-73. [Free Full Text]
Koblizek TI, Weiss C, Yancopoulos GD, Deutsch U, Risau W. Angiopoietin-1 in-duces sprouting angiogenesis in vitro. Curr Biol 1998;8:529-532. [CrossRef][ISI][Medline]
Lee SH, Wolf PL, Escudero R, Deutsch R, Jamieson SW, Thistlethwaite PA. Early expression of angiogenesis factors in acute myocardial ischemia and infarction. N Engl J Med 2000;342:626-633. [Free Full Text]
Heath D, Edwards JE. The pathology of hypertensive pulmonary vascular disease: a description of six grades of structural changes in the pulmonary arteries with special reference to congenital cardiac septal defects. Circulation 1958;18:533-547. [ISI][Medline]
Maisonpierre PC, Suri C, Jones PF, et al. Angiopoietin-2, a natural antagonist for Tie2 that disrupts in vivo angiogenesis. Science 1997;277:55-60. [Free Full Text]
Jones N, Master Z, Jones J, et al. Identification of Tek/Tie2 binding partners: binding to a multifunctional docking site mediates cell survival and migration. J Biol Chem 1999;274:30896-30905. [Free Full Text]
Newman JH, Wheeler L, Lane KB, et al. Mutation in the gene for bone morphogenetic protein receptor II as a cause of primary pulmonary hypertension in a large kindred. N Engl J Med 2001;345:319-324. [Erratum, N Engl J Med 2001;345:1506, 2002;346:1258.] [Free Full Text]
Dumont DJ, Fong GH, Puri MC, Gradwohl G, Alitalo K, Breitman ML. Vascularization of the mouse embryo: a study of flk-1, tek, tie, and vascular endothelial growth factor expression during development. Dev Dyn 1995;203:80-92. [ISI][Medline]
Abdulmalek K, Ashur F, Ezer N, Ye F, Magder S, Hussain SN. Differential expression of Tie-2 receptors and angiopoietins in response to in vivo hypoxia in rats. Am J Physiol Lung Cell Mol Physiol 2001;281:L582-L590. [Free Full Text]
Sato TN, Tozawa Y, Deutsch U, et al. Distinct roles of the receptor tyrosine kinases Tie-1 and Tie-2 in blood vessel formation. Nature 1995;376:70-74. [CrossRef][Medline]
Gilboa L, Nohe A, Geissendorfer T, Sebald W, Henis YI, Knaus P. Bone morphogenetic protein receptor complexes on the surface of live cells: a new oligomerization mode for serine/threonine kinase receptors. Mol Biol Cell 2000;11:1023-1035. [Free Full Text]
Yoshida Y, Tanaka S, Umemori H, et al. Negative regulation of BMP/Smad signaling by Tob in osteoblasts. Cell 2000;103:1085-1097. [CrossRef][ISI][Medline]
Heldin CH, Miyazono K, ten Dijke P. TGF-beta signalling from cell membrane to nucleus through SMAD proteins. Nature 1997;390:465-471. [CrossRef][Medline]
Kumura N, Matuso R, Shibuya H, Nakashima K, Taga T. BMP2-induced apoptosis is mediated by activation of the TAK1-p38 kinase pathway that is negatively regulated by Smad6. J Biol Chem 2000;275:17647-17652. [Free Full Text]
Thomson JR, Machado RD, Pauciulo MW, et al. Sporadic primary pulmonary hypertension is associated with germline mutations of the gene encoding BMPR-II, a receptor member of the TGF-beta family. J Med Genet 2000;37:741-745. [Free Full Text]
El-Bizri, N., Guignabert, C., Wang, L., Cheng, A., Stankunas, K., Chang, C.-P., Mishina, Y., Rabinovitch, M.
(2008). SM22{alpha}-targeted deletion of bone morphogenetic protein receptor 1A in mice impairs cardiac and vascular development, and influences organogenesis. Development
135: 2981-2991
[Abstract][Full Text]
Rubin, L. J.
