FREE NEJM E-TOC    HOME   |   SUBSCRIBE   |   CURRENT ISSUE   |   PAST ISSUES   |   COLLECTIONS   |   Search Term  Advanced Search

Sign in | Get NEJM's E-Mail Table of Contents — Free | Subscribe

Previous Volume 349:1113-1122 September 18, 2003 Number 12 Next

Abstract PDF PDA Full Text PowerPoint Slide Set Supplementary Material Perspective by Cesarman, E. Letters Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited E-mail When Letters Appear PubMed Citation

ABSTRACT

Background Severe pulmonary hypertension constitutes a group of diseases characterized by complex, lumen-occluding vascular lesions that develop in genetically susceptible persons. The only viral infection associated with severe pulmonary hypertension has been that due to human immunodeficiency virus type 1, but neither the viral genome nor viral antigens have been demonstrated in pathologic lesions.

Methods We examined lung-tissue samples from 16 patients with sporadic primary pulmonary hypertension and 14 patients with secondary pulmonary hypertension for evidence of infection with human herpesvirus 8 (HHV-8). HHV-8 infection was ascertained immunohistochemically with use of an antibody directed against latency-associated nuclear antigen 1 (LANA-1), and a polymerase-chain-reaction (PCR) assay was performed on lung DNA to detect the viral cyclin gene of HHV-8. Sequence analysis was also performed.

Results In lung tissue from 10 of 16 patients with primary pulmonary hypertension (62 percent), cells within the plexiform lesions as well as cells outside the lesions were positive for LANA-1 on immunohistochemical analysis. Tissue from the same 10 patients contained viral cyclin on PCR analysis. No LANA-1 was detected in lung tissue from patients with secondary pulmonary hypertension, although one such patient had PCR evidence of viral cyclin. Plexiform lesions from patients with primary pulmonary hypertension had a histologic and immunohistochemical resemblance to cutaneous Kaposi's sarcoma lesions.

Conclusions The spectrum of trigger factors and molecular mechanisms leading to severe pulmonary hypertension and the formation of plexiform lesions is apparently wide, including both genetic and epigenetic factors. Our data suggest that infection with the vasculotropic virus HHV-8 may have a pathogenetic role in primary pulmonary hypertension.

Analysis of lung tissue from patients with primary pulmonary hypertension has established that the endothelial cells of the plexiform lesions proliferate in a monoclonal fashion⁴ and that they can have somatic mutations of the BMPR2 and BAX genes.⁵ Although the histopathological findings are not specific, the molecular pathological characteristics of the various forms of severe pulmonary hypertension are distinct, as suggested by the fact that the gene-expression profile of whole-lung tissue can distinguish between patients with sporadic and those with familial primary pulmonary hypertension.⁶ However, not all plexiform lesions from patients with primary pulmonary hypertension have somatic mutations, and only 50 percent of patients with familial primary pulmonary hypertension have BMPR2 mutations.^1,5 Therefore, additional molecular factors must be involved in the acquisition of the selective growth advantage of endothelial cells in patients with severe pulmonary hypertension.

Our understanding of the role of human herpesvirus 8 (HHV-8), a newly discovered gamma herpesvirus, in human disease is evolving. HHV-8 is thought to be the cause of all clinical types of Kaposi's sarcoma^7,8 and rare lymphoproliferative disorders associated with HIV-1 infection, such as primary effusion lymphoma and multicentric Castleman's disease.⁹ Seroepidemiologic studies have established that the prevalence of HHV-8 infection varies geographically and is influenced by behavioral risk factors. In the United States, antibodies against HHV-8 latency-associated nuclear antigen 1 (LANA-1) are present in approximately 33 percent of homosexual men without Kaposi's sarcoma, 8 percent of patients without HIV-1 infection who are attending sexually transmitted disease clinics, and up to 3 percent of blood donors without HIV-1 infection.^10,11

Several observations led us to explore the potential relation between HHV-8 infection and primary pulmonary hypertension. First, there is a well-described association between HIV-1 infection and severe pulmonary hypertension,^12,13,14 and although the effect of the coexistence of HHV-8 infection in these patients has not been studied, the prevalence of HHV-8 infection is increased among patients who are infected with HIV-1.^11,15 Second, primary pulmonary hypertension has been described in two patients with HHV-8–associated Castleman's disease, and lung tissue from one of these patients was positive for LANA-1.¹⁶ Third, elevated levels of inflammatory cytokines are present in the serum of patients with primary pulmonary hypertension,^17,18 and T and B lymphocytes are present in plexiform lesions from such patients.^19,20 These observations raise the possibility that an immune response to an undefined antigenic stimulus may be present in these patients or may even be involved in the pathogenesis of this disorder. Finally, in the course of evaluating a large number of patients with primary pulmonary hypertension, we noted a histologic resemblance between the plexiform lesions of the disorder and the endothelial abnormalities of cutaneous Kaposi's sarcoma. For these reasons, we examined lung tissue from patients with primary and various secondary forms of severe pulmonary hypertension for evidence of infection with HHV-8.

Methods

Screening Study

In a screening study, we extracted DNA from 15 microdissected plexiform lesions from six patients with primary pulmonary hypertension and 5 skin lesions from five patients with Kaposi's sarcoma, with the use of laser capture microdissection (PixCell II LCM unit, Arcturus Engineering). Only the core of the lesions containing endothelial cells was dissected from serial sections that were 10 µm thick (approximately 100 cells per section). DNA was extracted and amplified with use of a polymerase-chain-reaction (PCR) assay (Expand Long Template PCR System, Roche Diagnostics) in combination with nested PCR in order to amplify DNA from a single tumor cell. PCR analysis of the DNA representing the HHV-8 open reading frame 26 (ORF26)^21,22 was performed.

To corroborate the findings, we also analyzed formalin-fixed, paraffin-embedded samples of lung tissue from 30 patients with severe pulmonary hypertension, 4 patients with other lung diseases, and 1 control patient with normal lung tissue. A lymph node from one of the patients with Castleman's disease and primary pulmonary hypertension was analyzed because lung tissue was unavailable. Cutaneous-biopsy specimens from five patients with Kaposi's sarcoma served as positive controls. We examined the tissue sections for HHV-8 LANA-1 using immunohistochemical techniques and for viral cyclin using DNA extraction followed by PCR analysis.

