Growth Hormone Insensitivity Associated with a STAT5b Mutation
Eric M. Kofoed, B.A., Vivian Hwa, Ph.D., Brian Little, B.A., Katie A. Woods, M.D., Caroline K. Buckway, M.D., Junko Tsubaki, M.D., Katherine L. Pratt, M.S., Liliana Bezrodnik, M.D., Hector Jasper, M.D., Alejandro Tepper, M.D., Juan J. Heinrich, M.D., and Ron G. Rosenfeld, M.D.
The syndrome of growth hormone insensitivity is characterizedby phenotypic features consistent with the presence of a growthhormone deficiency, but with normal-to-elevated circulatingconcentrations of growth hormone and resistance to exogenousgrowth hormone therapy.1 Originally described by Laron and colleagues,2the syndrome, it has become increasingly apparent, involvesconsiderable phenotypic heterogeneity, reflecting, at leastin part, the complexity of the growth hormone signaling cascade.The majority of patients described to date have low serum concentrationsof growth hormone–binding protein, the extracellular domainof the growth hormone receptor, as a result of mutations ordeletions that affect the growth hormone–binding regionof the receptor.3,4,5 A number of patients, however, have beendescribed who have normal or even elevated serum concentrationsof growth hormone–binding protein.6,7 These include patientswith mutations in the growth hormone receptor that affect dimerization8or the transmembrane and intracellular regions.9,10,11,12
Growth hormone insensitivity in patients who are positive forgrowth hormone–binding protein might also result fromdefects in the signaling of growth hormone receptor. Dimerizationof the receptor activates Janus kinase 2 (JAK2), a receptor-associatedkinase that phosphorylates both itself and the growth hormonereceptor. The phosphorylated residues act as docking sites fora variety of molecules, which undergo subsequent phosphorylationby JAK2, resulting in the activation of the signal transducersand activators of transcription (STAT), phosphatidylinositol-3kinase, and mitogen-activated protein kinase pathways. Collectively,these pathways mediate the growth-promoting and metabolic actionsof growth hormone.
Although several patients with a phenotype of growth hormoneinsensitivity and normal growth hormone receptor (GHR) geneshave been described, no specific molecular defects downstreamof the receptor have been identified.13,14,15,16 We now describea patient with the clinical and biochemical characteristicsof growth hormone insensitivity, a normal GHR gene, and a homozygousmissense mutation in the gene for STAT5b.
Case Report
A 1400-g baby girl was born at 33 weeks of gestation to consanguineousArgentine parents. Paternal and maternal heights were 173.6and 155.8 cm, respectively. There was no family history of growthfailure, and the girl's younger sisters were of normal stature.At birth, she required care in a neonatal unit because of respiratorydifficulties. Poor weight gain and growth failure were notedduring the first three years of life, and evaluations for failureto thrive and malabsorption revealed no abnormalities. The girlwas first referred to an endocrine center at seven years ofage, when her height was 97 cm and her weight was 14 kg, bothfar below the 5th percentiles. She also had respiratory difficulties,with increased oxygen requirements; an eventual lung biopsywas interpreted as indicating lymphoid interstitial pneumonia.Studies were negative for human immunodeficiency virus, cytomegalovirus,and Epstein–Barr virus. The patient was treated with corticosteroids,with partial improvement, but she continued to have multipleepisodes of bronchial obstruction. At the age of eight years,she presented with severe hemorrhagic varicella and subsequentlyhad several episodes of herpes zoster. A progressive worseningof her pulmonary function resulted in a second lung biopsy atthe age of 10 years (diagnosis, lymphoid interstitial pneumonia),and Pneumocystis carinii was isolated from the tissue.
A 12-month trial of growth hormone therapy resulted in no improvementin growth rate (Figure 1A). At the age of 16.5 years, her heightwas 117.8 cm (7.5 SD below the mean for age), with normal bodyproportions and delayed secondary sex characteristics (Tannerstage III pubertal development). She had a prominent forehead,a saddle nose, and a high-pitched voice. In an insulin–argininegrowth hormone stimulation test, the serum growth hormone concentrationwas 9.4 ng per milliliter after an overnight fast, with a peakconcentration of 53.8 ng per milliliter after stimulation with0.05 U of insulin per kilogram of body weight (normal value,>10), and the serum growth hormone–binding proteinconcentration was 1236 pmol per liter (normal range, 431 to1892). Serum concentrations of insulin-like growth factor I(IGF-I), insulin-like growth factor–binding protein 3(IGFBP-3), and the acid-labile subunit were all markedly low,with poor responses to seven consecutive daily injections ofgrowth hormone (0.05 mg per kilogram of body weight per day)(Figure 1B). All studies were approved by the institutionalreview board at Oregon Health and Science University, and writteninformed consent was obtained from the patient and her parents.
Figure 1. Growth Curve of the Patient between the Ages of 4 and 16 Years (Panel A); Response of Insulin-Like Growth Factor I (IGF-I), Insulin-Like Growth Factor–Binding Protein 3 (IGFBP-3), and Acid-Labile Subunit to Stimulation with Growth Hormone (Panel B); and the Transcriptional Regulation of IGF-I (Panel C) and IGFBP-3 (Panel D) by Growth Hormone.
The arrows in Panel A indicate the 12-month period when the patient received growth hormone therapy. Panel B shows the response of IGF-I to the administration of human growth hormone when the patient was 16.5 years old (0.05 mg per kilogram of body weight per day for seven days). Laboratory studies performed at the age of 16.5 years also revealed a 46,XX karyotype and a bone age of 13.5 years. In Panel C, primary fibroblasts were incubated with growth hormone (500 ng per milliliter) for 0, 10, 60, and 180 minutes. Total RNA was collected, and the response of IGF-I messenger RNA (mRNA) to growth hormone was analyzed with the use of real-time quantitative polymerase chain reaction. Results are normalized to those for 18S and are expressed as the relative difference as compared with untreated cells. Data are the means (±SD) from two independent experiments. In Panel D, primary fibroblasts were treated with growth hormone (500 ng per milliliter) for 24 or 48 hours, and total RNA was collected. The results of Northern blotting for IGFBP-3 are shown; -actin was used as a control.
