Deficiency on Maturation of
/ß and
/
T-Cell Lineages in Severe Combined Immunodeficiency
| |||||||||||||||||||||||||||||||||||||||||||||||||
and
or
and
variant chains, paired as mutually exclusive heterodimers in association with the invariant chains CD3
,
,
, and
. T cells with
and
chains are referred to as
/
T cells, and those with
and
chains are called
/
T cells. During development, the CD3 protein complex plays an important part in the transition of thymocytes from CD4CD8 double-negative immature precursors to a CD4+CD8+ double-positive stage and finally to the mature CD4+CD8 or CD4CD8+ single-positive T cell.1,2,3,4,5 Selective deficiency of CD3 component
,
,
, or
in mice, achieved by gene knockout, causes mild-to-severe, although incomplete, blockage of T-cell development.6,7,8,9,10 Similarly, CD3
or CD3
deficiency in humans brings about a partial arrest of T-cell maturation and only moderate immunodeficiency.11,12
We report a novel defect in the CD3
gene in three members of a kindred with a form of severe combined immunodeficiency (SCID) characterized by the absence of T cells but normal numbers of B cells (TB+ SCID). These three patients had an early arrest in T-cell development, with a nearly complete absence of circulating mature T cells and a complete lack of
/
T cells. Our results suggest that, unlike CD3
and CD3
, CD3
is essential for T-cell development.
Case Report
We studied a kindred of Mennonite descent that shared multiple consanguineous links across several generations. Three patients with SCID were identified in this family. SCID was diagnosed in Patient 1 immediately after birth, after an examination performed because of previous cases in the family (Patients 2 and 3). She subsequently underwent bone marrow transplantation and is alive and well, with full immune reconstitution, three years later. Patient 2, a male cousin of Patient 1, was admitted at the age of two months because of fever, tachypnea, and tachycardia. Rapidly developing respiratory arrest required assisted ventilation, and he died of multiorgan failure. Adenovirus was identified in stool, urine, and bronchial secretions.
Patient 3, a male cousin of Patients 1 and 2, was well and thriving until two and a half months of age, when chronic diarrhea developed. At three and a half months of age, the patient was admitted with respiratory distress, lethargy, and jaundice. On examination, he was noted to have hepatomegaly, and liver-function tests were markedly abnormal. He was transferred from another hospital with increased respiratory distress and died 12 hours later from rapidly developing refractory hypotension, liver failure, pulmonary hemorrhage, disseminated intravascular coagulopathy, and hemorrhagic shock. Cytomegalovirus was identified in multiple tissues obtained at autopsy.
Flow-cytometric analyses of peripheral-blood lymphocytes from these patients showed a slight reduction in total lymphocyte counts in Patients 1 and 2 and a marked reduction in Patient 3 (Table 1). The numbers of circulating mature CD3+ T cells were extremely low (3 to 7 cells per cubic millimeter), whereas CD4+ or CD8+ T cells were undetectable. In contrast, the number of B cells, as determined by staining for CD20, was either normal (in Patients 1 and 3) or increased (in Patient 2). The number of natural killer cells, as determined by staining for CD56, was normal in all patients.
|
Methods
Assays of Phenotype and Function of Peripheral-Blood Lymphocytes
Cell-surface markers of peripheral-blood lymphocytes were determined by immunofluorescence antibody staining and flow cytometry (Epics V, Coulter Electronics) with antibodies purchased from Coulter Diagnostics. In vitro lymphocyte proliferation induced by phytohemagglutinin was assayed by standard means.
Analysis of Thymic Tissue
After written informed consent was obtained from the parents of the patients and control infants, samples of thymus tissue obtained by biopsy (Patient 1), at autopsy (Patient 3), and from four infants undergoing cardiac surgery were obtained for analysis. Then, 4-µm serial sections of frozen thymus tissue were mounted on glass slides, air-dried, and stained with hematoxylin and eosin or with specific antibodies raised against the various T-cell receptor, CD3, CD4, and CD8 chains.
Western Blotting
Thymocytes obtained from Patient 1 or from normal thymus were isolated by centrifugation and lysed in 50 µl of lysis buffer (20 mM TRIS [pH 7.4], 150 mM sodium chloride, 1 percent Igepal CA-630, 5 mM EDTA, 2 mM sodium orthovanadate, and 1 mM phenylmethylsulfonylfluoride), incubated on ice for 15 minutes, and then centrifuged for 10 minutes at 12,000xg. The proteins in the supernatant were analyzed by a standard Western blotting technique with the use of antibodies against T-cell receptor
(SC-9100), T-cell receptor
(SC-5277), T-cell receptor
(SC-9854), T-cell receptor
(SC-1578), CD3
(SC-1125), CD3
(SC-1128), CD3
(SC-1179), CD3
(SC-1239), guanine nucleotidebinding protein
-inhibitory subunit 3 (G
-3, SC-262), CD4 (SC-7219), CD8
(SC-7970), and CD3
(SC-9147), all purchased from Santa Cruz Biotechnology.