Patients

The institutional review board of the University of Colorado Health Sciences Center approved the study. Patients with severe pulmonary hypertension who were on the waiting list for lung transplantation granted written permission for their explanted lung tissue to be used for investigations, and their next of kin gave written permission to use the tissue samples for a postmortem examination as well as for research. Lung tissue banked at the Pulmonary Hypertension Center of the University of Colorado Health Sciences Center from 30 patients with severe pulmonary hypertension was identified, and the patients' medical history, clinical presentation, and data obtained by right heart catheterization were reviewed (see Supplementary Appendix 1, available with the full text of this article at http://www.nejm.org). Most of the patients had been followed for many years at the center. Some of the archived tissue (e.g., from Patients 7 and 15) had been obtained at autopsy 10 to 20 years earlier. The histologic findings in the lungs and pulmonary vessels were independently reviewed by two pathologists, using tissue sections stained with hematoxylin and eosin.

Patients 1, 2, 3, and 4 had recently received a lung transplant; Patients 2, 3, and 4 had done so after the failure of long-term prostacyclin infusion therapy. Patient 13 had died 2.5 years after the development of fenfluramine-induced pulmonary hypertension; Patient 7 had a history of injection-drug abuse. Birefringent crystals, as well as plexiform lesions, were noted in the lung tissue from Patient 7. Patient 6 had initially been treated for sleep-apnea–associated pulmonary hypertension before receiving a diagnosis of primary pulmonary hypertension, and Patient 22 had been given a diagnosis of primary pulmonary hypertension before a skin biopsy documented sarcoidosis. Patient 8 had primary pulmonary hypertension associated with Castleman's disease¹⁶; Patients 19, 20, and 21 had pulmonary hypertension associated with HIV-1 infection; and Patients 27, 28, 29, 30, and 31 had been given a diagnosis of severe pulmonary hypertension due to atrial septal or ventricular septal defects. Patient 18 had pulmonary capillary hemangiomatosis. Lung tissue from two patients with cryptogenic organizing pneumonia, one patient with nonspecific interstitial pneumonitis, one patient with smoking-induced emphysema, and one patient with normal lung tissue served as controls (Table 1).

View this table: [in this window] [in a new window]   Table 1. Results of Immunohistochemical (IHC) and Polymerase-Chain-Reaction (PCR) Analysis of Lung Tissue.

 
Immunohistochemical Analysis

Immunohistochemical staining was performed as previously described to identify the LANA-1 of HHV-8 encoded by ORF73 (dilution, 1:1500; Advanced Biotechnologies).²³ For each antigen, skin tissue from the five patients with Kaposi's sarcoma and lung tissues were stained simultaneously. Briefly, after paraffin-embedded blocks had been cut into 5-µm sections and mounted onto slides, the specimens were deparaffinized and rehydrated. High-temperature antigen retrieval involved boiling the slides in citrate buffer (10 mM per liter, pH 6.0) for 20 minutes, followed by incubation with the avidin–biotin–peroxidase complex (Vectastain Elite ABC kit, Vector Laboratories) according to the manufacturer's instructions. For the detection of LANA-1, the samples were incubated with primary antibody (dilution, 1:1500) at room temperature for one hour. The samples were then stained with 3,3'-diaminobenzidine as the chromogen and counterstained with Mayer's hematoxylin. Normal blocking serum without primary antibody was used for the negative control.

For the comparison of Kaposi's sarcoma and plexiform lesions, selected slides were immunostained with an antibody against vascular endothelial growth factor (VEGF) (dilution, 1:300; Dako). An immunofluorescence assay for factor VIII–related antigen was also performed (dilution, 1:1000; Dako) in which the samples were incubated with goat-antirabbit secondary antibody (dilution, 1:200) conjugated to fluorescein (Molecular Probes).

HHV-8 Viral Cyclin Analyses

Formalin-fixed, paraffin-embedded tissue was used for DNA extraction. Five-micrometer sections were cut from each paraffin block and placed in 0.5-ml MicroAmp tubes (Perkin–Elmer Applied Biosystems). The tissue sections were deparaffinized twice in xylene for five minutes each, followed by a two-step rehydration in 100 percent ethanol. The air-dried pellet was then resuspended in buffer with proteinase K, incubated for 18 hours at 37°C and 3 hours at 55°C, and then heat inactivated for 10 minutes at 98°C.

The PCR primers were synthesized to amplify the viral cyclin of HHV-8 encoded by ORF72. Primer set KS1 and KS2 (KS1, 5'CGCCTGTAGAACGGAAACAT; KS2, 5'TTGCCCGCCTCTATTATCAG) amplifies a 138-bp fragment of HHV-8. The PCR conditions have been described previously.²⁴

DNA from each PCR product was quantified with the use of ultraviolet photospectrometry, then diluted to a concentration of 20 ng per microliter of water. ORF72-specific primers were diluted to a concentration of 10 µM in water. The samples were sequenced at the Diabetes and Endocrinology Research Center's Molecular Biology Core Facility (Barbara Davis Center, University of Colorado Health Sciences Center). We used the Basic Local Alignment Search Tool 2 (BLAST2) Sequences program of the National Center for Biotechnology Information, which aligns two sequences, to determine the degree of homology between the two sequences.²⁵

Analysis of BMPR2 for Mutations

DNA from the 16 patients with primary pulmonary hypertension was screened for at least seven of the most commonly reported mutations in the BMPR2 gene. Mutations K230fs, I860fs, and R899X have been reported by two or more independent groups.^1,26,27,28 The details of the analysis are provided in Supplementary Appendix 2, available with the full text of this article at http://www.nejm.org.

Results

Screening

In the screening study, 4 of 15 microdissected plexiform lesions from patients with pulmonary hypertension were positive for ORF26 by PCR.

Immunohistochemical Findings

Ten of the 16 patients with primary pulmonary hypertension (62 percent), but none of the 14 patients with secondary pulmonary hypertension, had lung-tissue sections that showed the characteristic nuclear-staining pattern when probed with a monoclonal antibody directed against the LANA-1 of HHV-8 encoded by ORF73 (Table 1 and Figure 1). The lymph node from one of the patients with Castleman's disease and primary pulmonary hypertension (Patient 17) was negative for LANA-1. We found that not only cells within the plexiform lesions but also bronchoepithelial cells, inflammatory cells (lymphocytes and macrophages), and endothelial cells lining patent lung vessels were positive for LANA-1. Smooth-muscle cells were consistently negative for LANA-1 (Figure 1C). All specimens from the five controls were negative for LANA-1.