Methods
Serum concentrations of IGF-I, IGFBP-3, and acid-labile subunit(Diagnostic Systems Laboratories),17 growth hormone–bindingprotein (Esoterix Endocrinology), and growth hormone (NicholsInstitute Diagnostics) were measured in the patient and controlsubjects. Primary fibroblast cultures were established fromskin-biopsy specimens obtained from the patient and a healthy30-year-old woman in compliance with ethics guidelines. Additionalnormal dermal fibroblasts from a 31-year-old woman were purchasedfrom BioWhittaker. Further details concerning cell culture areprovided in Supplementary Appendix 1 (available with the fulltext of this article at http://www.nejm.org). Details of Westernimmunoblotting, genomic, and complementary DNA (cDNA) analysis,real-time quantitative polymerase chain reaction (PCR) for IGF-Itranscripts, and Northern analysis for IGFBP-3 are also providedin Supplementary Appendix 1.
Results
Analysis of the Growth Hormone Receptor Gene and Protein
Sequencing of genomic DNA from the patient's lymphocytes didnot show any mutations in the GHR gene. Sequencing of GHR cDNAamplified from fibroblasts by reverse-transcriptase PCR (RT-PCR)confirmed that the GHR coding region was normal. Corroboratingthe genetic data, normal growth hormone receptor was readilydetected in fibroblast-cell lysates by immunoblot analysis (datanot shown). These findings were consistent with the patient'snormal serum growth hormone–binding protein concentrationand suggested that the defect occurs downstream from GHR.
Expression of IGF-I and IGFBP-3 Messenger RNA
Growth hormone–induced regulation of the expression ofIGF-I and IGFBP-3 was assessed in primary fibroblasts. IGF-Imessenger RNA (mRNA) was monitored by real-time quantitativePCR 0, 10, 60, and 180 minutes after the addition of growthhormone (Figure 1C). Primers for IGF-I were as follows: 5'TGCCCGGCTAATTTTTTGG3'(forward) and 5'CATGCCTGTAATCCCAGCAA3' (reverse) (further detailsare available in Supplementary Appendix 1). Transcriptionalregulation of IGF-I mRNA was reproducibly induced in two independentcultures of normal fibroblasts; elevated mRNA concentrationswere evident within 10 minutes after the administration of growthhormone, peaked at 60 minutes (with an 80 percent increase),and were sustained for 180 minutes. In contrast, the fibroblastsfrom the patient showed no increase in IGF-I transcription inresponse to growth hormone; there was even a reduction in transcriptionof 30 to 40 percent 60 minutes after treatment.
To assess the expression of IGFBP-3, total RNA was collectedat 24 and 48 hours from untreated cells and from cells thathad been incubated with growth hormone. Northern blotting analysisdemonstrated that the level of expression of IGFBP-3 tripledin normal primary fibroblasts within 24 hours after growth hormonestimulation, whereas there was no such increase in the patient'scells (Figure 1D). These observations reflected the markedlyreduced serum concentrations of IGF-I and IGFBP-3, as well asthe minimal increase in these proteins after the administrationof growth hormone in vivo (Figure 1B).
GHR Signal-Transduction Patterns
Signal transduction involving the growth hormone receptor occursby means of at least three well-established pathways: the signalingmodule involving mitogen-activated protein kinase and extracellularregulated kinase 1 and 2 (ERK1 and 2), STAT, and the phosphatidylinositol-3kinase–protein kinase B signaling module. A review ofthese pathways indicated that signal transduction from the growthhormone receptor to ERK1 and 2 was normal in normal fibroblastsand in primary fibroblasts from the patient, with a rapid onsetof phosphorylation (within 5 minutes) (data not shown), whichpeaked within 30 minutes (Figure 2A). Growth hormone–inducedsignaling through the STAT pathways (STAT1, STAT3, STAT5a, andSTAT5b) was, however, aberrant in the patient's cells. Inductionof STAT1 phosphorylation by growth hormone was poor in normalprimary skin fibroblasts, as described previously,13 and inthe fibroblasts from the two control subjects (Figure 2A). Thepatient's fibroblasts, on the contrary, demonstrated growthhormone–induced phosphorylation of STAT1 as early as 15minutes after the administration of growth hormone, which peakedbetween 30 and 60 minutes and returned to base line by 120 minutes.The degree of phosphorylation of STAT1 in the patient's fibroblastswas 8 to 10 times as great as in the control cells (Figure 2A).Interestingly, the total STAT1 concentration appeared to beat least twice as high in the patient's cells as in the controlcells. As with STAT1, growth hormone–activated phosphorylationof STAT3 was also significantly enhanced in the patient's cells,with a peak increase by a factor of approximately 8 (Figure 2A).
Figure 2. Immunoblots of Phosphorylation (p) of Signal Transducer and Activator of Transcription 1 (STAT1), STAT3, Extracellular Regulated Kinase 1 (ERK1), and ERK2 (Panel A) and STAT5 (Panel B) Induced by Growth Hormone (GH), Prolactin, and Interferon- (IFN-).
Cells were deprived of serum for 24 hours and incubated with growth hormone (500 ng per milliliter) for 0, 30, 60, and 120 minutes; interferon- (5 ng per milliliter) for 30 minutes; or prolactin (100 ng per milliliter) for 30 minutes. In Panel A, the immunoblots were probed for phosphorylated STAT1, STAT3, ERK1, and ERK2 and then reprobed for total STAT1, STAT3, and ERK2. In Panel B, the immunoblots were first probed with a specific antibody against STAT5 that detects both phosphorylated STAT5a and STAT5b. The blots were then stripped and reprobed with a specific monoclonal antibody against STAT5b and a specific antibody against STAT5a. The blots are representative of five independent experiments. The antibodies used were as follows: anti–phosphorylated STAT1, STAT3, STAT5, ERK1, and ERK2 (Cell Signaling Technology); anti-STAT5a (L-20), anti-STAT5b (G2), and anti-STAT1 (Santa Cruz Biotechnology); and anti-ERK2 and anti-STAT3 (Upstate Biotechnology).