Preparation of RNA, Genomic DNA, and Complementary DNA
RNA was prepared from thymocytes from the patients and controls with the use of the RNeasy kit (Qiagen), according to the manufacturer's suggestions. Random, primed first-strand complementary DNA (cDNA) was synthesized from 5 µg of total RNA with the use of SuperScript II RNase H Reverse Transcriptase (Invitrogen). Genomic DNA was prepared from EpsteinBarr virustransformed B-cell lines established from cells from both the patients and the controls or from peripheral-blood mononuclear cells obtained from other family members after FicollHypaque gradient centrifugation with use of the Wizard genomic DNApurification kit (Promega), according to the manufacturer's suggestions. Then, cDNA was used to amplify the CD3
coding sequence in a polymerase chain reaction (PCR) with use of the primers 5'ATCTACTGGATGAGTTCCGCTGGGAG3' and 5'CTGCTTCTAGAAGCCACCAGTCTCAG3'.
To amplify exon 2 of CD3
from genomic DNA by PCR, the primer sequences 5'AACTGTGATATTTTTTCCCCTT3' and 5'CAACCCAAAGGGTTCAGGAAGCAC3' were used. The resultant PCR products were resolved on 1 percent agarose gels, and the appropriate bands were removed and purified with use of the Qiaex II agarose-gel extraction kit (Qiagen). The purified products were directly sequenced with use of the Thermo Sequenase radiolabeled terminator cycle-sequencing kit (Amersham).
Microarray Analysis
The labeled probe was prepared as recommended by the manufacturers of the microarray (Affymetrix), and microarray analysis was performed at the Centre for Applied Genomics (Hospital for Sick Children, Toronto). Briefly, 20 µg of total RNA from patient and control thymocytes was used as a template for the synthesis of double-stranded cDNA. The cDNA was purified and used as a template for in vitro transcription with biotin-labeled nucleotides (Enzo Diagnostics). Labeled cRNA was fragmented and hybridized to Human Genechip microarrays (HG-U95A and HG-U133A, Affymetrix), which can detect 12,000 and 22,400 messenger RNA (mRNA) species, respectively, all representing annotated genes. The microarrays were scanned and the output files inspected for hybridization artifacts. Arrays without substantial artifacts were analyzed with the use of Microarray suite 5.0 software.14,15
The expression value for each gene was determined by calculating the average differences in intensity (perfect-match intensity minus mismatch intensity) of the pairs of probes for each gene and ensuring that the gene was present in the array. The differences in expression were calculated by comparing the values for the level of expression of genes from the patient divided by that for the controls. The results have been deposited in the Gene Expression Omnibus at http://www.ncbi.nlm.nih.gov/geo/ (accession number GSE 609).
Results
Microarray Analysis of Gene Expression in the Thymus of Patient 1
The combination of profound lymphocytopenia and a partially preserved thymus structure suggested that the defect in the three patients with SCID was restricted to T cells and involved a gene controlling T-cell differentiation. To identify the putative genetic defect, we compared gene expression in the thymus of Patient 1 with that of a normal thymus, using oligonucleotide microarrays. Remarkably, only a relatively small number of gene products known to regulate T-cell development were substantially altered in the patient, as compared with the control (Figure 1A and Figure 1B). Of particular interest were a reduction in T-cell receptor
and T-cell receptor
transcripts by a factor of 4.3 and 1.6, respectively; a reduction in transcripts of CD3
and CD3
by a factor of 2.3; and increases in T-cell receptor
and T-cell receptor
mRNA by a factor of 1.5 and 2.5, respectively (Figure 1A, Figure 1B, and Figure 1C).
|

Despite the lower-than-normal level of CD3
and CD3
transcripts in the thymus of Patient 1 (as estimated by microarray analysis), we were able to detect mRNA for both CD3 chains and for CD3
and CD3
using standard reverse-transcriptase PCR (data not shown). Sequence analysis of the CD3
, CD3
, and CD3
cDNA did not demonstrate any abnormalities. However, sequencing of the CD3
PCR product from Patient 1 revealed a homozygous C-to-T transition at nucleotide position 202, predicting a premature stop codon, with a truncation at residue 68 (R68stop) in the extracellular domain of the protein. The patient's genomic DNA contained this homozygous mutation in exon 2 of the CD3
gene (Figure 2A, Figure 2B, and Figure 2C).
|
allele were detected in the genomic DNA sequence of the parents of all three patients, consistent with the occurrence of autosomal recessive inheritance. Compatible with this mode of inheritance, siblings of Patients 1, 2, and 3 were either heterozygous for the CD3
mutation or completely normal (Figure 2A). The stop codon within exon 2 can explain the reduction in CD3
mRNA (by a factor of 2.3) in the thymus of Patient 1 through a nonsense-mediated decay mechanism.16,17 Despite the presence of detectable, albeit reduced, levels of CD3
mRNA (Figure 2D), CD3
protein was undetectable by Western blotting (Figure 2E). The immunodeficiency in these patients thus appears to arise from a heritable mutation of the CD3
gene that prevents the synthesis of the CD3
protein.