View larger version (49K): [in this window] [in a new window]   Figure 1. Plexiform Lesions from One Patient with Primary Pulmonary Hypertension (Panels A, B, C, D, and E) and a Kaposi's Sarcoma Skin Lesion from One Patient Infected with Human Immunodeficiency Virus Type 1 (Panels F, G, H, I, and J). In Panel A, tufts of abnormal capillary-like structures that occlude the lumen of small pulmonary arteries are the histologic hallmark of severe pulmonary hypertension (hematoxylin and eosin, x200). The inset shows a high-power view of the plump, spindle-shaped endothelial cells that make up much of the lesion (hematoxylin and eosin, x1000). Panel B shows immunohistochemical staining for latency-associated nuclear antigen 1 (LANA-1) in multiple cells of the plexiform lesion (x400). The inset highlights the punctate nuclear staining of the spindle-shaped endothelial cells (x1000). In Panel C, LANA-1 is absent from smooth-muscle cells (arrowhead) but present in the monolayer of endothelial cells lining the vessel lumen (arrows) and the epithelial cells of the adjacent bronchiole (x200). In Panel D, immunofluorescence staining for factor VIII–related antigen demonstrates the presence of endothelial cells (green) within the plexiform lesion (x400). Nuclei are blue (4',6-diamidino-2-phenolindole). In Panel E, immunostaining for vascular endothelial growth factor (VEGF) shows a high level of expression within the plexiform lesion (arrow) and no expression in the surrounding lung tissue (x400). Panel F shows the characteristic features of a section of Kaposi's sarcoma skin lesion: plump, spindle-shaped cells containing irregular, angulated, slit-like spaces lined by endothelial cells (hematoxylin and eosin, x400). Panel G shows prominent immunohistochemical staining for LANA-1 in the nuclei of the Kaposi's sarcoma lesion (x400). The inset shows the characteristic punctate nuclear staining (x1000). As was true in the plexiform lesion, not all of the cells are positive for LANA-1. In Panel H, the skin tissue serves as a negative control for Kaposi's sarcoma skin lesions (x400). In Panel I, immunofluorescence staining for factor VIII–related antigen reveals the prominent endothelial-cell component (green) (x400). In Panel J, the Kaposi's sarcoma lesion, like the plexiform lesion, has a high level of expression of VEGF on immunostaining, whereas the surrounding tissue is negative for VEGF (x400).

 
HHV-8 Viral Cyclin

On PCR, 10 of the 16 patients with primary pulmonary hypertension (the same 10 who were positive for LANA-1 on immunohistochemical analysis) and 1 of 14 patients with secondary pulmonary hypertension had tissue sections that were positive for the viral cyclin gene of HHV-8 encoded by ORF72. Specimens from all five controls were negative for the viral cyclin gene on PCR (Table 1 and Figure 2).

View larger version (18K): [in this window] [in a new window]   Figure 2. Detection of a Human Herpesvirus 8 Gene by Means of Polymerase-Chain-Reaction Amplification of Viral Cyclin Encoded by Open Reading Frame 72 (ORF72). Using primer pairs specific for ORF72, we subjected 200 ng of genomic DNA to one round (35 cycles) of PCR amplification. Genomic DNA was from patients with primary pulmonary hypertension (lanes 1 through 12 and 14, 15, 16, and 17), pulmonary capillary hemangiomatosis (PCH) (lane 18), secondary pulmonary hypertension (lanes 13 and 19 through 31), cryptogenic organizing pneumonia (COP) (lanes 32 and 33), nonspecific interstitial pneumonitis (NSIP) (lane 34), and emphysema (lane 36) and from a subject with normal lung tissue (lane 35). CREST denotes calcinosis, Raynaud's phenomenon, esophageal dysmotility, sclerodactyly, and telangiectasis.

 
Sequence analysis of one skin lesion from a patient with Kaposi's sarcoma and four lung samples from patients with pulmonary hypertension who were positive for the HHV-8 viral cyclin gene on PCR analysis showed a high degree of sequence homology with the published full-length HHV-8 sequence. The Kaposi's sarcoma lesion was 91 percent homologous, as was the sample from Patient 2. The sample from Patient 4 was 97 percent homologous, that from Patient 6 was 86 percent homologous, and that from Patient 20 was 98 percent homologous (Figure 3). Long stretches of conserved sequences were found toward the 5' end of the gene, whereas the sequences in the 3' region were more variable.

View larger version (24K): [in this window] [in a new window]   Figure 3. Homology with the Published Human Herpesvirus 8 Sequence in Viral Cyclin Sequences from a Kaposi's Sarcoma Skin Lesion and Lung-Tissue Samples from Three Patients with Primary Pulmonary Hypertension (Patients 2, 4, and 6) and One Patient with Pulmonary Hypertension Due to Infection with Human Immunodeficiency Virus Type 1 (Patient 20). The percentages are the percentages of homologous base pairs in two aligned sequences as detected by the Basic Local Alignment Search Tool 2 (BLAST2) Sequences program,25 including the program-generated gaps (the intervals that are not homologous). Only portions of the sequences are shown. Red letters represent the nucleotides at variance with the published sequence. Brackets indicate portions of the sequence with high homology. N denotes an unidentifiable nucleotide. The viral genome sequences show the expected heterogeneity for this region.

 
BMPR2 Mutations

DNA from Patient 8 had an R899X mutation in BMPR2. DNA from Patients 7, 10, and 16 had a previously unreported restriction-fragment–length polymorphism (RFLP) pattern. Thus, 4 of the 16 patients with primary pulmonary hypertension who were screened (25 percent) had mutations. Two of these patients were positive for HHV-8 on immunohistochemical and PCR analysis (Patients 8 and 16), and two were negative (Patients 7 and 10) (Table 1).

Discussion

Our studies provide evidence of HHV-8 infection in the vascular lesions and lung parenchymal cells of patients with nonfamilial primary pulmonary hypertension. HHV-8 infection of lung tissue was demonstrated with the use of two methods, immunohistochemical analysis for the expression of LANA-1 encoded by ORF73 and PCR for the detection of viral cyclin DNA encoded by ORF72. There was a high rate of concordance between staining for LANA-1 and the detection of viral cyclin DNA.

LANA-1 is constitutively expressed in lytic and latent HHV-8 infection^29,30 and is a reliable indicator of HHV-8 infection.³¹ The pulmonary vascular lesions and parenchymal cells from 10 of 16 patients with nonfamilial primary pulmonary hypertension expressed LANA-1, whereas tissue samples from only 1 of 3 patients with HIV-1–associated severe pulmonary hypertension were positive. Kaposi's sarcoma was not present in this patient. These data suggest that HIV-1–associated pulmonary hypertension can occur independently of HHV-8 infection. In contrast to specimens from patients with primary pulmonary hypertension, the lung tissue from all patients with secondary pulmonary hypertension due to known causes, such as congenital cardiac abnormalities, collagen vascular disorders, anorexigen use,³² and sarcoidosis, had no evidence of HHV-8 infection.

