Somatic and Germ-Line Mutations of the HRPT2 Gene in Sporadic Parathyroid Carcinoma
Trisha M. Shattuck, B.S., Stiina Välimäki, M.D., Takao Obara, M.D., Randall D. Gaz, M.D., Orlo H. Clark, M.D., Dolores Shoback, M.D., Margaret E. Wierman, M.D., Katsuyoshi Tojo, M.D., Christiane M. Robbins, M.S., John D. Carpten, Ph.D., Lars-Ove Farnebo, M.D., Ph.D., Catharina Larsson, M.D., Ph.D., and Andrew Arnold, M.D.
Background We looked for mutations of the HRPT2 gene, whichencodes the parafibromin protein, in sporadic parathyroid carcinomabecause germ-line inactivating HRPT2 mutations have been foundin a type of familial hyperparathyroidism hyperparathyroidismjawtumor (HPT-JT) syndrome that carries an increased riskof parathyroid cancer.
Methods We directly sequenced the full coding and flanking splice-junctionalregions of the HRPT2 gene in 21 parathyroid carcinomas from15 patients who had no known family history of primary hyperparathyroidismor the HPT-JT syndrome at presentation. We also sought to confirmthe somatic nature of the identified mutations and tested thecarcinomas for tumor-specific loss of heterozygosity at HRPT2.
Results Parathyroid carcinomas from 10 of the 15 patients hadHRPT2 mutations, all of which were predicted to inactivate theencoded parafibromin protein. Two distinct HRPT2 mutations werefound in tumors from five patients, and biallelic inactivationas a result of a mutation and loss of heterozygosity was foundin one tumor. At least one HRPT2 mutation was demonstrably somaticin carcinomas from six patients. Unexpectedly, HRPT2 mutationsin the parathyroid carcinomas of three patients were identifiedas germ-line mutations.
Conclusions Sporadic parathyroid carcinomas frequently haveHRPT2 mutations that are likely to be of pathogenetic importance.Certain patients with apparently sporadic parathyroid carcinomacarry germ-line mutations in HRPT2 and may have the HPT-JT syndromeor a phenotypic variant.
Parathyroid carcinomas are an uncommon and often devastatingcause of primary hyperparathyroidism.1,2 These cancers characteristicallyresult in more profound clinical manifestations of hyperparathyroidismthan do parathyroid adenomas, the most frequent cause of primaryhyperparathyroidism. If a parathyroid carcinoma spreads to distantsites, it can cause relentless hypercalcemia and severe metaboliccomplications that are notoriously difficult to control andoften result in death. Affected patients may require repeatedpalliative surgical extirpation of metastatic nodules.1,2,3Early en bloc resection of the primary tumor is the only curativetreatment. Because the histopathological features of parathyroidcarcinoma and adenoma may overlap, a definitive diagnosis ofparathyroid carcinoma requires the presence of invasion of surroundingstructures by the tumor, local recurrence, or metastasis,3,4,5,6,7,8,9yet these features signify a stage at which cure is usuallyimpossible. An understanding of the molecular pathogenesis ofparathyroid carcinoma could have considerable value with respectto early diagnosis, prognosis, and new approaches to treatment.
No specific gene has been established as a direct contributorto the pathogenesis of sporadic parathyroid carcinoma, althoughseveral important molecular clues have been uncovered.10,11,12,13,14,15For example, a region on chromosome 13 is frequently lost inparathyroid carcinomas.10,11,12,13,14 However, molecular analysis16has not yet established the identity of the relevant gene orgenes in this region of the chromosome.17,18
We investigated the HRPT2 gene, which encodes the parafibrominprotein, in sporadic parathyroid carcinoma because inactivatinggerm-line mutations in this gene were recently identified inthe majority of kindreds with the hereditary hyperparathyroidismjawtumor (HPT-JT) syndrome, or hyperparathyroidism 2 (Online MendelianInheritance in Man number #145001), a rare autosomal dominantcause of parathyroid tumors, ossifying fibromas of the mandibleand maxilla, and various cystic and neoplastic renal abnormalities.19,20,21,22,23,24,25,26Also, somatic inactivating mutations of the gene were reportedin 4 percent of cystic parathyroid adenomas (2 of 47), noneof which had germ-line mutations.19 Parathyroid tumors oftenoccur asynchronously in patients with the HPT-JT syndrome, andalthough most of the tumors are benign, the incidence of malignantparathyroid carcinomas is markedly increased in these patients.For these reasons, it seemed plausible that inactivating somaticmutations of HRPT2 might occur in sporadic parathyroid carcinomas.