(2008). BMPR2 Mutation and Outcome in Pulmonary Arterial Hypertension: Clinical Relevance to Physicians and Patients. Am. J. Respir. Crit. Care Med.
177: 1300-1301
[Full Text]
Chin, K. M., Rubin, L. J.
(2008). Pulmonary arterial hypertension.. J Am Coll Cardiol
51: 1527-1538
[Abstract][Full Text]
Ray, L., Mathieu, M., Jespers, P., Hadad, I., Mahmoudabady, M., Pensis, A., Motte, S., Peters, I. R., Naeije, R., McEntee, K.
(2008). Early increase in pulmonary vascular reactivity with overexpression of endothelin-1 and vascular endothelial growth factor in canine experimental heart failure. Exp Physiol
93: 434-442
[Abstract][Full Text]
Newman, J. H., Phillips, J. A. III, Loyd, J. E.
(2008). Narrative Review: The Enigma of Pulmonary Arterial Hypertension: New Insights from Genetic Studies. ANN INTERN MED
148: 278-283
[Abstract][Full Text]
El-Bizri, N., Wang, L., Merklinger, S. L., Guignabert, C., Desai, T., Urashima, T., Sheikh, A. Y., Knutsen, R. H., Mecham, R. P., Mishina, Y., Rabinovitch, M.
(2008). Smooth Muscle Protein 22{alpha}-Mediated Patchy Deletion of Bmpr1a Impairs Cardiac Contractility but Protects Against Pulmonary Vascular Remodeling. Circ. Res.
102: 380-388
[Abstract][Full Text]
Lagna, G., Ku, M. M., Nguyen, P. H., Neuman, N. A., Davis, B. N., Hata, A.
(2007). Control of Phenotypic Plasticity of Smooth Muscle Cells by Bone Morphogenetic Protein Signaling through the Myocardin-related Transcription Factors. J. Biol. Chem.
282: 37244-37255
[Abstract][Full Text]
Shim, W. S.N., Ho, I. A.W., Wong, P. E.H.
(2007). Angiopoietin: A TIE(d) Balance in Tumor Angiogenesis. Mol Cancer Res
5: 655-665
[Abstract][Full Text]
Suntharalingam, J., Machado, R. D, Sharples, L. D, Toshner, M. R, Sheares, K. K, Hughes, R. J, Jenkins, D. P, Trembath, R. C, Morrell, N. W, Pepke-Zaba, J.
(2007). Demographic features, BMPR2 status and outcomes in distal chronic thromboembolic pulmonary hypertension. Thorax
62: 617-622
[Abstract][Full Text]
Sehgal, P. B., Mukhopadhyay, S.
(2007). Pulmonary arterial hypertension: a disease of tethers, SNAREs and SNAPs?. Am. J. Physiol. Heart Circ. Physiol.
293: H77-H85
[Abstract][Full Text]
Tidswell, M., Higgins, T. L.
(2007). The Anesthesiologist and Pulmonary Arterial Hypertension. SEMIN CARDIOTHORAC VASC ANESTH
11: 93-95
Morty, R. E., Nejman, B., Kwapiszewska, G., Hecker, M., Zakrzewicz, A., Kouri, F. M., Peters, D. M., Dumitrascu, R., Seeger, W., Knaus, P., Schermuly, R. T., Eickelberg, O.
(2007). Dysregulated Bone Morphogenetic Protein Signaling in Monocrotaline-Induced Pulmonary Arterial Hypertension. Arterioscler. Thromb. Vasc. Bio.
27: 1072-1078
[Abstract][Full Text]
Hildebrandt, M., Bommert, K., Rautenberg, K., Ludwig, W.-D.