LANA-1, viral cyclin, and viral FLICE inhibitory protein (FLIP) are cotranscribed on two polycistronic messenger RNAs and are constitutively expressed in cells latently infected with HHV-8.³¹ Consequently, the presence of LANA-1 in plexiform lesions from patients with primary pulmonary hypertension reliably predicts the coexpression of viral cyclin and viral FLIP gene products. Viral cyclin has both functional and sequence homology with D-type cyclins, which direct cyclin-dependent kinase 4 and 6 to phosphorylate the retinoblastoma protein.^33,34 Underphosphorylated retinoblastoma protein is sequestered by the E2F family of transcription factors, which regulates the expression of cell-cycle–entry genes. Therefore, viral cyclin induces cell-cycle progression by inhibiting the function of the retinoblastoma protein. The generation of free E2F also leads to the expression of p14^ARF, ultimately increasing the expression of the p53 tumor-suppressor protein and inducing p53-dependent apoptosis.³⁵ LANA-1 inhibits the function of p53, thereby preventing apoptosis of latently infected cells.³⁶ The capacity of gene products expressed during latent infection (e.g., viral cyclin and LANA-1) to trigger unregulated cell-cycle progression while simultaneously blocking p53-dependent apoptosis is probably a major molecular mechanism contributing to the oncogenicity of HHV-8.³⁰ The pattern of inducing E2F-dependent transcription while inhibiting p53-dependent apoptosis is a common feature of several different DNA tumor viruses, such as human papillomaviruses, adenoviruses, and simian virus 40.^37,38

The types of cells that HHV-8 may infect have not all been identified. We detected the expression of LANA-1 in a variety of cells in the lungs of patients with primary pulmonary hypertension, including bronchoepithelial cells, inflammatory cells (primarily lymphocytes and macrophages), and endothelial cells. Our data suggest that HHV-8 has the capacity to infect a wide variety of cells in lung tissue, and we hypothesize that HHV-8 infection may be responsible for a broader spectrum of diseases in humans than is currently known.

Although we demonstrated HHV-8 infection of the lungs in patients with primary pulmonary hypertension, we cannot conclude that infection alone causes this condition. It is possible that some unique aspect of primary pulmonary hypertension increases the risk of HHV-8 infection. Factors unique to the plexiform lesions (e.g., local production of inflammatory cytokines) may enhance the replication of HHV-8 in affected tissues. However, that HHV-8 infection has some role in the process is suggested by the number of features that are shared by Kaposi's sarcoma and the plexiform lesions of primary pulmonary hypertension (Table 2). In primary but not secondary pulmonary hypertension, many, but not all, of the endothelial-cell clusters, which make up a large portion of the plexiform lesions, are due to the monoclonal growth of endothelial cells.⁴ In this context, it is of interest that early Kaposi's sarcoma lesions are characterized by polyclonal-cell hyperplasia, but they can develop into a true clonal cancer as the disease progresses to its nodular state.³⁹ Our findings show that Kaposi's sarcoma skin lesions and plexiform lesions in patients with primary pulmonary hypertension have histologic similarities: slit-like vascular spaces and sheets of spindle cells that express factor VIII–related antigen (an endothelial-cell marker) and VEGF. HHV-8 may thus have a particular affinity for tissues and cells that have a high level of expression of VEGF, such as lung microvascular endothelial cells or Kaposi's sarcoma cells. The increased expression of VEGF may in turn increase the growth of endothelial cells.^40,41,42

View this table: [in this window] [in a new window]   Table 2. Features Shared by Kaposi's Sarcoma Lesions and Plexiform Lesions from Patients with Primary Pulmonary Hypertension.

 
The resemblance between Kaposi's sarcoma lesions and the plexiform lesions of primary pulmonary hypertension suggests that the spectrum of molecular mechanisms leading to the development of severe pulmonary hypertension includes genetic and epigenetic mechanisms. Clearly, one or several genetic susceptibility factors are required to allow the proliferation of endothelial cells to occur in pulmonary precapillary arterioles. High shear stress (as occurs in tissues from patients with Eisenmenger's syndrome), anorexigen use, and perhaps HHV-8 infection may help trigger or amplify a process in which "the law of the endothelial cell monolayer has been broken"⁴³ and there is endothelial-cell dysfunction⁴⁴ and irreversible obliteration of the lumen by a disordered process of angiogenesis.^42,43

We propose that HHV-8 infection and the expression of viral cyclin and LANA-1 in the lungs contribute to the growth of monoclonal endothelial cells and mutations in somatic endothelial cells in plexiform lesions from patients with primary pulmonary hypertension. Our findings indicate that vasculotropic viruses such as HHV-8 can encourage the growth of endothelial cells by dysregulating cell growth or growth-factor signaling.

Supported by a program project grant from the National Institutes of Health (PO1 HL66524, to Dr. Voelkel) and by a grant from the National Heart, Lung, and Blood Institute (K08 HL03911, to Dr. Cool).

We are indebted to Drs. David Badesch, Karen Fagan, and Bertron Groves (Pulmonary Hypertension Center, University of Colorado Health Sciences Center, Denver) for their support; to Drs. Thomas Campbell and James Neid for their critical review of the manuscript; to Dr. Joanne Yi (University of California, San Diego) for providing tissue from patients with Eisenmenger's syndrome; and to Lisa Litzenberger for photographic support.

Note added in proof: While this article was being prepared, an additional patient with primary pulmonary hypertension and HHV-8–positive lung vascular lesions was identified.

Source Information

From the Pulmonary Hypertension Center (C.D.C., P.R.R., M.E.Y., A.E.S., T.M.B., M.W.G., N.F.V.), the Department of Pathology (C.D.C.), and the Webb-Waring Institute (D.H.-S.), University of Colorado Health Sciences Center; and the National Jewish Medical and Research Center (C.D.C., K.K.B., J.M.R.) — all in Denver; and the Cardiopulmonary Division, Department of Pathology, Johns Hopkins University, Baltimore (R.M.T.).

Drs. Rai and Yeager contributed equally to the article.

Address reprint requests to Dr. Voelkel at the Pulmonary and Critical Care Division, University of Colorado Health Sciences Center, Box C272, 4200 E. 9th Ave., Denver, CO 80262, or at norbert.voelkel{at}uchsc.edu.