The enhanced activation of STAT1 and STAT3 in the patient'scells was also observed when the cells were treated with prolactin,a luteotrophic hormone whose actions, like those of growth hormone,are mediated by class I cytokine receptors. In contrast, whenthe cells were incubated with interferon-, a potent STAT1 activatorwhose actions are mediated by class II cytokine receptors, theactivation of STAT1 and STAT3 was robust, and more important,it was the same as that in the normal cells (Figure 2A).
Identification of a Missense Mutation in the SH2 Domain of STAT5b
Although the signal transduction is mediated in part throughSTAT1 and STAT3, rodent knockout models (STAT5a–/–,STAT5b–/–, and STAT5a–/–b–/–)have demonstrated the requirement for STAT5b in the generationof IGF-I in response to treatment with growth hormone and fornormal postnatal growth.18,19,20 In normal fibroblasts, bothSTAT5a and STAT5b were detectable under basal conditions. Activationof STAT5 was evident but transient, with peak activity observedbetween 5 and 15 minutes after the administration of growthhormone (Figure 2B) and a return to basal concentrations by60 minutes. In the patient's cells, however (Figure 2B), immunoblottingwith antibodies specific to either STAT5a or STAT5b clearlydemonstrated that STAT5b was only poorly detectable, whereasSTAT5a was normally expressed. Furthermore, on treatment withgrowth hormone, no phosphorylation of STAT5a or STAT5b was detectable.These results suggested either that STAT5b was absent in thepatient or that the epitope recognized by the specific (monoclonal)antibody was affected by a mutation and raised questions concerningthe ability of this protein to be activated.
The 2.4-kb STAT5b coding region was amplified by RT-PCR fromthe patient's cells and from two control cell lines. A comparisonof the DNA sequences indicated that the patient was homozygousfor a single nucleotide change within the src homology (SH2)domain of STAT5b (Figure 3A). The mutation was confirmed atthe genomic level (data not shown). The mutation resulted inan amino acid substitution of proline (cct) for alanine (gct)at position 630 (A630P) (Figure 3B). The patient's parents,as expected, were heterozygous for the mutation (Figure 3B).Sequencing of the relevant STAT5b exon (exon 15) from 100 samplesof normal genomic DNA (Coriell) revealed neither polymorphismsnor heterozygosity at this site.
Figure 3. Domains of the Wild-Type STAT5b Protein (Panel A), Mutation in the STAT5b Gene from the Patient (Panel B), Differentiation of the Wild-Type Sequence from That of the Mutated Sequence in the src-Homology-2 (SH2) Domain (Panel C), and Stability and Activity of the Mutant STAT5b (Panel D).
In Panel A, TAD denotes transcription activation domain, A alanine, and pY the tyrosine at position 699 that is phosphorylated. Numbers indicate the amino acid positions. Panel B shows an electrophoretogram of the wild-type DNA sequence, the mutant sequence in the patient, and the sequences in her mother and father, both of whom were heterozygous for the mutation. Arrows indicate the relevant nucleotide that is changed in the patient's DNA. The predicted amino acid alteration is shown. As shown in Panel C, the substitution of proline for alanine at position 630 (A630P) introduces a novel StyI restriction site into the STAT5b gene. Polymerase-chain-reaction (PCR) primers were used to amplify the SH2 and transcription activation domains of STAT5b complementary DNA from lymphocytes from a control subject, the patient's mother and father, and the patient. StyI-restriction digests of the PCR products confirmed the patient's homozygosity and parental heterozygosity. In Panel D, mutant STAT5b, which is overexpressed in COS-7 cells, is not activated by interferon- (IFN-). Representative immunoblots are shown from four independent experiments. COS-7 cells were incubated alone (lanes 7 and 8) or transiently transfected with pcDNA3.1 (lanes 1 and 4), pcDNA3.1:STAT5b (A630P) (lanes 2 and 5), or pcDNA3.1:STAT5b (lanes 3 and 6). After 24 hours, cells were deprived of serum for 24 hours and then incubated alone or with interferon- (100 U per milliliter) or not treated for 60 minutes. Cell lysates were collected and immunoblotted to determine the phosphorylation (p) of STAT5 induced by interferon-, as well as the total STAT5b and STAT5a, as described in the legend to Figure 2B. The apparent lack of detectable STAT5a in lanes 3 and 6 is due to the inefficient stripping of antibody against STAT5b from the blot. Fresh blots probed with antibody against STAT5a confirmed that STAT5a was unaffected by the overexpression of wild-type or mutant STAT5b (data not shown).
The change in the DNA sequence introduced a StyI restrictionsite, which, as shown in Figure 3C, could be used to differentiatethe mutated SH2 sequence from that of the wild type. Both thepatient's mother and father carried the wild-type as well asthe mutant products (Figure 3C), corroborating the sequencingdata. Furthermore, immunoblotting of lymphoblast-cell extractsfrom both parents showed the presence of wild-type STAT5b inconcentrations equivalent to those of controls (data not shown).
Stability and Activity of Mutant STAT5b
To evaluate the stability and phosphorylation of the mutantSTAT5b (A630P) further, we used a COS-7–cell expressionsystem and interferon-, which can activate both STAT5a and STAT5b(data not shown). In COS-7 cells, treatment with interferon-results in the activation of endogenous STAT5 (Figure 3D, lanes7 and 8). Transient transfection with the vector pcDNA3.1 resultedin the same pattern of phosphorylation (Figure 3D, lanes 1 and4). When wild-type STAT5b was overexpressed, it was constitutivelyactivated but was still clearly responsive to interferon-–inducedactivation (Figure 3D, lanes 3 and 6). In contrast, overexpressionof mutant STAT5b (A630P) showed a pattern of STAT5 phosphorylationthat was similar to that of untransfected, or vector-transfected,cells (Figure 3D, lanes 2 and 5). This was not due to a lackof expression of mutant STAT5b, since the overexpressed proteinwas readily detected, albeit less well recognized by the antibodythan the wild-type protein (Figure 3D, lanes 2 and 5). Theseresults demonstrate that the mutant STAT5b can be stably expressedbut cannot be activated by either growth hormone (Figure 2B)or interferon- (Figure 3D).