(2006). Altered Expression and Signalling of Bone Morphogenetic Protein Receptor 1A (BMPR-1A) and Enhanced Hematopoietic Progenitor Cell Growth in Long-Term Stromal Culture Assays from Two Patients with a Myeloproliferative Syndrome and Pulmonary Hypertension.. ASH ANNUAL MEETING ABSTRACTS
108: 3640-3640
[Abstract]
Morrell, N. W.
(2006). Pulmonary Hypertension Due to BMPR2 Mutation: A New Paradigm for Tissue Remodeling?. Proc Am Thorac Soc
3: 680-686
[Abstract][Full Text]
Dewachter, L., Adnot, S., Fadel, E., Humbert, M., Maitre, B., Barlier-Mur, A.-M., Simonneau, G., Hamon, M., Naeije, R., Eddahibi, S.
(2006). Angiopoietin/Tie2 Pathway Influences Smooth Muscle Hyperplasia in Idiopathic Pulmonary Hypertension. Am. J. Respir. Crit. Care Med.
174: 1025-1033
[Abstract][Full Text]
Fantozzi, I., Platoshyn, O., Wong, A. H., Zhang, S., Remillard, C. V., Furtado, M. R., Petrauskene, O. V., Yuan, J. X.-J.
(2006). Bone morphogenetic protein-2 upregulates expression and function of voltage-gated K+ channels in human pulmonary artery smooth muscle cells. Am. J. Physiol. Lung Cell. Mol. Physiol.
291: L993-L1004
[Abstract][Full Text]
Rich, S.
(2006). The current treatment of pulmonary arterial hypertension: time to redefine success.. Chest
130: 1198-1202
[Abstract][Full Text]
McLaughlin, V. V., McGoon, M. D.
(2006). Pulmonary Arterial Hypertension. Circulation
114: 1417-1431
[Full Text]
Macdonald, P. R., Progias, P., Ciani, B., Patel, S., Mayer, U., Steinmetz, M. O., Kammerer, R. A.
(2006). Structure of the Extracellular Domain of Tie Receptor Tyrosine Kinases and Localization of the Angiopoietin-binding Epitope. J. Biol. Chem.
281: 28408-28414
[Abstract][Full Text]
Guignabert, C., Izikki, M., Tu, L. I., Li, Z., Zadigue, P., Barlier-Mur, A.-M., Hanoun, N., Rodman, D., Hamon, M., Adnot, S., Eddahibi, S.
(2006). Transgenic Mice Overexpressing the 5-Hydroxytryptamine Transporter Gene in Smooth Muscle Develop Pulmonary Hypertension. Circ. Res.
98: 1323-1330
[Abstract][Full Text]
Brindle, N. P.J., Saharinen, P., Alitalo, K.
(2006). Signaling and Functions of Angiopoietin-1 in Vascular Protection. Circ. Res.
98: 1014-1023
[Abstract][Full Text]
Hoeper, M. M., Mayer, E., Simonneau, G., Rubin, L. J.
(2006). Chronic Thromboembolic Pulmonary Hypertension. Circulation
113: 2011-2020
[Full Text]
Tschopp, O., Schmid, C., Speich, R., Seifert, B., Russi, E. W., Boehler, A.
(2006). Pretransplantation bone disease in patients with primary pulmonary hypertension.. Chest
129: 1002-1008
[Abstract][Full Text]
Takahashi, H., Goto, N., Kojima, Y., Tsuda, Y., Morio, Y., Muramatsu, M., Fukuchi, Y.
(2006). Downregulation of type II bone morphogenetic protein receptor in hypoxic pulmonary hypertension. Am. J. Physiol. Lung Cell. Mol. Physiol.
290: L450-L458
[Abstract][Full Text]
Thistlethwaite, P. A., Kemp, A., Du, L., Madani, M. M., Jamieson, S. W.
(2006). Outcomes of pulmonary endarterectomy for treatment of extreme thromboembolic pulmonary hypertension. J. Thorac. Cardiovasc. Surg.