References

1. Deng Z, Morse JH, Slager SL, et al. Familial primary pulmonary hypertension (gene PPH1) is caused by mutations in the bone morphogenetic protein receptor-II gene. Am J Hum Genet 2000;67:737-744. [CrossRef][Web of Science][Medline]
2. Tuder RM, Cool CD, Yeager M, Taraseviciene-Stewart L, Bull TM, Voelkel NF. The pathobiology of pulmonary hypertension: endothelium. Clin Chest Med 2001;22:405-418. [CrossRef][Web of Science][Medline]
3. Voelkel NF, Tuder RM. Cellular and molecular mechanisms in the pathogenesis of severe pulmonary hypertension. Eur Respir J 1995;8:2129-2138. [Abstract]
4. Lee SD, Shroyer KR, Markham NE, Cool CD, Voelkel NF, Tuder RM. Monoclonal endothelial cell proliferation is present in primary but not secondary pulmonary hypertension. J Clin Invest 1998;101:927-934. [Web of Science][Medline]
5. Yeager ME, Voelkel NF, Tuder RM. Mutational analysis of endothelial cell TGF- receptor type II in plexiform lesions of patients with primary pulmonary hypertension. Circulation 1999;100:Suppl:I-587. abstract. 
6. Geraci MW, Moore M, Gesell T, et al. Gene expression patterns in the lungs of patients with primary pulmonary hypertension: a gene microarray analysis. Circ Res 2001;88:555-562. [Free Full Text]
7. Boshoff C, Weiss RA. Kaposi's sarcoma-associated herpesvirus. Adv Cancer Res 1998;75:57-86. [Web of Science][Medline]
8. Weiss RA, Whitby D, Talbot S, Kellam P, Boshoff C. Human herpesvirus type 8 and Kaposi's sarcoma. J Natl Cancer Inst Monogr 1998;23:51-54.
9. Soulier J, Grollet L, Oksenhendler E, et al. Kaposi's sarcoma-associated herpesvirus-like DNA sequences in multicentric Castleman's disease. Blood 1995;86:1276-1280. [Free Full Text]
10. Schuylz TF, Chang Y, Moore PS. Kaposi's sarcoma-associated herpesvirus (human herpes virus 8) in human tumor viruses. In: McCance D, ed. Human tumor viruses. Washington, D.C.: American Society for Microbiology, 1998:87-134.
11. Antman K, Chang Y. Kaposi's sarcoma. N Engl J Med 2000;342:1027-1038. [Free Full Text]
12. Mette SA, Palevsky HI, Pietra GG, et al. Primary pulmonary hypertension in association with human immunodeficiency virus infection: a possible viral etiology for some forms of hypertensive pulmonary arteriopathy. Am Rev Respir Dis 1992;145:1196-1200. [Web of Science][Medline]
13. Speich R, Jenni R, Opravil M, Pfab M, Russi EW. Primary pulmonary hypertension in HIV infection. Chest 1991;100:1268-1271. [Free Full Text]
14. Mehta NJ, Khan IA, Mehta RN, Sepkowitz DA. HIV-related pulmonary hypertension: analytic review of 131 cases. Chest 2000;118:1133-1141. [Free Full Text]
15. Lennette E, Blackbourn DJ, Levy JA. Antibodies to human herpesvirus type 8 in the general population and in Kaposi's sarcoma patients. Lancet 1996;348:858-861. [CrossRef][Web of Science][Medline]
16. Bull TM, Cool CD, Serls AE, et al. Primary pulmonary hypertension, Castleman's disease and HHV-8. Eur Respir J (in press).
17. Humbert M, Monti G, Brenot F, et al. Increased interleukin-1 and interleukin-6 serum concentrations in severe primary pulmonary hypertension. Am J Respir Crit Care Med 1995;151:1628-1631. [Abstract]
18. Eddahibi S, Humbert M, Sediame S, et al. Imbalance between platelet vascular endothelial growth factor and platelet-derived growth factor in pulmonary hypertension: effect of prostacyclin therapy. Am J Respir Crit Care Med 2000;162:1493-1499. [Free Full Text]
19. Tuder RM, Groves B, Badesch DB, Voelkel NF. Exuberant endothelial cell growth and elements of inflammation are present in plexiform lesions of pulmonary hypertension. Am J Pathol 1994;144:275-285. [Abstract]
20. Tuder RM, Voelkel NF. Pulmonary hypertension and inflammation. J Lab Clin Med 1998;132:16-24. [CrossRef][Web of Science][Medline]
21. Chang Y, Cesarman E, Pessin MS, et al. Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposi's sarcoma. Science 1994;266:1865-1869. [Free Full Text]
22. Moore PS, Chang Y. Detection of herpesvirus-like DNA sequences in Kaposi's sarcoma in patients with and without HIV infection. N Engl J Med 1995;332:1181-1185. [Free Full Text]
23. Dupin N, Fisher C, Kellam P, et al. Distribution of human herpesvirus-8 latently infected cells in Kaposi's sarcoma, multicentric Castleman's disease, and primary effusion lymphoma. Proc Natl Acad Sci U S A 1999;96:4546-4551. [Free Full Text]