Discussion
We describe a patient with a homozygous mutation in the genefor STAT5b, resulting in IGF-I deficiency and growth hormoneinsensitivity. The patient had abnormal postnatal growth, facialdysmorphism, and markedly reduced serum concentrations of IGF-I,IGFBP-3, and acid-labile subunit. Serum concentrations of thesethree proteins remained abnormally low, despite seven days oftreatment with growth hormone, and her growth rate failed toincrease in response to one year of growth hormone therapy.Her concentrations of growth hormone–binding protein werenormal, as measured by a ligand-mediated binding assay in serumand by immunoblotting of fibroblast lysates, reflecting thefact that her GHR gene and protein were normal. Although therewas no family history of growth retardation, the parents werefirst cousins, a relationship consistent with the occurrenceof classic autosomal recessive transmission.
Most reported cases of growth hormone insensitivity involvemutations or deletions of the GHR gene.2,3,4,5,8,9,10,11,12Several cases of putative defects downstream of the GHR genehave now been reported in patients with phenotypes of growthhormone insensitivity.13,14,15,16 In two of these studies,15,16growth hormone failed to induce tyrosine phosphorylation ofthe STAT proteins, although no specific molecular abnormalitieswere identified. Indeed, the STAT5b gene from each of the 14children with idiopathic short stature described by Salernoet al.16 was sequenced and found to be normal.21 Rodent modelsof STAT knockouts, on the other hand, have indicated that ofthe STAT proteins, STAT5b is essential for growth hormone–inducedactivation of IGF-I and for normal postnatal growth.19,20 Interestingly,female mice with STAT5b knockouts were largely unaffected, whereasmales, which are usually approximately 30 percent larger thanfemale mice, resembled females in size. This loss of sexuallydimorphic growth patterns in mice contrasts with the dramaticgrowth failure observed in our patient. Furthermore, STAT5aand STAT5b do not appear to be fully redundant in humans, sincenormal concentrations of STAT5a did not prevent the insensitivityto growth hormone in our patient.
The missense mutation in our patient is in exon 15 of the STAT5bgene, which encodes half of the SH2 domain. No polymorphismor heterozygosity was detected in this exon in control subjects.The SH2 domain of the STAT genes is highly conserved and isnecessary for the docking of these latent proteins to ligand-activatedphosphorylated receptors22,23 and for their subsequent dimerization.24The amino acid affected, alanine at position 630, is deep withinthe SH2 domain, in a -sheet, C, that is part of an antiparallel-sheet structure essential for the binding of phosphate groups.25Prolines are incompatible with a functional -sheet structure.A change from alanine to proline is therefore predicted to bedisruptive, affecting the functionality of the SH2 domain, distortingthe epitopes recognized by antibodies, and changing the overallstability of the protein. When the mutant STAT5b was overexpressed,it was detectable in COS-7 cells, suggesting that its expressioncan be stable. Epitope recognition and functionality, however,were clearly affected by the mutation, since the mutant proteinwas poorly recognized by commercially available antibodies againstSTAT5b. Most important, despite being stably expressed, themutant protein could not be activated by either growth hormoneor interferon-.
One consequence of the mutant STAT5b is the failure to activategenes transcriptionally, as demonstrated by the dysregulationof IGF-I and IGFBP-3 both in vitro and in vivo. Aberrant regulationof other proteins is also to be expected, including the negativeregulators of STAT signaling, which could potentially accountfor the enhanced phosphorylation of STAT1 and STAT3 that weobserved. The increase in total STAT1 concentrations in ourpatient is consistent with that observed in the STAT5b–/–rodent model.19
In addition to mediating the actions of growth hormone, STAT5bis also important for the actions of many other growth factorsand cytokines (interleukins26 and interferons20). The signaltransduction of prolactin was abnormal in our patient's fibroblasts,and in the COS-7–cell model, interferon- activated wild-typeSTAT5b but failed to activate the mutant STAT5b. STAT5b hasan important role in the proliferation and differentiation ofT cells,26,27,28,29 and a nonfunctional STAT5b is likely todecrease cell-mediated immunity, as has been demonstrated inSTAT5b–/– mice18,19,20,28 and as suggested by theresults in our patient's cells when they were exposed to interferon-.Hence, we hypothesize that the immunologic problems in our patientare probably a direct manifestation of the mutated STAT5b. Furtherstudies of immunodeficiencies in this and similar patients areclearly warranted.
In summary, the STAT5b mutation represents a clearly definedpostreceptor molecular abnormality in the human growth hormonesignaling cascade. It is likely that other defects in the JAK-STATsystem will be identified in patients with various degrees ofIGF deficiency and growth hormone insensitivity. The combinedphenotype of growth hormone insensitivity and immunodeficiencyis consistent with the presence of such signaling defects.
Supported by grants (CA58110 and DMD17-00-1-0042, to Dr. Rosenfeld)from the National Institutes of Health, and by a grant fromPharmacia.
We are indebted to Dr. Ellen Magenis (Department of Genetics,Oregon Health and Science University) for performing a skinbiopsy to obtain the fibroblast cultures used in this study.
Source Information
From the Department of Pediatrics, Oregon Health and Science University, Portland (E.M.K., V.H., B.L., K.A.W., C.K.B., J.T., K.L.P., R.G.R.); the Departments of Endocrinology (L.B., H.J., J.J.H.) and Pulmonology (A.T.), Hospital General de Niños Ricardo Gutiérrez de Buenos Aires, Buenos Aires, Argentina; and the Lucile Packard Foundation for Children's Health, Palo Alto, Calif. (R.G.R.). Mr. Kofoed and Dr. Hwa contributed equally to the article.
Address reprint requests to Dr. Rosenfeld at the Lucile Packard Foundation for Children's Health, 770 Welch Rd., Suite 350, Palo Alto, CA 94304, or at ron.rosenfeld{at}lpfch.org.
References
Savage MO, Rosenfeld RG. Growth hormone insensitivity: a proposed revised classification. Acta Paediatr Suppl 1999;428:147-147.