131: 307-313
[Abstract][Full Text]
Cool, C. D., Groshong, S. D., Oakey, J., Voelkel, N. F.
(2005). Pulmonary Hypertension: Cellular and Molecular Mechanisms. Chest
128: 565S-571S
[Full Text]
Kugathasan, L., Dutly, A. E., Zhao, Y. D., Deng, Y., Robb, M. J., Keshavjee, S., Stewart, D. J.
(2005). Role of Angiopoietin-1 in Experimental and Human Pulmonary Arterial Hypertension. Chest
128: 633S-642S
[Abstract][Full Text]
Rondelet, B., Kerbaul, F., Van Beneden, R., Hubloue, I., Huez, S., Fesler, P., Remmelink, M., Brimioulle, S., Salmon, I., Naeije, R.
(2005). Prevention of pulmonary vascular remodeling and of decreased BMPR-2 expression by losartan therapy in shunt-induced pulmonary hypertension. Am. J. Physiol. Heart Circ. Physiol.
289: H2319-H2324
[Abstract][Full Text]
Merklinger, S. L., Wagner, R. A., Spiekerkoetter, E., Hinek, A., Knutsen, R. H., Kabir, M. G., Desai, K., Hacker, S., Wang, L., Cann, G. M., Ambartsumian, N. S., Lukanidin, E., Bernstein, D., Husain, M., Mecham, R. P., Starcher, B., Yanagisawa, H., Rabinovitch, M.
(2005). Increased Fibulin-5 and Elastin in S100A4/Mts1 Mice With Pulmonary Hypertension. Circ. Res.
97: 596-604
[Abstract][Full Text]
Rubin, L. J., Badesch, D. B.
(2005). Evaluation and Management of the Patient with Pulmonary Arterial Hypertension. ANN INTERN MED
143: 282-292
[Abstract][Full Text]
Yang, X., Long, L., Southwood, M., Rudarakanchana, N., Upton, P. D., Jeffery, T. K., Atkinson, C., Chen, H., Trembath, R. C., Morrell, N. W.
(2005). Dysfunctional Smad Signaling Contributes to Abnormal Smooth Muscle Cell Proliferation in Familial Pulmonary Arterial Hypertension. Circ. Res.
96: 1053-1063
[Abstract][Full Text]
Yuan, J. X.-J., Rubin, L. J.
(2005). Pathogenesis of Pulmonary Arterial Hypertension: The Need for Multiple Hits. Circulation
111: 534-538
[Full Text]
Kido, M., Du, L., Sullivan, C. C., Deutsch, R., Jamieson, S. W., Thistlethwaite, P. A.
(2005). Gene transfer of a TIE2 receptor antagonist prevents pulmonary hypertension in rodents. J. Thorac. Cardiovasc. Surg.
129: 268-276
[Abstract][Full Text]
Satoh, T., Kimura, K., Okano, Y., Hirakata, M., Kawakami, Y., Kuwana, M.
(2005). Lack of circulating autoantibodies to bone morphogenetic protein receptor-II or activin receptor-like kinase 1 in mixed connective tissue disease patients with pulmonary arterial hypertension. Rheumatology (Oxford)
44: 192-196
[Abstract][Full Text]
Richter, A., Yeager, M. E., Zaiman, A., Cool, C. D., Voelkel, N. F., Tuder, R. M.
(2004). Impaired Transforming Growth Factor-{beta} Signaling in Idiopathic Pulmonary Arterial Hypertension. Am. J. Respir. Crit. Care Med.
170: 1340-1348
[Abstract][Full Text]
Task Force members, , Galie, N., Torbicki, A., Barst, R., Dartevelle, P., Haworth, S., Higenbottam, T., Olschewski, H., Peacock, A., Pietra, G., Rubin, L. J., Simonneau, G.