24. Pan L, Milligan L, Michaeli J, Cesarman E, Knowles DM. Polymerase chain reaction detection of Kaposi's sarcoma-associated herpesvirus-optimized protocols and their application to myeloma. J Mol Diagn 2001;3:32-38. [Free Full Text]
25. BLAST 2 sequences. (Accessed August 22, 2003, at http://www.ncbi.nlm.nih.gov/blast/bl2seq/bl2.html.)
26. Thomson JR, Machado RD, Pauciulo MW, et al. Sporadic primary pulmonary hypertension is associated with germline mutations of the gene encoding BMPR-II, a receptor member of the TGF-beta family. J Med Genet 2000;37:741-745. [Free Full Text]
27. Lane KB, Machado RD, Pauciulo MW, et al. Heterozygous germline mutations in BMPR2, encoding a TGF-beta receptor, cause familial primary pulmonary hypertension. Nat Genet 2000;26:81-84. [CrossRef][Web of Science][Medline]
28. Machado RD, Pauciulo MW, Thomson JR, et al. BMPR2 haploinsufficiency as the inherited molecular mechanism for primary pulmonary hypertension. Am J Hum Genet 2001;68:92-102. [CrossRef][Web of Science][Medline]
29. Sarid R, Flore O, Bohenzky RA, Chang Y, Moore PS. Transcription mapping of the Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) genome in a body cavity-based lymphoma cell line (BC-1). J Virol 1998;72:1005-1012. [Free Full Text]
30. Fakhari FD, Dittmer DP. Charting latency transcripts in Kaposi's sarcoma-associated herpesvirus by whole-genome real-time quantitative PCR. J Virol 2002;76:6213-6223. [Free Full Text]
31. Dittmer D, Lagunoff M, Renne R, Staskus K, Haase A, Ganem D. A cluster of latently expressed genes in Kaposi's sarcoma-associated herpesvirus. J Virol 1998;72:8309-8315. [Free Full Text]
32. Abenhaim L, Moride Y, Brenot F, et al. Appetite-suppressant drugs and the risk of primary pulmonary hypertension: International Primary Pulmonary Hypertension Study Group. N Engl J Med 1996;335:609-616. [Free Full Text]
33. Cesarman E, Nador RG, Bai F, et al. Kaposi's sarcoma-associated herpesvirus contains G protein-coupled receptor and cyclin D homologs which are expressed in Kaposi's sarcoma and malignant lymphoma. J Virol 1996;70:8218-8223. [Abstract]
34. Chang Y, Moore PS, Talbot SJ, et al. Cyclin encoded by KS herpesvirus. Nature 1996;382:410-410. [CrossRef][Medline]
35. Bates S, Phillips AC, Clark PA, et al. p14ARF links the tumour suppressors RB and p53. Nature 1998;395:124-125. [CrossRef][Medline]
36. Friborg J Jr, Kong W, Hottiger MO, Nabel GJ. p53 Inhibition of the LANA protein of KSHV protects against cell death. Nature 1999;402:889-894. [Medline]
37. Munger K, Howley PM. Human papillomavirus immortalization and transformation functions. Virus Res 2002;89:213-228. [CrossRef][Web of Science][Medline]
38. zur Hausen H. Oncogenic DNA viruses. Oncogene 2001;20:7820-7823. [CrossRef][Web of Science][Medline]
39. Judde JG, Lacoste V, Briere J, et al. Monoclonality or oligoclonality of human herpesvirus 8 terminal repeat sequences in Kaposi's sarcoma and other diseases. J Natl Cancer Inst 2000;92:729-736. [Free Full Text]
40. Masood R, Cai J, Zheng T, Smith DL, Naidu Y, Gill PS. Vascular endothelial growth factor/vascular permeability factor is an autocrine growth factor for AIDS-Kaposi sarcoma. Proc Natl Acad Sci U S A 1997;94:979-984. [Free Full Text]
41. Masood R, Cesarman E, Smith DL, Gill PS, Flore O. Human herpesvirus-8-transformed endothelial cells have functionally activated vascular endothelial growth factor/vascular endothelial growth factor receptor. Am J Pathol 2002;160:23-29. [Free Full Text]
42. Tuder RM, Chacon M, Alger L, et al. Expression of angiogenesis-related molecules in plexiform lesions in severe pulmonary hypertension: evidence for a process of disordered angiogenesis. J Pathol 2001;195:367-374. [CrossRef][Web of Science][Medline]
43. Voelkel NF, Cool C, Taraceviene-Stewart L, et al. Janus face of vascular endothelial growth factor: the obligatory survival factor for lung vascular endothelium controls precapillary artery remodeling in severe pulmonary hypertension. Crit Care Med 2002;30:Suppl 5:S251-S256. [CrossRef][Web of Science][Medline]
44. Loscalzo J. Endothelial dysfunction in pulmonary hypertension. N Engl J Med 1992;327:117-119. [Web of Science][Medline]