Laron Z, Pertzelan A, Mannheimer S. Genetic pituitary dwarfism with high serum concentration of growth hormone -- a new inborn error of metabolism? Isr J Med Sci 1966;2:152-155. [Web of Science][Medline]
Rosenfeld RG, Rosenbloom AL, Guevara-Aguirre J. Growth hormone (GH) insensitivity due to primary GH receptor deficiency. Endocr Rev 1994;15:369-390. [Free Full Text]
Woods KA, Dastot F, Preece MA, et al. Phenotype: genotype relationships in growth hormone insensitivity syndrome. J Clin Endocrinol Metab 1997;82:3529-3535. [Free Full Text]
Wojcik J, Berg MA, Esposito N, et al. Four contiguous amino acid substitutions, identified in patients with Laron syndrome, differently affect the binding affinity and intracellular trafficking of the growth hormone receptor. J Clin Endocrinol Metab 1998;83:4481-4489. [Free Full Text]
Burren CP, Woods KA, Rose SJ, et al. Clinical and endocrine characteristics in atypical and classical growth hormone insensitivity syndrome. Horm Res 2001;55:125-130. [CrossRef][Web of Science][Medline]
Amit T, Youdim MB, Hochberg Z. Does serum growth hormone (GH) binding protein reflect human GH receptor function? J Clin Endocrinol Metab 2000;85:927-932. [Free Full Text]
Duquesnoy P, Sobrier ML, Duriez B, et al. A single amino acid substitution in the exoplasmic domain of the human growth hormone (GH) receptor confers familial GH resistance (Laron syndrome) with positive GH-binding activity by abolishing receptor homodimerization. EMBO J 1994;13:1386-1395. [Web of Science][Medline]
Sobrier ML, Dastot F, Duquesnoy P, et al. Nine novel growth hormone receptor gene mutations in patients with Laron syndrome. J Clin Endocrinol Metab 1997;82:435-437. [Free Full Text]
Woods KA, Fraser NC, Postel-Vinay MC, Savage MO, Clark AJ. A homozygous splice site mutation affecting the intracellular domain of the growth hormone (GH) receptor resulting in Laron syndrome with elevated GH-binding protein. J Clin Endocrinol Metab 1996;81:1686-1690. [Abstract]
Iida K, Takahashi Y, Kaji H, et al. Functional characterization of truncated growth hormone (GH) receptor-(1-277) causing partial GH insensitivity syndrome with high GH-binding protein. J Clin Endocrinol Metab 1999;84:1011-1016. [Free Full Text]
Ayling RM, Ross R, Towner P, et al. A dominant-negative mutation of the growth hormone receptor causes familial short stature. Nat Genet 1997;16:13-14. [CrossRef][Web of Science][Medline]
Freeth JS, Silva CM, Whatmore AJ, Clayton PE. Activation of the signal transducers and activators of transcription signaling pathway by growth hormone (GH) in skin fibroblasts from normal and GH binding protein-positive Laron Syndrome children. Endocrinology 1998;139:20-28. [Free Full Text]
Laron Z, Klinger B, Eshet R, Kaneti H, Karasik A, Silbergeld A. Laron syndrome due to a post-receptor defect: response to IGF-I treatment. Isr J Med Sci 1993;29:757-763. [Web of Science][Medline]
Silva CM, Kloth MT, Whatmore AJ, et al. GH and epidermal growth factor signaling in normal and Laron syndrome fibroblasts. Endocrinology 2002;143:2610-2617. [Free Full Text]
Salerno M, Balestrieri B, Matrecano E, et al. Abnormal GH receptor signaling in children with idiopathic short stature. J Clin Endocrinol Metab 2001;86:3882-3888. [Free Full Text]
Buckway CK, Guevara-Aguirre J, Pratt KL, Burren CP, Rosenfeld RG. The IGF-I generation test revisited: a marker of GH sensitivity. J Clin Endocrinol Metab 2001;86:5176-5183. [Free Full Text]
Liu X, Robinson GW, Wagner KU, Garrett L, Wynshaw-Boris A, Hennighausen L. Stat5a is mandatory for adult mammary gland development and lactogenesis. Genes Dev 1997;11:179-186. [Free Full Text]
Udy GB, Towers RP, Snell RG, et al. Requirement of STAT5b for sexual dimorphism of body growth rates and liver gene expression. Proc Natl Acad Sci U S A 1997;94:7239-7244. [Free Full Text]
Teglund S, McKay C, Schuetz E, et al. Stat5a and Stat5b proteins have essential and nonessential, or redundant, roles in cytokine responses. Cell 1998;93:841-850. [CrossRef][Web of Science][Medline]
Ambrosio R, Fimiani G, Monfregola J, et al. The structure of human STAT5A and B genes reveals two regions of nearly identical sequence and an alternative tissue specific STAT5B promoter. Gene 2002;285:311-318. [CrossRef][Web of Science][Medline]
Li X, Leung S, Kerr IM, Stark GR. Functional subdomains of STAT2 required for preassociation with the alpha interferon receptor and for signaling. Mol Cell Biol 1997;17:2048-2056. [Abstract]
Krishnan K, Singh B, Krolewski JJ. Identification of amino acid residues critical for the Src-homology 2 domain-dependent docking of Stat2 to the interferon alpha receptor. J Biol Chem 1998;273:19495-19501. [Free Full Text]
Shuai K, Horvath CM, Huang LH, Qureshi SA, Cowburn D, Darnell JE Jr. Interferon activation of the transcription factor Stat91 involves dimerization through SH2-phosphotyrosyl peptide interactions. Cell 1994;76:821-828. [CrossRef][Web of Science][Medline]
Chen X, Vinkemeier U, Zhao Y, Jeruzalmi D, Darnell JE Jr, Kuriyan J. Crystal structure of a tyrosine phosphorylated STAT-1 dimer bound to DNA. Cell 1998;93:827-839. [CrossRef][Web of Science][Medline]
Moriggl R, Sexl V, Piekorz R, Topham D, Ihle JN. Stat5 activation is uniquely associated with cytokine signaling in peripheral T cells. Immunity 1999;11:225-230. [CrossRef][Web of Science][Medline]
Welte T, Leitenberg D, Dittel BN, et al. STAT5 interaction with the T cell receptor complex and stimulation of T cell proliferation. Science 1999;283:222-225. [Free Full Text]
Imada K, Bloom ET, Nakajima H, et al. Stat5b is essential for natural killer cell-mediated proliferation and cytolytic activity. J Exp Med 1998;188:2067-2074. [Free Full Text]
Moriggl R, Topham DJ, Teglund S, et al. Stat5 is required for IL-2-induced cell cycle progression of peripheral T cells. Immunity 1999;10:249-259. [CrossRef][Web of Science][Medline]
Ohlsson, C., Mohan, S., Sjogren, K., Tivesten, A., Isgaard, J., Isaksson, O., Jansson, J.-O., Svensson, J.