Proteins of the CD3 Complex in CD3
/ Thymocytes
In comparison with the levels of mRNA for CD3
and CD3
in normal thymocytes, the levels in thymocytes from Patient 1 were marginally altered (Figure 1C). However, the levels of CD3
and CD3
proteins were lower in the patient's thymocytes than in normal control samples (Figure 3), possibly because CD3 complexes lacking CD3
are rapidly degraded. A similar universal reduction in the expression of CD3 subunits was found in murine CD3
/ thymocytes.7 Unlike the CD3
and CD3
subunits, the CD3
mRNA level was lower (by a factor of 2.3) in the patient's thymocytes than in the control samples, and levels of the CD3
protein were undetectable on Western blot analysis (Figure 3).
|
, CD3
, CD3
, and CD3
. In contrast, CD3
, CD3
, and CD3
were not detected in the patient's thymus. Despite the lack of expression of these CD3 chains, the degree of staining for CD3
was similar to that in the control thymus (Figure 4), suggesting that CD3
, even at low cytoplasmic levels, may be transported to the cell membrane independently of the other CD3 chains.
|
/ Thymocytes at the CD4CD8 Stage of Development
The thymocytes of Patient 1 contained twice as much precursor T-cell receptor
(pT
) gene transcript as did control thymocytes (Figure 1B and Figure 1C). Since the pT
gene is expressed exclusively by immature thymocytes, these results indicate a block early in the differentiation of T cells in the patient's thymus. Such a block could cause immature CD4 CD8 double-negative thymocytes to accumulate. Indeed, we found reduced levels of CD4, CD8
, and CD8
1 mRNA and protein in CD3
/ thymocytes (Figure 1 and Figure 3), and immunohistochemical analysis of CD3
/ thymus sections was negative for both CD4 and CD8 (not shown). These results are all consistent with an arrest of differentiation at the CD4CD8 stage of T-cell development.
The
/
Lineage in CD3
Deficiency
The normal thymus contains only a very small number of
/
T cells, and these cells constitute up to 5 percent of circulating lymphocytes.18 The thymocytes from Patient 1 contained increased levels of T-cell receptor
and T-cell receptor
transcripts (Figure 1) and protein (Figure 3). However,
/
T cells could not be detected by flow cytometry in the peripheral blood of the three patients with CD3
deficiency (Table 1) or by immunohistochemical analysis of sections obtained from the thymus, lymph nodes, spleen, or gut of Patient 3 (not shown). These results indicate that although the T-cell receptor
and
chains are produced, they are not correctly assembled and transported to the cell surface in the absence of CD3
.
Discussion
Our three patients with SCID presented with low numbers of circulating T cells and normal numbers of peripheral B cells. This phenotype is typical of SCID caused by mutations in the gene for the common gamma chain (
c), Janus kinase 3 (Jak3), or interleukin-7 receptor
(IL-7R
).19,20,21 The
c and Jak3 genes are also important in the development of natural killer cells, and the numbers and function of natural killer cells are compromised in many, although not all,22,23 such cases of SCID. In SCID arising from aberrations in the IL-7R
gene, natural killer cells are preserved.24,25 Although our patients had a phenotype in which T cells were absent and B cells and natural killer cells were present, analysis of their
c, Jak3, and IL-7R
genes revealed no abnormality (data not shown). To define the molecular basis for the immunodeficiency in these patients, we used oligonucleotide microarray analysis of thymocytes isolated from biopsy material as a source of mRNA of T-cell lineage.