Methods
Patients and Tumor Specimens
A total of 21 parathyroid-carcinoma samples were obtained from15 patients who had been treated surgically for primary hyperparathyroidismin the United States and Japan. The 21 specimens included 5primary carcinomas, 6 locally recurrent tumors, and 10 distantmetastases (Table 1). For inclusion in this study, we requiredan unequivocal diagnosis of parathyroid carcinoma, as demonstratedby the presence of either distant metastasis or widespread invasionof contiguous structures and local recurrence.3,4,5,6,7,8,9Histopathological features often associated with parathyroidcarcinoma (but not stringently diagnostic), such as fibrousbands, numerous cells in mitosis, trabecular cellular architecture,nuclear atypia, and microvascular or microscopic capsular invasion,were commonly present. For 10 of the 15 patients, peripheral-bloodleukocytes served as a source of germ-line DNA; for Patient6, normal muscle was the source. Germ-line DNA was not availablefrom four patients.
Table 1.HRPT2 Gene Mutation and Loss-of-Heterozygosity Analyses in Parathyroid Carcinomas from 15 Patients.
At initial parathyroidectomy, the 15 patients ranged in agefrom 20 to 62 years (mean, 43); 5 were women and 10 were men.None of the 15 patients had a personal or family history ofthe HPT-JT syndrome, multiple endocrine neoplasia type 1, oranother familial form of hyperparathyroidism at presentation.After the diagnosis of parathyroid carcinoma in Patient 5, aparathyroid adenoma was diagnosed in an uncle. No patient hada history of irradiation to the head and neck or of uremic secondaryor tertiary hyperparathyroidism, and no patient had been treatedwith radiation therapy or chemotherapy.
Immediately after surgical resection, tumor samples were frozenin liquid nitrogen for storage at 80°C until use.Genomic DNA was extracted from tumor and nontumor tissues byproteinase K digestion followed by phenolchloroform extractionand ethanol precipitation. Tumor and blood samples were obtainedin accordance with protocols approved by institutional reviewboards for human studies; patients provided informed consentas dictated by these protocols.
Detection of HRPT2 Mutations
The 21 samples of parathyroid-carcinoma DNA were analyzed formutations in the HRPT2 gene by direct sequencing of both strands.The 17 exons of the gene, which encode a protein of 531 aminoacids, were amplified as 15 different fragments with the useof primers derived from flanking intronic or 3'- or 5'-untranslated-regionsequences (listed in Supplementary Appendix 1, available withthe full text of this article at http://www.nejm.org). Afteramplification, primers were removed by digestion with 10 U ofexonuclease I (Amersham Pharmacia Biotech) and 1 U of shrimpalkaline phosphatase (Amersham).
Sequencing reactions were performed with the use of the BigDyeTerminator cycle sequencing kit (Applied Biosystems) as describedpreviously.27 Data were analyzed with the use of SequencingAnalysis and AutoAssembler software (Applied Biosystems), andall mutations were confirmed by repeated forward and reversesequencing of the involved exon or intron from an independentpolymerase chain reaction (PCR). When mutations were detectedin tumor DNA, the same exons or introns in corresponding germ-lineDNA samples, when available, were sequenced in a similar manner.Amplified exons for which sequencing in both directions showeda clear chromatogram and an apparently normal sequence on oneside of a specific nucleotide position abruptly followed byan unclear sequence on the other were interpreted as suggestinga frame-shift mutation. To determine definitively whether aninsertion or a deletion was present in these cases, or to confirmthe loss of a specific allele in one instance, amplified exonswere resequenced after cloning to separate the alleles. PCRproducts were cloned into the PCR4-TOPO vector with use of theTOPO TA Cloning Kit (Invitrogen), transformed into Escherichiacoli, and plated onto LB agar to which 50 µg of ampicillinper milliliter had been added. Then, 8 to 10 distinct colonieswere picked and resuspended in PCR mix for amplification andsequencing.
Sequencing of all HRPT2 exons (1, 2, 3, 4, 5, 7, and 14) forwhich germ-line mutations were identified in this study (orin kindreds with the HPT-JT syndrome19) was performed as describedpreviously19 in 150 unrelated healthy control subjects.
Loss-of-Heterozygosity Analysis
We analyzed 17 matched pairs of germ-line and tumor DNA samplesfrom 11 patients for loss of heterozygosity at the HRPT2 locusby genotyping four microsatellite markers. D1S542 and D1S413flank HRPT2 on its centromeric and telomeric sides, respectively(University of California Santa Cruz Human Genome Project WorkingDraft, available at http://genome.ucsc.edu). We also searchedthe human-genomesequence data base for previously unreporteddinucleotide repeat sequences within HRPT2 that might serveas the basis for new intragenic HRPT2 polymorphisms, identifiedtwo such regions within intron 10 and intron 14, and designedprimers from unique flanking sequences for PCR amplification:5'TGATTTCTCATGCATTTCCTG3' (intron 10 forward primer), 5'TAACTACCTGAAACCCATCAC3'(intron 10 reverse primer), 5'AATTAGTGTCACAGTATCTTA3' (intron14 forward primer), and 5'CTCAAAGTATCTATTAGGTA3' (intron 14reverse primer). These new intragenic markers were highly polymorphic,showing substantial frequencies of heterozygosity in our patients:60 percent for intron 10 and 50 percent for intron 14. Electrophoresisof fluorescently labeled products in an ABI Prism 377 Sequencerwas followed by pattern analysis with the use of Genescan andGenotyper software (Applied Biosystems).27 An allelic imbalancewas identified by an analysis of the heights of allele peaksin tumor and control samples27 and was considered to indicatea loss of heterozygosity when the contribution of the minorityallele was repeatedly negligible.