(2009). The Role of Liver-Derived Insulin-Like Growth Factor-I. Endocr. Rev.
30: 494-535
[Abstract][Full Text]
Gevers, E. F., Hannah, M. J., Waters, M. J., Robinson, I. C. A. F.
(2009). Regulation of Rapid Signal Transducer and Activator of Transcription-5 Phosphorylation in the Resting Cells of the Growth Plate and in the Liver by Growth Hormone and Feeding. Endocrinology
150: 3627-3636
[Abstract][Full Text]
Fang, P., Schwartz, I. D., Johnson, B. D., Derr, M. A., Roberts, C. T. Jr., Hwa, V., Rosenfeld, R. G.
(2009). Familial Short Stature Caused by Haploinsufficiency of the Insulin-Like Growth Factor I Receptor due to Nonsense-Mediated Messenger Ribonucleic Acid Decay. J. Clin. Endocrinol. Metab.
94: 1740-1747
[Abstract][Full Text]
Hosui, A., Kimura, A., Yamaji, D., Zhu, B.-m., Na, R., Hennighausen, L.
(2009). Loss of STAT5 causes liver fibrosis and cancer development through increased TGF-{beta} and STAT3 activation. JEM
206: 819-831
[Abstract][Full Text]
Murphy, R., Baptista, J., Holly, J., Umpleby, A. M., Ellard, S., Harries, L. W., Crolla, J., Cundy, T., Hattersley, A. T.
(2008). Severe Intrauterine Growth Retardation and Atypical Diabetes Associated with a Translocation Breakpoint Disrupting Regulation of the Insulin-Like Growth Factor 2 Gene. J. Clin. Endocrinol. Metab.
93: 4373-4380
[Abstract][Full Text]
Jin, H., Lanning, N. J., Carter-Su, C.
(2008). JAK2, But Not Src Family Kinases, Is Required for STAT, ERK, and Akt Signaling in Response to Growth Hormone in Preadipocytes and Hepatoma Cells. Mol. Endocrinol.
22: 1825-1841
[Abstract][Full Text]
Hosui, A., Hennighausen, L.
(2008). Genomic dissection of the cytokine-controlled STAT5 signaling network in liver. Physiol. Genomics
34: 135-143
[Abstract][Full Text]
Eleswarapu, S., Gu, Z., Jiang, H.
(2008). Growth Hormone Regulation of Insulin-Like Growth Factor-I Gene Expression May Be Mediated by Multiple Distal Signal Transducer and Activator of Transcription 5 Binding Sites. Endocrinology
149: 2230-2240
[Abstract][Full Text]
Hennighausen, L., Robinson, G. W.
(2008). Interpretation of cytokine signaling through the transcription factors STAT5A and STAT5B. Genes Dev.
22: 711-721
[Abstract][Full Text]
Uyttendaele, I., Lemmens, I., Verhee, A., De Smet, A.-S., Vandekerckhove, J., Lavens, D., Peelman, F., Tavernier, J.
(2007). Mammalian Protein-Protein Interaction Trap (MAPPIT) Analysis of STAT5, CIS, and SOCS2 Interactions with the Growth Hormone Receptor. Mol. Endocrinol.
21: 2821-2831
[Abstract][Full Text]
Walenkamp, M J E, Wit, J M
(2007). Genetic disorders in the GH IGF-I axis in mouse and man. Eur J Endocrinol
157: S15-S26
[Abstract][Full Text]
Rosenfeld, R. G
(2007). Pharmacogenomics and pharmacoproteomics in the evaluation and management of short stature. Eur J Endocrinol
157: S27-S31
[Abstract][Full Text]
Savage, M. O, Camacho-Hubner, C., David, A., Metherell, L. A, Hwa, V., Rosenfeld, R. G, Clark, A. J L
(2007). Idiopathic short stature: will genetics influence the choice between GH and IGF-I therapy?. Eur J Endocrinol
157: S33-S37
[Abstract][Full Text]
Fang, P., Riedl, S., Amselem, S., Pratt, K. L., Little, B. M., Haeusler, G., Hwa, V., Frisch, H., Rosenfeld, R. G.
(2007). Primary Growth Hormone (GH) Insensitivity and Insulin-Like Growth Factor Deficiency Caused by Novel Compound Heterozygous Mutations of the GH Receptor Gene: Genetic and Functional Studies of Simple and Compound Heterozygous States. J. Clin. Endocrinol. Metab.
92: 2223-2231
[Abstract][Full Text]
Ono, M., Chia, D. J., Merino-Martinez, R., Flores-Morales, A., Unterman, T. G., Rotwein, P.
(2007). Signal Transducer and Activator of Transcription (Stat) 5b-Mediated Inhibition of Insulin-Like Growth Factor Binding Protein-1 Gene Transcription: A Mechanism for Repression of Gene Expression by Growth Hormone. Mol. Endocrinol.
21: 1443-1457
[Abstract][Full Text]
Carneiro-Sampaio, M., Coutinho, A.
(2007). Immunity to Microbes: Lessons from Primary Immunodeficiencies. Infect. Immun.
75: 1545-1555
[Full Text]
Walenkamp, M. J E, Vidarsdottir, S., Pereira, A. M, Karperien, M., van Doorn, J., van Duyvenvoorde, H. A, Breuning, M. H, Roelfsema, F., Kruithof, M F., van Dissel, J., Janssen, R., Wit, J. M, Romijn, J. A
(2007). Growth hormone secretion and immunological function of a male patient with a homozygous STAT5b mutation. Eur J Endocrinol
156: 155-165
[Abstract][Full Text]
Vidal, O. M., Merino, R., Rico-Bautista, E., Fernandez-Perez, L., Chia, D. J., Woelfle, J., Ono, M., Lenhard, B., Norstedt, G., Rotwein, P., Flores-Morales, A.
(2007). In Vivo Transcript Profiling and Phylogenetic Analysis Identifies Suppressor of Cytokine Signaling 2 as a Direct Signal Transducer and Activator of Transcription 5b Target in Liver. Mol. Endocrinol.
