Panel A shows the normal (control) band pattern for this segment. Patient 1 has only aberrant bands. Her mother has two normal bands and the same lower aberrant band as Patient 1. Her father has the two upper aberrant bands in addition to the two normal bands. Polymerase chain reaction (PCR) used [³²P]deoxycytidine triphosphate for labeling, 25 cycles with Taq polymerase (Life Technologies), and 5'GGACTACCGCAGCTACCGCTTCC3' as the forward primer and 5'CCCACAATGTAGTTATTGGACAC3' as the reverse primer. PCR products were electrophoresed on a 0.5x mutation–detection gel (MDE,FMC Bioproducts) containing 0.6x TRIS buffer (a 1x solution that consists of 89 mM TRIS, 89 mM boric acid, and 2 mM EDTA) at 12 to 16 W in a closed-buffer–backed system for 15 to 24 hours. An autoradiogram from an MDE gel with 10 percent glycerol is shown. In Panel B, the base substitutions are indicated by arrows, and the mutated codons are underlined. The double peaks indicate heterozygosity at these loci and show that the patient is a compound heterozygote, having inherited one mutation from each parent. Sequencing of DNA was performed with the use of standard, automated methods.

The mutation introduces a novel restriction site (DdeI). Sequencing of DNA was performed with the use of standard, automated methods after polymerase chain reaction.