Results
We identified HRPT2 mutations in parathyroid carcinomas from10 of 15 patients with apparently sporadic disease. All mutationswere predicted to inactivate the encoded protein, parafibromin,which is also affected in the HPT-JT syndrome.19 A total of15 different HRPT2 mutations, spanning six exons, were identifiedin 12 tumors from 10 of the 15 patients (Table 1). Five mutationsresulted directly in a premature stop codon, and 10 gave riseto an altered reading frame, typically with an early stop codonalso following shortly in the altered frame (Table 1). Testingof germ-line DNA showed that eight HRPT2 mutations (from sixpatients) were somatic, and two distinct somatic mutations werefound in tumors from two of these patients. Two mutations werealso found in each tumor from two additional patients, but itwas not possible to determine the somatic or germ-line statusof these mutations.
Unexpectedly, HRPT2 mutations found in the parathyroid carcinomasof three patients were identified as germ-line mutations (Table 1and Figure 1), even though none of these patients had a knownfamily history of the HPT-JT syndrome or presented with clinicalevidence thereof. None of these germ-line mutations were presentin 150 control subjects, nor were other mutations found in thesequenced exons. Two of these germ-line mutations (664C>Tand 373insA) were not reported in a previous study of kindredswith the HPT-JT syndrome,19 whereas one (679insAG) was.19 Patient8 had a germ-line mutation in one allele of HRPT2 and a tumor-specificsomatic HRPT2 mutation in the other allele (Table 1).
Figure 1. Examples of Somatic and Germ-Line Mutations of the HRPT2 Gene in Sporadic Parathyroid Carcinoma.
Sequencing chromatograms in Panel A show two distinct somatic mutations of HRPT2 in exon 1 (82del4) and exon 8 (732delT) in tumor DNA from Patient 1. The acquired nature of both mutations (each chromatogram represents a single allele after subcloning of PCR products) is evidenced by the presence of the wild-type (normal) sequence alone in the germ-line control DNA from the same patient and is consistent with the presence of a tumor-suppressor mechanism. Panel B shows parathyroid-carcinoma DNA with an acquired disruption of both HRPT2 alleles owing to a somatic mutation plus loss of heterozygosity. Tumor DNA from Patient 4 carries a somatic mutation 39delC in exon 1 of HRPT2; somatic elimination of the tumor's nonmutant HRPT2 allele was also evident, since the sequence of total tumor DNA shown in this chromatogram was identical to that of the mutant allele after its isolation by subcloning (not shown) and was not obscured by the concomitant overlapping presence of a normal allele. Allelic inactivation of HRPT2 by loss of heterozygosity was further demonstrated at the intragenic intron 10 polymorphic marker, as shown on the right side of Panel B, in which one of the two germ-line alleles was lost in tumor DNA (arrow). This tumor also manifested loss of heterozygosity at D1S413, at a location telomeric to HRPT2 (data not shown). A centromeric border for the loss-of-heterozygosity event was delimited by the retention of both alleles at D1S542; the exon 14 marker was uninformative. Panel C shows a heterozygous germ-line mutation in exon 7 of HRPT2 (664C>T; arrows), predicted to inactivate the gene product, in both directly sequenced tumor DNA and germ-line DNA from Patient 6.
The availability of germ-line DNA from 11 of the 15 patientsallowed examination of their tumors for loss of heterozygositywithin or near HRPT2. Loss of heterozygosity was identifiedin one carcinoma, from Patient 4 (Table 1 and Figure 1B). Parathyroidcarcinomas from 6 of the 10 patients whose tumors revealed mutationshad two HRPT2 lesions (Table 1). In tumor tissue from Patient4, one allele contained a somatic frame-shift mutation and theother was deleted (Table 1 and Figure 1B); each of the otherfive tumors had two distinct intragenic HRPT2 mutations (Table 1and Figure 1).
In the four instances in which more than one tumor sample wasavailable from a single patient, representing primary tumorplus a local recurrence or a metastasis or multiple metastases,all samples had the same HRPT2 gene status (Table 1). Thesepatients included two (Patients 5 and 7) for whom the identicalsomatic mutation was present in both primary tumor and a metastasisor a local recurrence (Table 1).