(2004). Guidelines on diagnosis and treatment of pulmonary arterial hypertension: The Task Force on Diagnosis and Treatment of Pulmonary Arterial Hypertension of the European Society of Cardiology. Eur Heart J
25: 2243-2278
[Full Text]
Beppu, H., Ichinose, F., Kawai, N., Jones, R. C., Yu, P. B., Zapol, W. M., Miyazono, K., Li, E., Bloch, K. D.
(2004). BMPR-II heterozygous mice have mild pulmonary hypertension and an impaired pulmonary vascular remodeling response to prolonged hypoxia. Am. J. Physiol. Lung Cell. Mol. Physiol.
287: L1241-L1247
[Abstract][Full Text]
Kunichika, N., Landsberg, J. W., Yu, Y., Kunichika, H., Thistlethwaite, P. A., Rubin, L. J., Yuan, J. X.-J.
(2004). Bosentan Inhibits Transient Receptor Potential Channel Expression in Pulmonary Vascular Myocytes. Am. J. Respir. Crit. Care Med.
170: 1101-1107
[Abstract][Full Text]
Farber, H. W., Loscalzo, J.
(2004). Pulmonary Arterial Hypertension. NEJM
351: 1655-1665
[Full Text]
Rondelet, B., Kerbaul, F., Van Beneden, R., Motte, S., Fesler, P., Hubloue, I., Remmelink, M., Brimioulle, S., Salmon, I., Ketelslegers, J.-M., Naeije, R.
(2004). Signaling Molecules in Overcirculation-Induced Pulmonary Hypertension in Piglets: Effects of Sildenafil Therapy. Circulation
110: 2220-2225
[Abstract][Full Text]
Humbert, M., Sitbon, O., Simonneau, G.
(2004). Treatment of Pulmonary Arterial Hypertension. NEJM
351: 1425-1436
[Full Text]
Yu, Y., Fantozzi, I., Remillard, C. V., Landsberg, J. W., Kunichika, N., Platoshyn, O., Tigno, D. D., Thistlethwaite, P. A., Rubin, L. J., Yuan, J. X.-J.
(2004). Enhanced expression of transient receptor potential channels in idiopathic pulmonary arterial hypertension. Proc. Natl. Acad. Sci. USA
101: 13861-13866
[Abstract][Full Text]
Velez-Roa, S., Ciarka, A., Najem, B., Vachiery, J.-L., Naeije, R., van de Borne, P.
(2004). Increased Sympathetic Nerve Activity in Pulmonary Artery Hypertension. Circulation
110: 1308-1312
[Abstract][Full Text]
Naeije, R., Eddahibi, S.
(2004). Serotonin in Pulmonary Arterial Hypertension. Am. J. Respir. Crit. Care Med.
170: 209-210
[Full Text]
Newman, J. H., Fanburg, B. L., Archer, S. L., Badesch, D. B., Barst, R. J., Garcia, J. G.N., Kao, P. N., Knowles, J. A., Loyd, J. E., McGoon, M. D., Morse, J. H., Nichols, W. C., Rabinovitch, M., Rodman, D. M., Stevens, T., Tuder, R. M., Voelkel, N. F., Gail, D. B.
(2004). Pulmonary Arterial Hypertension: Future Directions: Report of a National Heart, Lung and Blood Institute/Office of Rare Diseases Workshop. Circulation
109: 2947-2952
[Full Text]
Humbert, M., Morrell, N. W., Archer, S. L., Stenmark, K. R., MacLean, M. R., Lang, I. M., Christman, B. W., Weir, E. K., Eickelberg, O., Voelkel, N. F., Rabinovitch, M.
(2004). Cellular and molecular pathobiology of pulmonary arterial hypertension. J Am Coll Cardiol
43: 13S-24S
[Abstract][Full Text]
Pietra, G. G., Capron, F., Stewart, S., Leone, O., Humbert, M., Robbins, I. M., Reid, L. M., Tuder, R. M.