21: 293-311
[Abstract][Full Text]
Adriani, M., Garbi, C., Amodio, G., Russo, I., Giovannini, M., Amorosi, S., Matrecano, E., Cosentini, E., Candotti, F., Pignata, C.
(2006). Functional Interaction of Common {gamma}-Chain and Growth Hormone Receptor Signaling Apparatus. J. Immunol.
177: 6889-6895
[Abstract][Full Text]
Frank, S. J., Wang, X., He, K., Yang, N., Fang, P., Rosenfeld, R. G., Hwa, V., Chaudhuri, T. R., Deng, L., Zinn, K. R.
(2006). In Vivo Imaging of Hepatic Growth Hormone Signaling. Mol. Endocrinol.
20: 2819-2830
[Abstract][Full Text]
Rosenbloom, A. L., Guevara-Aguirre, J.
(2006). Reclassification of Insulin-Like Growth Factor I Production and Action Disorders. J. Clin. Endocrinol. Metab.
91: 4232-4234
[Abstract][Full Text]
Cohen, P.
(2006). Problems with Reclassification of Insulin-Like Growth Factor I Production and Action Disorders. J. Clin. Endocrinol. Metab.
91: 4235-4236
[Abstract][Full Text]
Pfaffle, R.
(2006). Genetics of growth in the normal child. Eur J Endocrinol
155: S27-S33
[Abstract][Full Text]
Bernasconi, A., Marino, R., Ribas, A., Rossi, J., Ciaccio, M., Oleastro, M., Ornani, A., Paz, R., Rivarola, M. A., Zelazko, M., Belgorosky, A.
(2006). Characterization of Immunodeficiency in a Patient With Growth Hormone Insensitivity Secondary to a Novel STAT5b Gene Mutation. Pediatrics
118: e1584-e1592
[Abstract][Full Text]
Vidarsdottir, S., Walenkamp, M. J. E., Pereira, A. M., Karperien, M., van Doorn, J., van Duyvenvoorde, H. A., White, S., Breuning, M. H., Roelfsema, F., Kruithof, M. F., van Dissel, J., Janssen, R., Wit, J. M., Romijn, J. A.
(2006). Clinical and Biochemical Characteristics of a Male Patient with a Novel Homozygous STAT5b Mutation. J. Clin. Endocrinol. Metab.
91: 3482-3485
[Abstract][Full Text]
Cohen, A. C., Nadeau, K. C., Tu, W., Hwa, V., Dionis, K., Bezrodnik, L., Teper, A., Gaillard, M., Heinrich, J., Krensky, A. M., Rosenfeld, R. G., Lewis, D. B.
(2006). Cutting Edge: Decreased Accumulation and Regulatory Function of CD4+CD25high T Cells in Human STAT5b Deficiency.. J. Immunol.
177: 2770-2774
[Abstract][Full Text]
Hoogendam, J., Parlevliet, E., Miclea, R., Lowik, C. W. G. M., Wit, J. M., Karperien, M.
(2006). Novel Early Target Genes of Parathyroid Hormone-Related Peptide in Chondrocytes. Endocrinology
147: 3141-3152
[Abstract][Full Text]
Hwa, V., Haeusler, G., Pratt, K. L., Little, B. M., Frisch, H., Koller, D., Rosenfeld, R. G.
(2006). Total Absence of Functional Acid Labile Subunit, Resulting in Severe Insulin-Like Growth Factor Deficiency and Moderate Growth Failure. J. Clin. Endocrinol. Metab.
91: 1826-1831
[Abstract][Full Text]
DiVall, S. A., Radovick, S.
(2006). Deciphering the genetics of stature--another piece of the puzzle.. J. Clin. Endocrinol. Metab.
91: 1218-1219
[Full Text]
Veldhuis, J. D., Roemmich, J. N., Richmond, E. J., Bowers, C. Y.
(2006). Somatotropic and Gonadotropic Axes Linkages in Infancy, Childhood, and the Puberty-Adult Transition. Endocr. Rev.
27: 101-140
[Abstract][Full Text]
Fang, P., Kofoed, E. M., Little, B. M., Wang, X., Ross, R. J. M., Frank, S. J., Hwa, V., Rosenfeld, R. G.
(2006). A Mutant Signal Transducer and Activator of Transcription 5b, Associated with Growth Hormone Insensitivity and Insulin-Like Growth Factor-I Deficiency, Cannot Function as a Signal Transducer or Transcription Factor. J. Clin. Endocrinol. Metab.
91: 1526-1534
[Abstract][Full Text]
Chia, D. J., Subbian, E., Buck, T. M., Hwa, V., Rosenfeld, R. G., Skach, W. R., Shinde, U., Rotwein, P.
(2006). Aberrant Folding of a Mutant Stat5b Causes Growth Hormone Insensitivity and Proteasomal Dysfunction. J. Biol. Chem.
281: 6552-6558
[Abstract][Full Text]
Rosenfeld, R. G.
(2006). The Pharmacogenomics of Human Growth.. J. Clin. Endocrinol. Metab.
91: 795-796
[Full Text]
Chia, D. J., Ono, M., Woelfle, J., Schlesinger-Massart, M., Jiang, H., Rotwein, P.
(2006). Characterization of Distinct Stat5b Binding Sites That Mediate Growth Hormone-stimulated IGF-I Gene Transcription. J. Biol. Chem.
281: 3190-3197
[Abstract][Full Text]
Waters, M J, Hoang, H N, Fairlie, D P, Pelekanos, R A, Brown, R J
(2006). New insights into growth hormone action. J Mol Endocrinol
36: 1-7
[Abstract][Full Text]
Flores-Morales, A., Greenhalgh, C. J., Norstedt, G., Rico-Bautista, E.
(2006). Negative Regulation of Growth Hormone Receptor Signaling. Mol. Endocrinol.
20: 241-253
[Abstract][Full Text]
Shi, M., Cooper, J. C., Yu, C.-L.