Discussion
There has been considerable progress in elucidating the pathogenesisof sporadic parathyroid adenomas,19,28,29 but the molecularroots of parathyroid carcinoma are obscure. The identificationof mutations in HRPT2 in patients with the HPT-JT syndrome,in which parathyroid carcinoma is overrepresented despite themore common presence of benign parathyroid tumors, led us toevaluate whether HRPT2 is involved in sporadic parathyroid carcinoma.We found mutations of the HRPT2 gene in sporadic parathyroidcarcinomas from 10 of 15 patients. The demonstration of tumor-specific,acquired HRPT2 mutations in multiple parathyroid carcinomasmarks these tumors as clonal expansions, each derived from anoriginal cell that had undergone HRPT2 mutation and had gaineda selective advantage. Therefore, HRPT2 mutation is very likelyan important contributor to the pathogenesis of parathyroidcarcinoma. Consistent with this conclusion are the findingsof unexpected germ-line mutations in HRPT2 in certain patientswith apparently sporadic parathyroid carcinoma. The concordantHRPT2 status among tumors in patients who had more than onesample available for analysis is consistent with the conceptthat HRPT2 mutation may influence the phenotype of parathyroidcarcinoma, including its metastatic potential, at an early stageof tumorigenesis. The likelihood that the observed mutationsinactivated the HRPT2 gene product and the finding that multipleparathyroid carcinomas each contained such distinct inactivatingHRPT2 lesions indicate that a tumor-suppressor gene mechanism16is involved in HRPT2's contribution to tumorigenesis.
Atypical parathyroid adenomas and parathyromatosis30 are lesionsthat share some phenotypic features with parathyroid carcinomabut fail to fulfill rigorous criteria for cancer; study of theirHRPT2 status should help clarify the extent to which they resembleparathyroid carcinoma on a molecular level. The mechanisms ofaction of parafibromin the protein encoded by HRPT2 in cell physiology and tumor suppression are unknown.Nonetheless, our findings indicate that parafibromin is a potentialtarget for new therapeutic agents that could benefit patientswith parathyroid carcinoma.
Patients with apparently sporadic parathyroid carcinoma whocarry germ-line mutations in HRPT2 may, on further investigationof their clinical features and relatives, turn out to have theHPT-JT syndrome31,32 or phenotypic variants of the syndrome,perhaps with altered penetrance of the mutation. Two of thegerm-line mutations we identified (664C>T and 373insA) werenot reported in a previous study of kindreds with the HPT-JTsyndrome,19 whereas one (679insAG) was,19 raising the possibilityof a mutational "hot spot" or a familial relationship unknownto the patient.
The identification of a germ-line HRPT2 mutation in a patientwith apparently sporadic parathyroid carcinoma requires cliniciansto reconsider the approach to this patient and raises new managementissues with respect to his or her relatives. When hyperparathyroidismrecurs or worsens in such a patient, a new and distinct primaryparathyroid tumor, benign or malignant, should be carefullysought in addition to a recurrence or progression of the originalcarcinoma, because asynchronous primary parathyroid neoplasmscan develop in patients with the HPT-JT syndrome. Surveillancefor renal and jaw neoplasia may also be indicated.
Susceptibility to the development of parathyroid carcinoma orother manifestations of the HPT-JT syndrome may exist in therelatives of a patient with apparently sporadic parathyroidcarcinoma who has an HRPT2 germ-line mutation if they also carrythe mutation. Monitoring of serum calcium levels is warrantedin such family members, with the goal of early diagnosis andtreatment of an incipient or premetastatic parathyroid cancer.If primary hyperparathyroidism develops in a relative who isat risk, surgery aimed at identifying and examining all parathyroidglands could be advocated, even if a more limited approach mightotherwise have been chosen.
We suggest that HRPT2 germ-line DNA testing should be seriouslyconsidered for patients presenting with apparently sporadicparathyroid carcinoma. The identification of a coding mutationwould be definitive, although a negative result would not ruleout the existence of an undetected, noncoding mutation, andindeed, the latter are expected, since germ-line HRPT2 codingmutations were not found in affected members of almost halfof families with classic HPT-JT syndrome.19 A separate questionis whether and when genetic testing should be offered to at-riskrelatives of a patient who has parathyroid carcinoma with anHRPT2 germ-line mutation. Genotyping of such family membersfor this recognized mutation would enable the focused implementationof clinical and biochemical monitoring of carriers of the mutationand offer reassurance to family members who do not have themutation. Monitoring serum calcium levels in all persons atrisk provides an alternative to definitive DNA diagnosis.
Supported by the Murray-Heilig Fund in Molecular Medicine, theSwedish Cancer Foundation, the Nilsson-Ehle Foundation, theRobert Lundberg Foundation, the Torsten and Ragnar SöderbergFoundations, the Gustav V Jubilee Foundation, and the Emil andVera Cornell Foundation.
We are indebted to Dr. Anders Höög for expert histopathologicalevaluations and to Ms. Pamela Vachon for expert administrativeassistance.