(2004). Pathologic assessment of vasculopathies in pulmonary hypertension. J Am Coll Cardiol
43: 25S-32S
[Abstract][Full Text]
Rubin, L. J., Galie, N.
(2004). Pulmonary arterial hypertension: a look to the future. J Am Coll Cardiol
43: 89S-90S
[Abstract][Full Text]
Chaouat, A, Coulet, F, Favre, C, Simonneau, G, Weitzenblum, E, Soubrier, F, Humbert, M
(2004). Endoglin germline mutation in a patient with hereditary haemorrhagic telangiectasia and dexfenfluramine associated pulmonary arterial hypertension. Thorax
59: 446-448
[Abstract][Full Text]
Rabinovitch, M.
(2004). The Mouse Through the Looking Glass: A New Door Into the Pathophysiology of Pulmonary Hypertension. Circ. Res.
94: 1001-1004
[Full Text]
Chu, D., Sullivan, C. C., Du, L., Cho, A. J., Kido, M., Wolf, P. L., Weitzman, M. D., Jamieson, S. W., Thistlethwaite, P. A.
(2004). A new animal model for pulmonary hypertension based on the overexpression of a single gene, angiopoietin-1. Ann. Thorac. Surg.
77: 449-456
[Abstract][Full Text]
Budhiraja, R., Tuder, R. M., Hassoun, P. M.
(2004). Endothelial Dysfunction in Pulmonary Hypertension. Circulation
109: 159-165
[Full Text]
Eickelberg, O., Yeager, M. E, Grimminger, F.
(2003). The tantalizing triplet of pulmonary hypertension--BMP receptors, serotonin receptors, and angiopoietins. Cardiovasc Res
60: 465-467
[Full Text]
Blanpain, C., Le Poul, E., Parma, J., Knoop, C., Detheux, M., Parmentier, M., Vassart, G., Abramowicz, M. J
(2003). Serotonin 5-HT2B receptor loss of function mutation in a patient with fenfluramine-associated primary pulmonary hypertension. Cardiovasc Res
60: 518-528
[Abstract][Full Text]
Jamieson, S. W., Kapelanski, D. P., Sakakibara, N., Manecke, G. R., Thistlethwaite, P. A., Kerr, K. M., Channick, R. N., Fedullo, P. F., Auger, W. R.
(2003). Pulmonary endarterectomy: experience and lessons learned in 1,500 cases. Ann. Thorac. Surg.
76: 1457-1464
[Abstract][Full Text]
Sullivan, C. C., Du, L., Chu, D., Cho, A. J., Kido, M., Wolf, P. L., Jamieson, S. W., Thistlethwaite, P. A.
(2003). Induction of pulmonary hypertension by an angiopoietin 1/TIE2/serotonin pathway. Proc. Natl. Acad. Sci. USA
100: 12331-12336
[Abstract][Full Text]
Nishimura, T., Vaszar, L. T., Faul, J. L., Zhao, G., Berry, G. J., Shi, L., Qiu, D., Benson, G., Pearl, R. G., Kao, P. N.
(2003). Simvastatin Rescues Rats From Fatal Pulmonary Hypertension by Inducing Apoptosis of Neointimal Smooth Muscle Cells. Circulation
108: 1640-1645
[Abstract][Full Text]
Hoeper, M. M., Thistlethwaite, P. A., Jamieson, S. W.
(2003). Signaling Molecules in Pulmonary Hypertension. NEJM
348: 2151-2151
[Full Text]
Rudge, J.S., Thurston, G., Yancopoulos, G.D.
(2003). Angiopoietin-1 and Pulmonary Hypertension: Cause or Cure?. Circ. Res.
92: 947-949
[Full Text]
Zhao, Y. D., Campbell, A. I.M., Robb, M., Ng, D., Stewart, D. J.
(2003). Protective Role of Angiopoietin-1 in Experimental Pulmonary Hypertension. Circ. Res.
92: 984-991
[Abstract][Full Text]
Previous