(2006). A Constitutively Active Lck Kinase Promotes Cell Proliferation and Resistance to Apoptosis through Signal Transducer and Activator of Transcription 5b Activation. Mol Cancer Res
4: 39-45
[Abstract][Full Text]
Iida, K, Rosen, C J, Ackert-Bicknell, C, Thorner, M O
(2005). Genetic differences in the IGF-I gene among inbred strains of mice with different serum IGF-I levels. J Endocrinol
186: 481-489
[Abstract][Full Text]
Hwa, V., Little, B., Adiyaman, P., Kofoed, E. M., Pratt, K. L., Ocal, G., Berberoglu, M., Rosenfeld, R. G.
(2005). Severe Growth Hormone Insensitivity Resulting from Total Absence of Signal Transducer and Activator of Transcription 5b. J. Clin. Endocrinol. Metab.
90: 4260-4266
[Abstract][Full Text]
Walenkamp, M. J. E., Karperien, M., Pereira, A. M., Hilhorst-Hofstee, Y., van Doorn, J., Chen, J. W., Mohan, S., Denley, A., Forbes, B., van Duyvenvoorde, H. A., van Thiel, S. W., Sluimers, C. A., Bax, J. J., de Laat, J. A. P. M., Breuning, M. B, Romijn, J. A., Wit, J. M.
(2005). Homozygous and Heterozygous Expression of a Novel Insulin-Like Growth Factor-I Mutation. J. Clin. Endocrinol. Metab.
90: 2855-2864
[Abstract][Full Text]
Held, M. A., Cosme-Blanco, W., Difedele, L. M., Bonkowski, E. L., Menon, R. K., Denson, L. A.
(2005). Alterations in growth hormone receptor abundance regulate growth hormone signaling in murine obstructive cholestasis. Am. J. Physiol. Gastrointest. Liver Physiol.
288: G986-G993
[Abstract][Full Text]
Wang, Y., Jiang, H.
(2005). Identification of a Distal STAT5-binding DNA Region That May Mediate Growth Hormone Regulation of Insulin-like Growth Factor-I Gene Expression. J. Biol. Chem.
280: 10955-10963
[Abstract][Full Text]
Rowland, J. E., Lichanska, A. M., Kerr, L. M., White, M., d'Aniello, E. M., Maher, S. L., Brown, R., Teasdale, R. D., Noakes, P. G., Waters, M. J.
(2005). In Vivo Analysis of Growth Hormone Receptor Signaling Domains and Their Associated Transcripts. Mol. Cell. Biol.
25: 66-77
[Abstract][Full Text]
Mullis, P. E
(2005). Genetic control of growth. Eur J Endocrinol
152: 11-31
[Abstract][Full Text]
Tiulpakov, A., Rubtsov, P., Dedov, I., Peterkova, V., Bezlepkina, O., Chrousos, G. P., Hochberg, Z.
(2005). A Novel C-Terminal Growth Hormone Receptor (GHR) Mutation Results in Impaired GHR-STAT5 But Normal STAT-3 Signaling. J. Clin. Endocrinol. Metab.
90: 542-547
[Abstract][Full Text]
Sun, D. F., Zheng, Z., Tummala, P., Oh, J., Schaefer, F., Rabkin, R.
(2004). Chronic Uremia Attenuates Growth Hormone-Induced Signal Transduction in Skeletal Muscle. J. Am. Soc. Nephrol.
15: 2630-2636
[Abstract][Full Text]
Schaefer, F., Yoon, S.-A., Nouri, P., Tsao, T., Tummala, P., Deng, E., Rabkin, R.
(2004). Growth Hormone-Mediated Janus Associated Kinase-Signal Transducers and Activators of Transcription Signaling in the Growth Hormone-Resistant Potassium-Deficient Rat. J. Am. Soc. Nephrol.
15: 2299-2306
[Abstract][Full Text]
Laron, Z.
(2004). Laron Syndrome (Primary Growth Hormone Resistance or Insensitivity): The Personal Experience 1958-2003. J. Clin. Endocrinol. Metab.
89: 1031-1044
[Abstract][Full Text]
Rosenfeld, R. G., Hwa, V.
(2004). Toward a Molecular Basis for Idiopathic Short Stature. J. Clin. Endocrinol. Metab.
89: 1066-1067
[Full Text]
Lewis, M. D., Horan, M., Millar, D. S., Newsway, V., Easter, T. E., Fryklund, L., Gregory, J. W., Norin, M., Del Valle, C.-J., Lopez-Siguero, J. P., Canete, R., Lopez-Canti, L. F., Diaz-Torrado, N., Espino, R., Ulied, A., Scanlon, M. F., Procter, A. M., Cooper, D. N.
(2004). A Novel Dysfunctional Growth Hormone Variant (Ile179Met) Exhibits a Decreased Ability to Activate the Extracellular Signal-Regulated Kinase Pathway. J. Clin. Endocrinol. Metab.
89: 1068-1075
[Abstract][Full Text]
Milward, A., Metherell, L., Maamra, M., Barahona, M. J., Wilkinson, I. R., Camacho-Hubner, C., Savage, M. O., Bidlingmaier, C. M., Clark, A. J. L., Ross, R. J. M., Webb, S. M.
(2004). Growth Hormone (GH) Insensitivity Syndrome due to a GH Receptor Truncated after Box1, Resulting in Isolated Failure of STAT 5 Signal Transduction. J. Clin. Endocrinol. Metab.
89: 1259-1266
[Abstract][Full Text]
Tronche, F., Opherk, C., Moriggl, R., Kellendonk, C., Reimann, A., Schwake, L., Reichardt, H. M., Stangl, K., Gau, D., Hoeflich, A., Beug, H., Schmid, W., Schutz, G.
(2004). Glucocorticoid receptor function in hepatocytes is essential to promote postnatal body growth. Genes Dev.
18: 492-497
[Abstract][Full Text]
Hwa, V., Little, B., Kofoed, E. M., Rosenfeld, R. G.
(2004). Transcriptional Regulation of Insulin-like Growth Factor-I by Interferon-{gamma} Requires STAT-5b. J. Biol. Chem.
279: 2728-2736
[Abstract][Full Text]
, a potent STAT1 activator whose actions are mediated by class II cytokine receptors, the activation of STAT1 and STAT3 was robust, and more important, it was the same as that in the normal cells (Figure 2A). 
-sheet, 
Previous