Source Information
From the Center for Molecular Medicine (T.M.S., A.A.) and the Division of Endocrinology and Metabolism (A.A.), University of Connecticut School of Medicine, Farmington; the Departments of Molecular Medicine (S.V., C.L.) and Surgical Sciences (S.V., L.-O.F.), Karolinska Hospital, Stockholm, Sweden; the Department of Endocrine Surgery, Tokyo Women's Medical University, Sinjuku-ku, Tokyo, Japan (T.O.); the Department of Surgery, Massachusetts General Hospital, Boston (R.D.G.); the Department of Surgery, University of California, San Francisco, Mt. Zion Medical Center, San Francisco (O.H.C.); the Endocrine Research Unit, Veterans Affairs Medical Center, University of California, San Francisco, San Francisco (D.S.); the Division of Endocrinology, University of Colorado, Veterans Affairs Medical Center, Denver (M.E.W.); the Division of Diabetes and Endocrinology, Department of Internal Medicine, Jikei University School of Medicine, Tokyo, Japan (K.T.); and the Cancer Genetics Branch, National Human Genome Research Institute, National Institutes of Health, Bethesda, Md. (C.M.R., J.D.C.). Ms. Shattuck and Dr. Välimäki contributed equally to this article.
Address reprint requests to Dr. Arnold at the Center for Molecular Medicine, University of Connecticut School of Medicine, 263 Farmington Ave., Farmington, CT 06030-3101, or at molecularmedicine{at}uchc.edu, or to Dr. Larsson at catharina.larsson{at}cmm.ki.se.
References
Wang CA, Gaz RD. Natural history of parathyroid carcinoma: diagnosis, treatment, and results. Am J Surg 1985;149:522-527. [Medline]
Shane E. Clinical review 122: parathyroid carcinoma. J Clin Endocrinol Metab 2001;86:485-493. [Free Full Text]
Bondeson L, Sandelin K, Grimelius L. Histopathological variables and DNA cytometry in parathyroid carcinoma. Am J Surg Pathol 1993;17:820-829. [CrossRef][Web of Science][Medline]
Roth SI. Pathology of the parathyroids in hyperparathyroidism. Arch Pathol 1962;73:495-510. [Medline]
Vetto JT, Brennan MF, Woodruf J, Burt M. Parathyroid carcinoma: diagnosis and clinical history. Surgery 1993;114:882-892. [Web of Science][Medline]
Sandelin K, Thompson NW, Bondeson L. Metastatic parathyroid carcinoma: dilemmas in management. Surgery 1991;110:978-986. [Medline]
Sandelin K, Auer G, Bondeson L, Grimelius L, Farnebo LO. Prognostic factors in parathyroid cancer: a review of 95 cases. World J Surg 1992;16:724-731. [CrossRef][Medline]
Anderson BJ, Samaan NA, Vassilopoulou-Sellin R, Ordonez NG, Hickey RC. Parathyroid carcinoma: features and difficulties in diagnosis and management. Surgery 1983;94:906-915. [Medline]
Cryns VL, Thor A, Xu HJ, et al. Loss of the retinoblastoma tumor-suppressor gene in parathyroid carcinoma. N Engl J Med 1994;330:757-761. [Free Full Text]
Pearce SH, Trump D, Wooding C, Sheppard MN, Clayton RN, Thakker RV. Loss of heterozygosity studies at the retinoblastoma and breast cancer susceptibility (BRCA2) loci in pituitary, parathyroid, pancreatic and carcinoid tumors. Clin Endocrinol (Oxf) 1996;45:195-200. [CrossRef][Medline]
Dotzenrath C, Teh BT, Farnebo F, et al. Allelic loss of the retinoblastoma tumor suppressor gene: a marker for aggressive parathyroid tumors? J Clin Endocrinol Metab 1996;81:3194-3196. [Abstract]
Kytölä S, Farnebo F, Obara T, et al. Patterns of chromosomal imbalances in parathyroid carcinomas. Am J Pathol 2000;157:579-586. [Free Full Text]
Imanishi Y, Palanisamy N, Tahara H, et al. Molecular pathogenetic analysis of parathyroid carcinoma. J Bone Miner Res 1999;14:Suppl 1:S421-S421.
Agarwal SK, Schrock E, Kester MB, et al. Comparative genomic hybridization analysis of human parathyroid tumors. Cancer Genet Cytogenet 1998;106:30-36. [CrossRef][Web of Science][Medline]
Haber D, Harlow E. Tumour-suppressor genes: evolving definitions in the genomic age. Nat Genet 1997;16:320-322. [CrossRef][Web of Science][Medline]
Shattuck TM, Kim TS, Costa J, et al. Mutational analyses of RB and BRCA2 as candidate tumour suppressor genes in parathyroid carcinoma. Clin Endocrinol (Oxf) 2003;59:180-189. [Medline]
Costa J, Shattuck TM, Imanishi Y, et al. Mutational analyses of connexin 26, connexin 30 and connexin 46 as candidate tumor suppressor genes in parathyroid carcinoma. J Endocr Genet 2003;3:57-62.