Abstract PDF PDA Full Text PowerPoint Slide Set Supplementary Material Perspective by Cesarman, E. Letters Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited E-mail When Letters Appear PubMed Citation

Related Letters:

HHV-8 in Pulmonary Hypertension
Henke-Gendo C., Schulz T. F., Hoeper M. M., Cool C. D., Rai P. R., Voelkel N. F.
Extract | Full Text | PDF  
N Engl J Med 2004; 350:194-195, Jan 8, 2004. Correspondence

This article has been cited by other articles:

• Hassoun, P. M., Mouthon, L., Barbera, J. A., Eddahibi, S., Flores, S. C., Grimminger, F., Jones, P. L., Maitland, M. L., Michelakis, E. D., Morrell, N. W., Newman, J. H., Rabinovitch, M., Schermuly, R., Stenmark, K. R., Voelkel, N. F., Yuan, J. X.-J., Humbert, M. (2009). Inflammation, growth factors, and pulmonary vascular remodeling.. J Am Coll Cardiol 54: S10-S19 [Abstract] [Full Text]  
• Yu, Y., Keller, S. H., Remillard, C. V., Safrina, O., Nicholson, A., Zhang, S. L., Jiang, W., Vangala, N., Landsberg, J. W., Wang, J.-Y., Thistlethwaite, P. A., Channick, R. N., Robbins, I. M., Loyd, J. E., Ghofrani, H. A., Grimminger, F., Schermuly, R. T., Cahalan, M. D., Rubin, L. J., Yuan, J. X.-J. (2009). A Functional Single-Nucleotide Polymorphism in the TRPC6 Gene Promoter Associated With Idiopathic Pulmonary Arterial Hypertension. Circulation 119: 2313-2322 [Abstract] [Full Text]  
• Bull, T. M., Meadows, C. A., Coldren, C. D., Moore, M., Sotto-Santiago, S. M., Nana-Sinkam, S. P., Campbell, T. B., Geraci, M. W. (2008). Human Herpesvirus-8 Infection of Primary Pulmonary Microvascular Endothelial Cells. Am. J. Respir. Cell Mol. Bio. 39: 706-716 [Abstract] [Full Text]  
• Butrous, G., Ghofrani, H. A., Grimminger, F. (2008). Pulmonary Vascular Disease in the Developing World. Circulation 118: 1758-1766 [Full Text]  
• Michelakis, E. D., Wilkins, M. R., Rabinovitch, M. (2008). Emerging Concepts and Translational Priorities in Pulmonary Arterial Hypertension. Circulation 118: 1486-1495 [Full Text]  
• Humbert, M., Hoeper, M. M. (2008). Severe Pulmonary Arterial Hypertension: A Forme Fruste of Cancer?. Am. J. Respir. Crit. Care Med. 178: 551-552 [Full Text]  
• Rai, P. R., Cool, C. D., King, J. A. C., Stevens, T., Burns, N., Winn, R. A., Kasper, M., Voelkel, N. F. (2008). The Cancer Paradigm of Severe Pulmonary Arterial Hypertension. Am. J. Respir. Crit. Care Med. 178: 558-564 [Abstract] [Full Text]  
• Spiekerkoetter, E., Alvira, C. M., Kim, Y.-M., Bruneau, A., Pricola, K. L., Wang, L., Ambartsumian, N., Rabinovitch, M. (2008). Reactivation of {gamma}HV68 induces neointimal lesions in pulmonary arteries of S100A4/Mts1-overexpressing mice in association with degradation of elastin. Am. J. Physiol. Lung Cell. Mol. Physiol. 294: L276-L289 [Abstract] [Full Text]  
• Barnett, C. F., Hsue, P. Y., Machado, R. F. (2008). Pulmonary Hypertension: An Increasingly Recognized Complication of Hereditary Hemolytic Anemias and HIV Infection. JAMA 299: 324-331 [Abstract] [Full Text]  
• Weslow-Schmidt, J. L., Jewell, N. A., Mertz, S. E., Simas, J. P., Durbin, J. E., Flano, E. (2007). Type I Interferon Inhibition and Dendritic Cell Activation during Gammaherpesvirus Respiratory Infection. J. Virol. 81: 9778-9789 [Abstract] [Full Text]  
• Klinger, J. R. (2007). Pulmonary Arterial Hypertension: An Overview. SEMIN CARDIOTHORAC VASC ANESTH 11: 96-103 [Abstract]  
• Hagen, M., Fagan, K., Steudel, W., Carr, M., Lane, K., Rodman, D. M., West, J. (2007). Interaction of interleukin-6 and the BMP pathway in pulmonary smooth muscle. Am. J. Physiol. Lung Cell. Mol. Physiol. 292: L1473-L1479 [Abstract] [Full Text]  
• Taraseviciene-Stewart, L., Scerbavicius, R., Choe, K.-H., Cool, C., Wood, K., Tuder, R. M., Burns, N., Kasper, M., Voelkel, N. F. (2006). Simvastatin causes endothelial cell apoptosis and attenuates severe pulmonary hypertension. Am. J. Physiol. Lung Cell. Mol. Physiol. 291: L668-L676 [Abstract] [Full Text]  
• Ghofrani, H. A., Voswinckel, R., Reichenberger, F., Weissmann, N., Schermuly, R. T., Seeger, W., Grimminger, F. (2006). Hypoxia- and non-hypoxia-related pulmonary hypertension - Established and new therapies. Cardiovasc Res 72: 30-40 [Abstract] [Full Text]  
• Marecki, J. C., Cool, C. D., Parr, J. E., Beckey, V. E., Luciw, P. A., Tarantal, A. F., Carville, A., Shannon, R. P., Cota-Gomez, A., Tuder, R. M., Voelkel, N. F., Flores, S. C. (2006). HIV-1 Nef Is Associated with Complex Pulmonary Vascular Lesions in SHIV-nef-infected Macaques. Am. J. Respir. Crit. Care Med. 174: 437-445 [Abstract] [Full Text]  
• Witzenrath, M., Ahrens, B., Kube, S. M., Hocke, A. C., Rosseau, S., Hamelmann, E., Suttorp, N., Schutte, H. (2006). Allergic lung inflammation induces pulmonary vascular hyperresponsiveness. Eur Respir J 28: 370-377 [Abstract] [Full Text]  
• Zabka, T. S., Campbell, F. E., Wilson, D. W. (2006). Pulmonary arteriopathy and idiopathic pulmonary arterial hypertension in six dogs.. Vet Pathol 43: 510-522 [Abstract] [Full Text]  
• Speciale, L., Biffi, R., Mancuso, R., Borghi, E., Mazziotti, R., Ferrante, P. (2006). Big endothelin-1 and interleukin-6 modulation in human microvascular endothelial cells after human herpesvirus 8 infection.. Exp. Biol. Med. 231: 1171-1175 [Abstract] [Full Text]  
• Hoeper, M. M., Rubin, L. J. (2006). Update in pulmonary hypertension 2005.. Am. J. Respir. Crit. Care Med. 173: 499-505 [Full Text]  
• Voelkel, N. F., Vandivier, R. W., Tuder, R. M. (2006). Vascular endothelial growth factor in the lung. Am. J. Physiol. Lung Cell. Mol. Physiol. 290: L209-L221 [Abstract] [Full Text]  
• Steed, A. L., Barton, E. S., Tibbetts, S. A., Popkin, D. L., Lutzke, M. L., Rochford, R., Virgin, H. W. IV (2006). Gamma Interferon Blocks Gammaherpesvirus Reactivation from Latency. J. Virol. 80: 192-200 [Abstract] [Full Text]  
• Hsue, P. Y., Waters, D. D. (2005). What a Cardiologist Needs to Know About Patients With Human Immunodeficiency Virus Infection. Circulation 112: 3947-3957 [Abstract] [Full Text]  