This analysis revealed a reduction in mRNA transcripts for all the chains of the CD3 complex except CD3
, as well as in mRNA transcripts for the
and
T-cell receptor chains. Extensive biochemical studies have demonstrated that T-cell development is dependent on the function of the CD3 complex,26,27,28,29,30 and mice deficient in CD3
, CD3
, CD3
, or CD3
have a variable degree of impairment of thymocyte maturation from the CD4CD8 to the CD4+CD8+ stage.6,7,8,9,10 Our three patients, who had virtually no mature T cells, carried a deleterious mutation in the region of CD3
that encodes the extracellular domain of CD3
. The mutation, a homozygous C-to-T transition that produced a premature stop codon, resulted in a complete lack of CD3
protein in thymocytes. Although only the CD3
gene of the CD3 complex was found to harbor a mutation, levels of both the CD3
and CD3
subunits were reduced in CD3
/ thymocytes, and CD3
was undetectable by Western blotting. This pattern may reflect the normal content of CD3 subunits in very immature thymocytes.31
Precursors of the
/
T-cell lineage undergo three major stages of maturation, defined by the expression of CD4 and CD8. The earliest precursors are designated double-negative, expressing neither CD4 nor CD8. They progress to a stage of dual expression of CD4 and CD8 (double-positive) before committing to the expression of either CD4 or CD8 alone (single-positive) and leaving the thymus. The transition from the double-negative to the double-positive stage requires a productive rearrangement of the T-cell receptor
gene, followed by signaling through a complex formed by the
chain of the T-cell receptor and the invariant pT
chain.1,2 This unit noncovalently associates with the CD3 chains to signal and promote thymocyte differentiation.1,2,3,4,5 Subsequently, the T-cell receptor
gene rearranges to allow formation of the mature T-cellreceptor
/
complex.1,32
In our Patient 1, the increased level of pT
transcript and the absence of a T-cellreceptor
gene product in the CD3
/ thymocytes are consistent with the properties of immature T cells that have not rearranged the T-cell receptor
locus and therefore do not display
/
receptors. The marked reduction in CD4 and CD8 mRNA and proteins points to a developmental arrest of these immature cells at the double-negative stage of
/
T-cell maturation. Moreover, the lack of detectable
/
T cells indicates that the development of this lineage is also arrested in patients with CD3
deficiency.
Supported by the Canadian Centre for Primary Immunodeficiency and by grants from the Jeffrey Modell Foundation and the Canadian Institutes of Health Research. Dr. Roifman is also supported by the Audrey and Donald Campbell Chair of Immunology at the Hospital for Sick Children at the University of Toronto.
We are indebted to Linda Quintal, Sandra Mendonca, Wilson Chan, and Dr. Chao Lu for technical assistance and assistance with manuscript preparation; and to Drs. Johanna Rommens, Michael Julius, and Nigel Sharfe for critical review of the manuscript.
Source Information
From the Divisions of Immunology and Allergy and the Infection, Immunity, Injury and Repair Program, the Research Institute and the Hospital for Sick Children, University of Toronto, Toronto.
Address reprint requests to Dr. Roifman at the Division of Immunology and Allergy and the Infection, Immunity, Injury and Repair Program, Hospital for Sick Children, 555 University Ave., Toronto, ON M5G 1X8, Canada, or at chaim.roifman{at}sickkids.ca.
References
chain of the T cell antigen receptor complex. Science 1993;261:918-921.
/
gene. EMBO J 1993;12:4347-4355. [Web of Science][Medline]
gene. EMBO J 1995;14:4641-4653. [Web of Science][Medline]
chain is essential for development of both the TCR
and TCR
lineages. EMBO J 1998;17:1871-1882. [CrossRef][Web of Science][Medline]
deficiency arrests development of the 
but not the 
T cell lineage. EMBO J 1997;16:1360-1370. [CrossRef][Web of Science][Medline]
gene resulting in a T cell receptor/CD3 complex immunodeficiency. Nat Genet 1993;3:77-81. [CrossRef][Web of Science][Medline]
subunit of the T-lymphocyte receptor. N Engl J Med 1992;327:529-533. [Web of Science][Medline]
/
T cells in a patient with CD4+CD3- lymphocytosis, hypereosinophilia, and high levels of IgE. J Allergy Clin Immunol 1998;102:621-630. [CrossRef][Web of Science][Medline]
chain mutation with normal thymus morphology. J Clin Invest 1997;100:3036-3043. [Medline]
chain causes a moderate form of X-linked combined immunodeficiency. J Clin Invest 1995;95:1169-1173. [Medline]
is sufficient to abrogate T-cell development and cause severe combined immunodeficiency. Blood 2000;96:2803-2807.
in surface expression of the TCR/CD3 complex and in activation for killing analyzed with a CD3
-negative cytotoxic T lymphocyte variant. J Immunol 1992;148:657-664. [Abstract]
and
subunits of the CD3 complex inhibit pre-Golgi degradation of newly synthesized T cell antigen receptors. J Cell Biol 1990;110:973-986.
| |||||||||||||||||||||||||||||||||||||||||||||||||
This article has been cited by other articles:
HOME | SUBSCRIBE | SEARCH | CURRENT ISSUE | PAST ISSUES | COLLECTIONS | PRIVACY | TERMS OF USE | HELP | beta.nejm.org Comments and questions? Please contact us. The New England Journal of Medicine is owned, published, and copyrighted © 2009 Massachusetts Medical Society. All rights reserved. |