Carpten JD, Robbins CM, Villablanca A, et al. HRPT2, encoding parafibromin, is mutated in hyperparathyroidism-jaw tumor syndrome. Nat Genet 2002;32:676-680. [CrossRef][Web of Science][Medline]
Jackson CE, Norum RA, Boyd SB, et al. Hereditary hyperparathyroidism and multiple ossifying jaw fibromas: a clinically and genetically distinct syndrome. Surgery 1990;108:1006-1012. [Web of Science][Medline]
Wassif WS, Farnebo F, Teh BT, et al. Genetic studies of a family with hereditary hyperparathyroidism-jaw tumour syndrome. Clin Endocrinol (Oxf) 1999;50:191-196. [CrossRef][Medline]
Kennett S, Pollick H. Jaw lesions in familial hyperparathyroidism. Oral Surg Oral Med Oral Pathol 1971;31:502-510. [CrossRef][Medline]
Eversole LR, Leider AS, Nelson K. Ossifying fibroma: a clinicopathologic study of sixty-four cases. Oral Surg Oral Med Oral Pathol 1985;60:505-511. [Medline]
Szabo J, Heath B, Hill VM, et al. Hereditary hyperparathyroidism-jaw tumor syndrome: the endocrine tumor gene HRPT2 maps to chromosome 1q21
[PDB]
-q31. Am J Hum Genet 1995;56:944-950. [Web of Science][Medline]
Teh BT, Farnebo F, Kristoffersson U, et al. Autosomal dominant primary hyperparathyroidism and jaw tumor syndrome associated with renal hamartomas and cystic kidney disease: linkage to 1q21
[PDB]
-q32 and loss of the wild-type allele in renal hamartomas. J Clin Endocrinol Metab 1996;81:4204-4211. [Abstract]
Haven CJ, Wong FK, van Dam EW, et al. A genotypic and histopathological study of a large Dutch kindred with hyperparathyroidism-jaw tumor syndrome. J Clin Endocrinol Metab 2000;85:1449-1454. [Free Full Text]
Shattuck TM, Costa J, Bernstein M, Jensen RT, Chung DC, Arnold A. Mutational analysis of Smad3, a candidate tumor suppressor implicated in TGF- and menin pathways, in parathyroid adenomas and enteropancreatic endocrine tumors. J Clin Endocrinol Metab 2002;87:3911-3914. [Free Full Text]
Arnold A, Shattuck TM, Mallya SM, et al. Molecular pathogenesis of primary hyperparathyroidism. J Bone Miner Res 2002;17:Suppl 2:N30-N36.
Marx SJ. Hyperparathyroid and hypoparathyroid disorders. N Engl J Med 2000;343:1863-1875. [Erratum, N Engl J Med 2001;344:240, 696.] [Free Full Text]
Fitko R, Roth SI, Hines JR, Roxe DM, Cahill E. Parathyromatosis in hyperparathyroidism. Hum Pathol 1990;21:234-237. [Medline]
Marx SJ, Simonds WF, Agarwal SK, et al. Hyperparathyroidism in hereditary syndromes: special expressions and special managements. J Bone Miner Res 2002;17:Suppl 2:N37-N43.
Simonds WF, James-Newton LA, Agarwal SK, et al. Familial isolated hyperparathyroidism: clinical and genetic characteristics of 36 kindreds. Medicine (Baltimore) 2002;81:1-26. [CrossRef][Medline]
Yang, Y.-J., Han, J.-W., Youn, H.-D., Cho, E.-J.
(2009). The tumor suppressor, parafibromin, mediates histone H3 K9 methylation for cyclin D1 repression. Nucleic Acids Res
0: gkp991v1-gkp991
[Abstract][Full Text]
Hahn, M. A, McDonnell, J., Marsh, D. J
(2009). The effect of disease-associated HRPT2 mutations on splicing. J Endocrinol
201: 387-396
[Abstract][Full Text]
Eastell, R., Arnold, A., Brandi, M. L., Brown, E. M., D'Amour, P., Hanley, D. A., Rao, D. S., Rubin, M. R., Goltzman, D., Silverberg, S. J., Marx, S. J., Peacock, M., Mosekilde, L., Bouillon, R., Lewiecki, E. M.
(2009). Diagnosis of Asymptomatic Primary Hyperparathyroidism: Proceedings of the Third International Workshop. J. Clin. Endocrinol. Metab.
94: 340-350
[Abstract][Full Text]
Howell, V. M., Gill, A., Clarkson, A., Nelson, A. E., Dunne, R., Delbridge, L. W., Robinson, B. G., Teh, B. T., Gimm, O., Marsh, D. J.
(2009). Accuracy of Combined Protein Gene Product 9.5 and Parafibromin Markers for Immunohistochemical Diagnosis of Parathyroid Carcinoma. J. Clin. Endocrinol. Metab.
94: 434-441
[Abstract][Full Text]
Rozenblatt-Rosen, O., Nagaike, T., Francis, J. M., Kaneko, S., Glatt, K. A., Hughes, C. M., LaFramboise, T., Manley, J. L., Meyerson, M.