• Katano, H., Hogaboam, C. M. (2005). Herpesvirus-associated Pulmonary Hypertension?. Am. J. Respir. Crit. Care Med. 172: 1485-1486 [Full Text]  
• Henke-Gendo, C., Mengel, M., Hoeper, M. M., Alkharsah, K., Schulz, T. F. (2005). Absence of Kaposi's Sarcoma-associated Herpesvirus in Patients with Pulmonary Arterial Hypertension. Am. J. Respir. Crit. Care Med. 172: 1581-1585 [Abstract] [Full Text]  
• Nicolls, M. R., Taraseviciene-Stewart, L., Rai, P. R., Badesch, D. B., Voelkel, N. F. (2005). Autoimmunity and pulmonary hypertension: a perspective. Eur Respir J 26: 1110-1118 [Abstract] [Full Text]  
• Cool, C. D., Groshong, S. D., Oakey, J., Voelkel, N. F. (2005). Pulmonary Hypertension: Cellular and Molecular Mechanisms. Chest 128: 565S-571S [Full Text]  
• Rabinovitch, M. (2005). Cellular and Molecular Pathobiology of Pulmonary Hypertension Conference Summary. Chest 128: 642S-646S [Full Text]  
• Rabinovitch, M. (2005). Cellular and Molecular Pathobiology of Pulmonary Hypertension Conference Summary. Chest 128: 642S-646S [Full Text]  
• Montani, D., Achouh, L., Marcelin, A. G., Viard, J-P., Hermine, O., Canioni, D., Sitbon, O., Simonneau, G., Humbert, M. (2005). Reversibility of pulmonary arterial hypertension in HIV/HHV8-associated Castleman's disease. Eur Respir J 26: 969-972 [Abstract] [Full Text]  
• Zaiman, A., Fijalkowska, I., Hassoun, P. M., Tuder, R. M. (2005). One Hundred Years of Research in the Pathogenesis of Pulmonary Hypertension. Am. J. Respir. Cell Mol. Bio. 33: 425-431 [Full Text]  
• Mora, A. L., Woods, C. R., Garcia, A., Xu, J., Rojas, M., Speck, S. H., Roman, J., Brigham, K. L., Stecenko, A. A. (2005). Lung infection with {gamma}-herpesvirus induces progressive pulmonary fibrosis in Th2-biased mice. Am. J. Physiol. Lung Cell. Mol. Physiol. 289: L711-L721 [Abstract] [Full Text]  
• Ogawa, A., Nakamura, K., Matsubara, H., Fujio, H., Ikeda, T., Kobayashi, K., Miyazaki, I., Asanuma, M., Miyaji, K., Miura, D., Kusano, K. F., Date, H., Ohe, T. (2005). Prednisolone Inhibits Proliferation of Cultured Pulmonary Artery Smooth Muscle Cells of Patients With Idiopathic Pulmonary Arterial Hypertension. Circulation 112: 1806-1812 [Abstract] [Full Text]  
• Wheat, W. H., Cool, C. D., Morimoto, Y., Rai, P. R., Kirkpatrick, C. H., Lindenbaum, B. A., Bates, C. A., Ellison, M. C., Serls, A. E., Brown, K. K., Routes, J. M. (2005). Possible role of human herpesvirus 8 in the lymphoproliferative disorders in common variable immunodeficiency. JEM 202: 479-484 [Abstract] [Full Text]  
• Guihot, A., Couderc, L-J., Agbalika, F., Galicier, L., Bossi, P., Rivaud, E., Scherrer, A., Zucman, D., Katlama, C., Oksenhendler, E. (2005). Pulmonary manifestations of multicentric Castleman's disease in HIV infection: a clinical, biological and radiological study. Eur Respir J 26: 118-125 [Abstract] [Full Text]  
• Deraet, M., Manivet, P., Janoshazi, A., Callebert, J., Guenther, S., Drouet, L., Launay, J.-M., Maroteaux, L. (2005). The Natural Mutation Encoding a C Terminus-Truncated 5-Hydroxytryptamine2B Receptor Is a Gain of Proliferative Functions. Mol. Pharmacol. 67: 983-991 [Abstract] [Full Text]  
• Procop, G. W., Kohn, D. J., Johnson, J. E., Li, H. J., Loyd, J. E., Yen-Lieberman, B., Tang, Y. W. (2005). BK and JC Polyomaviruses Are Not Associated with Idiopathic Pulmonary Fibrosis. J. Clin. Microbiol. 43: 1385-1386 [Abstract] [Full Text]  
• Laney, A. S., De Marco, T., Peters, J. S., Malloy, M., Teehankee, C., Moore, P. S., Chang, Y. (2005). Kaposi Sarcoma-Associated Herpesvirus and Primary and Secondary Pulmonary Hypertension. Chest 127: 762-767 [Abstract] [Full Text]  
• Yuan, J. X.-J., Rubin, L. J. (2005). Pathogenesis of Pulmonary Arterial Hypertension: The Need for Multiple Hits. Circulation 111: 534-538 [Full Text]  
• Kido, M., Du, L., Sullivan, C. C., Deutsch, R., Jamieson, S. W., Thistlethwaite, P. A. (2005). Gene transfer of a TIE2 receptor antagonist prevents pulmonary hypertension in rodents. J. Thorac. Cardiovasc. Surg. 129: 268-276 [Abstract] [Full Text]  
• Richter, A., Yeager, M. E., Zaiman, A., Cool, C. D., Voelkel, N. F., Tuder, R. M. (2004). Impaired Transforming Growth Factor-{beta} Signaling in Idiopathic Pulmonary Arterial Hypertension. Am. J. Respir. Crit. Care Med. 170: 1340-1348 [Abstract] [Full Text]  
• Lorber, B. (2004). Update in Infectious Diseases. ANN INTERN MED 141: 875-881 [Full Text]  
• Bull, T. M., Coldren, C. D., Moore, M., Sotto-Santiago, S. M., Pham, D. V., Nana-Sinkam, S. P., Voelkel, N. F., Geraci, M. W. (2004). Gene Microarray Analysis of Peripheral Blood Cells in Pulmonary Arterial Hypertension. Am. J. Respir. Crit. Care Med. 170: 911-919 [Abstract] [Full Text]  
• Farber, H. W., Loscalzo, J. (2004). Pulmonary Arterial Hypertension. NEJM 351: 1655-1665 [Full Text]  
• Humbert, M., Morrell, N. W., Archer, S. L., Stenmark, K. R., MacLean, M. R., Lang, I. M., Christman, B. W., Weir, E. K., Eickelberg, O., Voelkel, N. F., Rabinovitch, M. (2004). Cellular and molecular pathobiology of pulmonary arterial hypertension. J Am Coll Cardiol 43: 13S-24S [Abstract] [Full Text]  
• Pietra, G. G., Capron, F., Stewart, S., Leone, O., Humbert, M., Robbins, I. M., Reid, L. M., Tuder, R. M. (2004). Pathologic assessment of vasculopathies in pulmonary hypertension. J Am Coll Cardiol 43: 25S-32S [Abstract] [Full Text]  
• Luna, R. E., Zhou, F., Baghian, A., Chouljenko, V., Forghani, B., Gao, S.-J., Kousoulas, K. G. (2004). Kaposi's Sarcoma-Associated Herpesvirus Glycoprotein K8.1 Is Dispensable for Virus Entry. J. Virol. 78: 6389-6398 [Abstract] [Full Text]  
• Rabinovitch, M. (2004). The Mouse Through the Looking Glass: A New Door Into the Pathophysiology of Pulmonary Hypertension. Circ. Res. 94: 1001-1004 [Full Text]  
• (2004). Herpesvirus 8 and Primary Pulmonary Hypertension. Journal Watch Cardiology 2004: 5-5 [Full Text]  
• Henke-Gendo, C., Schulz, T. F., Hoeper, M. M., Cool, C. D., Rai, P. R., Voelkel, N. F. (2004). HHV-8 in Pulmonary Hypertension. NEJM 350: 194-195 [Full Text]