(2009). The tumor suppressor Cdc73 functionally associates with CPSF and CstF 3' mRNA processing factors. Proc. Natl. Acad. Sci. USA
106: 755-760
[Abstract][Full Text]
Masi, G., Barzon, L., Iacobone, M., Viel, G., Porzionato, A., Macchi, V., De Caro, R., Favia, G., Palu, G.
(2008). Clinical, genetic, and histopathologic investigation of CDC73-related familial hyperparathyroidism. Endocr Relat Cancer
15: 1115-1126
[Abstract][Full Text]
Lin, L., Zhang, J.-H., Panicker, L. M., Simonds, W. F.
(2008). The parafibromin tumor suppressor protein inhibits cell proliferation by repression of the c-myc proto-oncogene. Proc. Natl. Acad. Sci. USA
105: 17420-17425
[Abstract][Full Text]
Rubin, M. R, Bilezikian, J. P, Birken, S., Silverberg, S. J
(2008). Human chorionic gonadotropin measurements in parathyroid carcinoma. Eur J Endocrinol
159: 469-474
[Abstract][Full Text]
Wang, P., Bowl, M. R., Bender, S., Peng, J., Farber, L., Chen, J., Ali, A., Zhang, Z., Alberts, A. S., Thakker, R. V., Shilatifard, A., Williams, B. O., Teh, B. T.
(2008). Parafibromin, a Component of the Human PAF Complex, Regulates Growth Factors and Is Required for Embryonic Development and Survival in Adult Mice. Mol. Cell. Biol.
28: 2930-2940
[Abstract][Full Text]
Weber, F., Eng, C.
(2008). Update on the Molecular Diagnosis of Endocrine Tumors: Toward -omics-Based Personalized Healthcare?. J. Clin. Endocrinol. Metab.
93: 1097-1104
[Abstract][Full Text]
Selvarajan, S, Sii, L-H, Lee, A, Yip, G, Bay, B-H, Tan, M-H, Teh, B-T, Tan, P-H
(2008). Parafibromin expression in breast cancer: a novel marker for prognostication?. J. Clin. Pathol.
61: 64-67
[Abstract][Full Text]
Cetani, F, Pardi, E, Ambrogini, E, Viacava, P, Borsari, S, Lemmi, M, Cianferotti, L, Miccoli, P, Pinchera, A, Arnold, A, Marcocci, C
(2007). Different somatic alterations of the HRPT2 gene in a patient with recurrent sporadic primary hyperparathyroidism carrying an HRPT2 germline mutation. Endocr Relat Cancer
14: 493-499
[Abstract][Full Text]
Juhlin, C C, Villablanca, A, Sandelin, K, Haglund, F, Nordenstrom, J, Forsberg, L, Branstrom, R, Obara, T, Arnold, A, Larsson, C, Hoog, A
(2007). Parafibromin immunoreactivity: its use as an additional diagnostic marker for parathyroid tumor classification. Endocr Relat Cancer
14: 501-512
[Abstract][Full Text]
Cetani, F., Ambrogini, E., Viacava, P., Pardi, E., Fanelli, G., Naccarato, A. G., Borsari, S., Lemmi, M., Berti, P., Miccoli, P., Pinchera, A., Marcocci, C.
(2007). Should parafibromin staining replace HRTP2 gene analysis as an additional tool for histologic diagnosis of parathyroid carcinoma?. Eur J Endocrinol
156: 547-554
[Abstract][Full Text]
Raue, F., Frank-Raue, K.
(2007). Primary hyperparathyroidism--what the nephrologist should know--an update. Nephrol Dial Transplant
22: 696-699
[Full Text]
Lin, L., Czapiga, M., Nini, L., Zhang, J.-H., Simonds, W. F.
(2007). Nuclear Localization of the Parafibromin Tumor Suppressor Protein Implicated in the Hyperparathyroidism-Jaw Tumor Syndrome Enhances Its Proapoptotic Function. Mol Cancer Res
5: 183-193
[Abstract][Full Text]
Howell, V. M., Cardinal, J. W., Richardson, A.-L., Gimm, O., Robinson, B. G., Marsh, D. J.
(2006). Rapid Mutation Screening for HRPT2 and MEN1 Mutations Associated with Familial and Sporadic Primary Hyperparathyroidism. J. Mol. Diagn.
8: 559-566
[Abstract][Full Text]
Marx, S. J., Simonds, W. F.
(2006). Imaging to detect early endocrine cancers.. J. Clin. Endocrinol. Metab.
91: 2861-2863
[Full Text]
Guarnieri, V., Scillitani, A., Muscarella, L. A., Battista, C., Bonfitto, N., Bisceglia, M., Minisola, S., Mascia, M. L., D'Agruma, L., Cole, D. E. C.
(2006). Diagnosis of Parathyroid Tumors in Familial Isolated Hyperparathyroidism with HRPT2 Mutation: Implications for Cancer Surveillance. J. Clin. Endocrinol. Metab.
91: 2827-2832
[Abstract][Full Text]
Juhlin, C, Larsson, C, Yakoleva, T, Leibiger, I, Leibiger, B, Alimov, A, Weber, G, Hoog, A, Villablanca, A
(2006). Loss of parafibromin expression in a subset of parathyroid adenomas.. Endocr Relat Cancer
13: 509-523
[Abstract][Full Text]
Rubin, M. R., Silverberg, S. J.
(2005). HRPT2 in Parathyroid Cancer: A Piece of the Puzzle. J. Clin. Endocrinol. Metab.
90: 5505-5507
[Full Text]
Krebs, L. J., Shattuck, T. M., Arnold, A.
(2005). HRPT2 Mutational Analysis of Typical Sporadic Parathyroid Adenomas. J. Clin. Endocrinol. Metab.
90: 5015-5017
[Abstract][Full Text]
Marx, S. J., Simonds, W. F.
(2005). Hereditary Hormone Excess: Genes, Molecular Pathways, and Syndromes. Endocr. Rev.
26: 615-661
[Abstract][Full Text]
Bradley, K J, Cavaco, B M, Bowl, M R, Harding, B, Young, A, Thakker, R V
(2005). Utilisation of a cryptic non-canonical donor splice site of the gene encoding PARAFIBROMIN is associated with familial isolated primary hyperparathyroidism. J. Med. Genet.
42: e51-e51
[Abstract][Full Text]
Yart, A., Gstaiger, M., Wirbelauer, C., Pecnik, M., Anastasiou, D., Hess, D., Krek, W.
(2005). The HRPT2 Tumor Suppressor Gene Product Parafibromin Associates with Human PAF1 and RNA Polymerase II. Mol. Cell. Biol.
25: 5052-5060
[Abstract][Full Text]
Forsberg, L., Bjorck, E., Hashemi, J., Zedenius, J., Hoog, A., Farnebo, L.-O., Reimers, M., Larsson, C.
(2005). Distinction in gene expression profiles demonstrated in parathyroid adenomas by high-density oligoarray technology. Eur J Endocrinol
152: 459-470
[Abstract][Full Text]
Moon, S.-D., Park, J.-H., Kim, E.-M., Kim, J.-H., Han, J.-H., Yoo, S.-J., Yoon, K.-H., Kang, M.-I., Lee, K.-W., Son, H.-Y., Kang, S.-K., Oh, S.-J., Kim, K.-M., Yoon, S.-J. K., Park, J.-G., Kim, I.-J., Kang, H. C., Hong, S.-W., Kim, K.-R., Cha, B.-Y.
(2005). A Novel IVS2-1G>A Mutation Causes Aberrant Splicing of the HRPT2 Gene in a Family with Hyperparathyroidism-Jaw Tumor Syndrome. J. Clin. Endocrinol. Metab.
90: 878-883
[Abstract][Full Text]
Rozenblatt-Rosen, O., Hughes, C. M., Nannepaga, S. J., Shanmugam, K. S., Copeland, T. D., Guszczynski, T., Resau, J. H., Meyerson, M.
(2005). The Parafibromin Tumor Suppressor Protein Is Part of a Human Paf1 Complex. Mol. Cell. Biol.
25: 612-620
[Abstract][Full Text]
Cetani, F., Pardi, E., Borsari, S., Viacava, P., Dipollina, G., Cianferotti, L., Ambrogini, E., Gazzerro, E., Colussi, G., Berti, P., Miccoli, P., Pinchera, A., Marcocci, C.
(2004). Genetic Analyses of the HRPT2 Gene in Primary Hyperparathyroidism: Germline and Somatic Mutations in Familial and Sporadic Parathyroid Tumors. J. Clin. Endocrinol. Metab.
89: 5583-5591
[Abstract][Full Text]
Tan, M.-H., Morrison, C., Wang, P., Yang, X., Haven, C. J., Zhang, C., Zhao, P., Tretiakova, M. S., Korpi-Hyovalti, E., Burgess, J. R., Soo, K. C., Cheah, W.-K., Cao, B., Resau, J., Morreau, H., Teh, B. T.
(2004). Loss of Parafibromin Immunoreactivity Is a Distinguishing Feature of Parathyroid Carcinoma. Clin. Cancer Res.
10: 6629-6637
[Abstract][Full Text]
Betea, D., Bradwell, A. R., Harvey, T. C., Mead, G. P., Schmidt-Gayk, H., Ghaye, B., Daly, A. F., Beckers, A.
(2004). Hormonal and Biochemical Normalization and Tumor Shrinkage Induced by Anti-Parathyroid Hormone Immunotherapy in a Patient with Metastatic Parathyroid Carcinoma. J. Clin. Endocrinol. Metab.
89: 3413-3420
[Abstract][Full Text]